%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf Datasheet_Percona_Server_for_MongoDB 2019-09-23T10:54:37-03:00 2019-09-23T10:54:37-03:00 2019-09-23T10:54:37-03:00 Adobe Illustrator CC 23.0 (Macintosh) 256 140 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAjAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9HQ+VPLRhQnTLYkqCT6a +HyzF/I4f5kfk5P5zN/OPzX/AOE/LX/Vstv+Ra/0x/I4f5kfkv5zN/OPzd/hPy1/1bLb/kWv9Mfy OH+ZH5L+czfzj82v8KeWv+rZbf8AItf6Y/kcP8yPyX85m/nH5selbyq83Cz0i0kjNeEkgVTIFJUt GiqxZaj7RpmsySxXUMcSPPr7nOj41eqcvx3pjpmm+Ub4mIabaLcKodo1VXBUgGqtRaj4hXbuPEZl YMODJtwRtx8uXPDfilS0RflsQCH0ohpzaKfUg3uB1hG/94P5OuZP5HD/ADI/Jp/OZv5x+a6K0/Lu WFZ4hpkkDzi1SVGhZDcHpCGBoZP8nrj+Rw/zI/Jfzmb+cfm6a1/LqCOSSb9FxRxTNbSu7wqqzopd omJOzqilivWm+P5HD/Mj8l/OZv5x+aLh8v8Ak+eWeKGys5JbZglzGixs0blQ4VwPskqwbfscfyOH +ZH5L+czfzj81X/Cnlr/AKtlt/yLX+mP5HD/ADI/Jfzmb+cfm7/Cnlr/AKtlt/yLX+mP5HD/ADI/ Jfzmb+cfm7/Cnlr/AKtlt/yLX+mP5HD/ADI/Jfzmb+cfmi9N03T7B5UsreO3RwjOsahQT8QqaZbj wwx/SAGrJllP6jaOy1rdirsVdiqXa15f0vWoo4tQjMiRMWQBmWhIp+yRmPqNLDMAJjk34NTPESYn mwL8w9K8peT9AXVv0UbzncxW3pPdyW6j1SRzaTjLQLTf4cxf5Jwd32lyf5Uz9/2BiF3r+i20RkOg 6TKo509LzNE1QoZgR+6/b4Hj38QNsf5Jwd32lf5Uz9/2Bif/ACufyj/1Jj/9xST/AKoY/wAk4O77 Sv8AKmfv+wO/5XP5R/6kx/8AuKSf9UMf5Jwd32lf5Uz9/wBgRmj/AJreUdR1O3sf8IPF67cPU/Sc jU2rWnoiv34/yTg7vtK/ypn7/sD0y30ny1OImGm2kaSosgaTVivHmK8WXhzBFaHbrj/JODu+0r/K mfv+wJMdR8o/9WB/+k2T/mjH+ScHd9pX+VM/f9gd+kfKP/Vgf/pNk/5ox/knB3faV/lTP3/YHfpH yj/1YH/6TZP+aMf5Jwd32lf5Uz9/2B36R8o/9WB/+k2T/mjH+ScHd9pX+VM/f9gd+kfKP/Vgf/pN k/5ox/knB3faV/lTP3/YFayufKNzeQW36CdPWkSPn9ckNObAVpwHjj/JODu+0r/Kmfv+wM9/5Vt5 R/5ZX/5Gyf8ANWP8k4O77Sv8qZ+/7AyKD+4j/wBUfqzZOvX4q1iqhfwyzWNxDC3CWSJ0jepFGZSA aj3yMxYIDKBAkCXgejza7NZRJqELtDaSNa31hJVB9ZtwVioBT1GCIqJDvViSftZoI4zVHl3eY/HJ 6rLwA+k7ncHyPP3d99zKfy9s/Mcnno3E0UkOkWlgERpBQszBEPMVI5yOjOSpINNmPXMrR4iMl9AP x+twdfPH4Fc5GX4/Um0/k6WDVjBB5cjm02yum1bTryK5WCVrwjkfV5F2cszsFJACgDNgZTEjtYdd HHhMATMifUVa2y8lpDaSLb+W5bK7jupr+0YagGQzoqxL6siOkgSdEFUAYDvh4p19P2oOLCCPXY2v Y3517ksvPJ/1nSxaX3kist3dNeNDBffALlIrjj8S1EcdX+BSwXlJ2pvDxMnWO/vbvy2nJNZfSP6P u/b8mR+QNE1ux1XW7/U9NSxl1NopnlWUuZpKyMxZPXuVTh6nEcSBSnWmSxGZviFfj3tWrhgiB4Uj I73+joGa5e4TsVdirUf98/8Aqr+tsVVcVdirsVdirsVQOt2en32mTWeoStDaTgLI8cz2zjcEcZY2 jdTUfstirEB+XfkL1zNJqmoSv8QX1Nbvm4h04MFrcV6fTiqIj8k+S45BJHrGoqwf1B/uc1AryrX7 BuSpHsRiqN0Ly/5R0OSGSw1Cf9xG0SRz6nc3EfF2LtWKaZ4yanrxqO2Kp9+ldL/5bIP+Rif1xV4n f2nmltX1d7KO/iaa+klsblLsi39Nrz1d4hr0SsGRSP7uOoNKKNiqgrzS/Pt7dPHPcXPCSGNYr2O4 uI0jYekarEdfYhhxIJ9Pdq9RiqHOjeeYI7cQyX9y7RxhybuaOhl5M3wHzBHGhiQKrL3bo2Kp/B5C 1zVLGzvh5iTSLkxyCayuZ9SEqO8zO+9trUiUdjyFGJAoCewVTIflq00jS3/meGeU0KyRXerQkEk+ oPi1SYhWViOKkDFVbT/y/uLfXLO6n82CTTIwxvbaO91OOSRgX9Li76jKBRSnIsCfhPZtlWXWWg+W LfVl1GHU7uS658lik1W7lgLFWSn1Zp2hIo+w4dd+uKsmxVSg/uI/9UfqxV5nqv5x2Y1Jho2raHPY NGFhW9mubWZZ1Px8z6Ui8aEU2Hz8FUrj/PC7kSzlS70JVkceuk0t/CGQEiTg7244FW4j7Ld8VTbT /wA3ork2sZvtAaZ7hUuFS/nVvRclVMSNbVaQtTb9Q+IKsN1LzbH5mhtDcQeVb+7vZlhaUXl3btyK /uTLCVimK8mCgsTuegoTlM8EJ8w5OHV5cf0ypkGkfmJB5dsLe0e48sW9qkkiyJYXMyx7brxMcdxy crTk2+/bbLIQERQasmSUzcjZRdv+aus3rzw2Vz5be4DyRW6i/uHQuPijBf0I1IMaSHlsGp2yTW0P zW1trx7aOby6/rCWTT2N/OpliQOA1FgkAo0ZBDFTsR4HFUOPzj1I24ka98sikczMV1Cd25KpEX7v 0VIrINxU1HgKEqomP84Z0uJoLufQYmimji9T69c+mSas6s/1UhPgU8S3cdN9lUNZ/nHq95dSQW03 l1/TlVD/AKddCquUVSGNv05vTl+HfFV8f5yXiG8iurjy+s9pJHC6m9vIwJA4Eq0a0PL4a049KftY qz/yt5u0LzNZPdaRdJdJCVS4MYkCrI0aycQ0iRFtnG/H7jtiqcR/3z/6q/rbFVXFXYq7FXYq7FUn 83S6NF5fun1qVoNM+AXM6Tm0ZAZFCn11eFk+OgqHGKvPk1P8ooWuLebXrqQXalWgutflk4qisrMn q3pZKcWPOu3iMVV5YPyvnuzcjVrxZrd29RovMEy0CIJGjJW9qqKtH4igXtSu6qN0Sx8ka+kq6JqO o6nFblTcfVdbkuCpaoQmQXbuleDAcWAO46bYqyHy95etdBaZrODVJmnAD/XL97sChJHFZ7iRVPxb kCp71OKvLtVS01LzXeWtl5ttbadZbz1tO+t3yzQy/WX5qY49ZhRWT1OJ4qtaHiAp+FVBWuo2cV1L Hb+ftLWPk3rxteXfP4vUZ/TpraN/x8N9g7EV6rsqn1lrP5Zw2ywaj5waa6XiySwa+8ScIwoA4NqE yty51qxJbrvxqFUZDqf5S3YheHXbx6O8cLDzBPzdrsejwVje835GA8QD1BPjiqFM/wCTJ+KTzDeI VPBvW8yToSUbmP7y+B+BvDodjviqYfpf8qIw1m+uS1uSyhZtdLSOr1gZI5JLwvxDxH7DfCw2pirM PKTaVDpzJoxur6zedy9zNffX+MlQrr6ktxMyheP2F2HhUnFWRYqhEmlRFTgp4gCvI9v9jiqhPbWk 7xvPYwSvCwkhZwrFHHRlJTYivUYqkeu+Q/LOuXkN5fWTCeCIwRtb3M1uPTNTTjEUH7XXFULD+Wfl aGD0IoblY+aPQ390/wBiSKShDswILQL196Urirdh+VnlS3toLaC3uVgtZVmij/SF5xDrSnwh6dEA 6dBTFVdvyv8ALDPE5guC0JiKk6heMT6HP0waudh6rH371xVTl/Kry3LC8LreGNwi8RqV6u0dSteL jmak7vU+GKqv/Ks/L31mO54XXqxV9M/pG9FKyPL2ff4pD/t4qhf+VQ+VPq7W/p3npMoQr+k76lA3 P7PqcevtiqL1H8svK+pXhu72zkncxmJo3vLoxlSWqCnLj+2fl2xVQH5UeVwsKiK6/cHlGf0je1B4 ha151/Z+jtirJ7jTLa5p9Ys7ebi4kX1FDUdSSrCqHcE7HFVaOBogRHFGgO5Cmm4AHZfAUxVUiSQO zOAKgAAEnpX2HjiqpirsVdirsVdiqE1UlbJ2W2luyrJ+4gcRyEFwCQS0f2QeRFe22+KsNl1nU4JF EXkbWpJHR25R3dmFARiFBY3o+0AGod9+mKtnXdU4sf8AA+uE82SVTd2daKoPL/e6jA8qCh7Yqnvl 6Fbu2mkm0i+0NllZfq9zcIXk/a9QfVLi4ShLHq1a4qmv6Nt/55/+kif/AJrxV4pqHnfzja6rfQxa Rqs0EeoXFrDcDQ7uQFUeQoyuuqIZkX4W58E2B79FUNF5987FWs00jVTLCha4uX0C+SP4pUChY21O NiF5svSu1elTirrj8w/zAfS/UTy1qyXE8zkRLpl45S0Clg2956Zfam5+0PsbqMVWL5x/MsK0dpol 4YEh40/Qt9CA4VQVEZ1J5KKWY09McqUWtRiqw/mH+YKD49G1EQOPThEWiX3MyBdnEc2pxPRWPP7F KbVriqf6fqX5pXnp6hHpd5+jZf3kdtNZLDOwVNh8erhk5kll5oN6g02qqzPyRF5rMl3B5jsnt/Tc SWdzAxhhdWVGdWjF7eNy9RmrXbr12JVZliqEPXFWO+bfM8mjrbwW0PrXl0HZa/YSOOnN3OwAFe5p mDrtTLGAIC5H7HN0elGQkyNRCA0DznLc3jW13JHKwkjhk9FXDRPLUL6nILT4gF6bFgCa7ZjaPV5D KslH3Dk3anRxjG42Pf1Zhm3dYkXnh9FTy3K2s6tcaLYCeAvf2jtHIrCQFF5KrkBm2O2KsBF35Fj+ BvzQ1pfTVTIWu6FmIMwcF4SOJUigXYjbepqqn2g+UtJ8xWw1HTfPGs6hZhvSlezvjCDNHbxw/vCi hgw4+px2qWqajqqmkX5XwJcW1y3mLW3uImH1mVrw850Dc/SZwvNIyRusbKOvffFUE/5T6jHbTR2P nbXreWR/Ujd7hZVUkBSCvFGI4bKOQod+2KpvoHkJ9J1hNTfXtTv3VXVoLqbnE5kjijJdab09Hl8z irK8VdirsVdirsVdirsVdirsVS3zHYtfaRParcfVGk4hboGNWjPIUKmaOeOvb4kPXFWK3/lC/kid I9a+puWBSVWsyy7jmtJLNlPI+K7dsVZE0NrFGhks9OAbZXeRRyopb/fIHQE7YqqrYKw5LpliynoQ 9R/yZxVv9Hf9qux/4L/rzirzbUru2SfVo1vdZtjDJKHWLS2lSIi5Ib6vI2kSCVB6gVaO/wAAqPHF VGykSC3M1zrGrXfIRv6J0ujqZpuaERRaV6x+wVK70BO1KAKpZa69psvBf09r0onJt4x+hgCZCpX4 WTRftLxLeO2/fFUxS9ja9al95gRY5Iz6R0RmR1KqKD/cKz8Cep+47iqqiLyG5nEiar5gVR6oES6K 4QMkJr8X6F+Ij7QUsfi7YqqQ3PMTtFqPmDihilJbRwrFTKY2CCXRqEVcF+K7AbbVGKs68ta7p2uT yCz0Rrb6uEd5Lu0urOnJiB6f1i1h5sOJ+z0xVluKoQ9cVYn+YflTWPMGlpHo+oGwvYyeQLMsc0bA gxyFQT38COoI3zG1OEzGx3c/QaqGKXrHEPuY/wCV/wAs9Vt/MMGpak8UFlYnnFa25Nbida8ZZhUq qx1HBAxpT/WrRh0hErPRy9T2jE4zGNky6noO4fpel5sHSoXWWuk0LUJLUoLiOB5I/UjEqkopanBn jUnbbk1PHFXnB1L82DHDFbaRahkT04SLG0UI0LqVB46nKoVk5KOP0Dviqld+YPzktpDaQWqQxp6n FktLIScVNVYRm/YfFTj07+OKUxg8w/m+slP0c11H6TUZbKzHx/FxY01XfpuPh+jFCo2ufnBAbid9 NaZIZYw0C2dsQ0cdFm9CmoLJ8e7ryB7Ad8VQx1z87ligjGnGSQiISyCytgauKuatqQXklf5QpIxV MbPXvzUX02u9NeQON0SwgRgU9QMpb9KSKC3pihpT4hiqWHXPztEvF9PcwRNHWSKxtA8nUutH1FqD jQcgDv8Aiq9K0a/vL6xFxeafLpkxZ1+qTtG8gVWIDExNInxddmxVHYq7FXYq7FXYq7FUg8+ep/hS +MdimpMPT/0CSNpUlHqrVWRYbpjQfFtE1KdMVeRTtYLc3ItvIVq44/vnl0+6hL/v15AcdGk9RfU4 yA9f2uNPixVXlTTJLNoJvKduI3ESW9odPvYY6RwCdaSNpKDknKbiFSvT9o0xVE6Z571/RdLFlYeX jptrbnlFZw2t/DbqGaSSTi66Rx+JeLcuIoWIZajdVmvkLzRrHmGK5TU47vTb6F+SRfVblIjDRQD6 17YWQMnPl8KjpT3xV5/fXkEGua76XlOxvo/rVxFc3i2N6jXAjkKP6hj0W6jlfkx5cHfap6b4qktx qemtfNLdeRtNMgAR5JLO9INQiAvI2hheCof2q9sVTazvrBtWgvtM8n2H1+3EZW8+r3MMsLQxxhqM dFqPTDUQEqxAFB2xVkeo/mV5ut242+kzzK8YeOT09RO9SrDjHo0n2SNwzK3enTFUUfPvmkuHhs5Z bWMg3TtFfRTJHzIbjB+i3YsE3WpAbsaYqhL78x/O8ckS2Wky3DGBpJYXi1KOTmoY8Vro5XpG1OVC T4d1U/8AJ3nW81ieO01OC/0/UJXJii+qXf1Zo1iWQl7i50+yCEkstCO2xOKs6xVKrnU9NtZ1gubu GCeRHlSKSREdkj3dwrEEqvc9sVecN5O8uQX9nMNV0iMwcGt42aRWK2901wW/3qAYrNM1TSm9DlNT 7x8v2uVxYa+mV/1h/wASuj8k6Mhtb231LShBYtDLBKHuCIvqfKRCHN2ykK0xY1HQite7WTvHy/an iwfzZ/6Yf8SyfQtT8o+X9BtbA61YJb29Ujka6QLR3LKA0sjt+1TdssiDW7jTIJ25J1r6TP5c1RYR Gzm2lqkyLKjrwPJCjvEh5Db4mC+O2SYvIrTTPMdqyMvlLTVuPjKmPSrCtKKBIaar0DqK/CPprspW 33l3W5ErJ5O0ylXAhTS7BQuyqrFk1MUDDZfiI270GKGS+TrfzlHbz2VpbWHle4LIwMljCEmUEgIk UF9IfhHj44qnrv599FvT8y6G0kkUbW7fU5FUlzxDf71PUOwop6Hw7Yqrwt5ziZVuPMujtShkU2Th vioKAi7UUr9n4fbfrirccPnv1BKvmLS7iJmjSaMWbRhCrUf02FxIat0KtXfoV6YqpBfP0QjjfzNo zyqgLl7F1ZizMqNRbsbFhTYeNMVZTpiXiWUaXtyl3dLX1Z409NGJJIolWpQUHXFUVirsVdirsVdi rsVQWsDVTp8v6K9M344mFZX9OM/EOQZ/Tmp8Nf2DvirG1f8ANE3Sq1pYJa8jzkGoF5OIO1EOnoNx /lbe9N1XM/5pekeNnp4l/eUrqTEbU9Pb9GL9reu+3XfpiqHSX83mukDWWnxWokIlb696jmP4fiQf UUFeuxp/HFU209fO0mpPHqEcEGmgfBcw3ayzE8RsYWso1+1Uf3mKsQufIutJqF9c23lLQJp5buV4 r6SWGOWaKVmLSTU06RhI605Dk3xHFVPUvy61C9eK9k8naBcXxWl1688QNVjVECyLpr81CFkIdR0H hirofy0u7y59TU/KegiG45TXNGhaX1vVqob/AEHi9U4lmru1R03xVlvlTy/f6ct3C1la6NAzhol0 1oHEpYFnaQfVLfieRPjXriqf/U7j/lun/wCBg/6pYq76ncf8t0//AAMH/VLFW1tLgMCb2ZgDUqRD Q+20YOKonFXk35txXl3qul6fbafYXZmilZp7yKzmaFVdOcipczRMUSMsWoNtjXwVYdPoOrpdSqfL 2jww28lIpGsNOCSCOZ0Kgm+U/HxoSE5fDTbeqlT0o3K6ZNcDSNH5R/WFuRLbWEYWaaGNgvJ7sCP1 omEVBy71+LbFUrGh+aLmQ/o7y1pR1Ax8li+qWDpII3AYIyzyR8xzYnioNAPbFX0D5kSOTyfqa30I nX6m5nUegApEZJf/AEk+iOB+L46gU74oeDRP5MgtfURpbdljkZwW8s0kM0LOifBxZeXShDCgG1dg pXS2HlNowHs3tXlkWGPTwfLpmaWOTg5UsvJzU/ZoPDoRirI4fy/khuInj8ta0bg+l+/MPlscBGwb b4CpJMa05dPf9pQi4PIdsk1ncXHk3UbiO2BV7T0PLwSUOzMRKUWFxQmnwHp/LXdVPrbR9BmjiWX8 rJY1UPEn7vSqrGQTQc7lCK8zX398Vdc6Xoluohi/K9pEIj9Mxx6aATw9WjES8l4NUVIpXv4qun0f RBJxb8sHkEIZFeJdO48Q/McazITVt+nX78VZX5SkhSF7W28tzeX4KtK8ci2yI0jEBjS3kkqzda4q yHFXYq7FXYq7FXYqxX8ytFGq+WqNM0SWFxDfOq2j3/qi3bl6Rto2jeRX6FQdxirzZPLnl6+hlMdq iLpySNJGfLWtQtIoVmYBjdoZCack+It0A22xVTi8t+WhaBlg4xN6kLxt5Z12SUuWhqwP1l5AVP2e BoQWoDQ4qk2r+UfK+vC2hs7670dkmaKtn5a1pTKzniA7SzSj4eBNNu+3gqyDSP8AnGu70/Ure9Pm ySYQNz9I2hXl7V+st+rFURqmueT0jSCXUbq2k5Au0ekX3Kp3PxcmRgFkU/BXalMyho5nu+YW1sae XZbX6zHrGpPGKV46Pfk0NN6U6b/a6ZE6Wd1t8wtqTPoARjHqOsSyKSvopomoc+QANNwFrRl79xh/ KT8vmFtELZ6SYWlF/q/FXEdBouoEkkA7AAn9qm+D8tLvHzC2q2+laXPIsaajq1WCGp0XUeI5qGAL caA0OROnkO75j9a2tudO0m3XlLqWqheAcE6NfhdywALMAqmq/tEdsI08j3fMLbIfL/kZrkW2px6n cpGkob0Lm1kt5D6T90kcMA3HY06ZVKPCaV6HkVeWfmp5Yn1jVdLmj0a71RYYp43NudP9NRLQfEL1 ZPi7ginsa9FWFQfltNDbGH/DGqM8hJUyDRW6gylSwiem8QUcvhPL9k4pQsX5Z6rdvN9Y0DUrdjCC p4aSyusJULH/AHf7s0NKd6V7UxV6X5K/LDQNKkXV5rWRryURSwWl7HaVs5VB5GNbRI4eZJHxgV26 9cUPQYACGB3B6jFWFeavN91Ya3Lp+n6ZbyxWkay6nfXIIjRXUkAcaEngffr0zA1euGE1zJ5Dvdrp NBCePikTZ5AMi8vXOla15ftL2Kzjjtrkep9XKKVVw5LbUAP7xSQae+ZsJcQtwdThOLIYHonOSaHl v5r6x5ntNXtILJpobBoWZZoW4gyhXIDCqV5OFUmvwg1pkg6/UyHH6pGMa6M68oXGp3Hlyxm1IEXj oefL7RHIhSfcrTAXJ0xkYDi5t+brrUbTy5fXOnKzXccfJOAqwFRzKjxC1yeEDi3XUmQgeHmxP8v/ ADHeaprk0dtBeRaZHbj1vrsjSn1a0DBmGxbwGWzsx9UeE3s0YaE/RLijW+90f2vQ8xnOdirsVdir sVdirsVS3zJd61aaHd3WiWi3+qQoXtbJyFErD9jkWQLXxJxV55ZedvzzuLw2z+RbaECaOMzy3ipE qPQFywLlkXepQFv8jfZVk31z82CY/wDcXoqg/wB4frlySPjI2H1cV+Ch69du1Sqpy3v5wenC0Ok6 EZCP9IR766AU/FQIwtjy241JA32oeuKpxojec5YJzra6faTrMy26WnrXCtDQcWZnMBDE1qtPpxV5 K0Pmtbp+H5WaYWo4e5Zac/35LKKIzDm1XHUU+7NptX96fx8UIH0NeW25H8mrFZAq0CxxGqgCm6jl y8RT5nJdf75fgmGjSee7LU7R9M/KjS9MvI2EMGp1jQQrIChdnRfV48WPMjele5yExEg3lJHd+Cj4 PQhe/m2YmP6L0US8gFQ3lzTjQVNRAe9cw+HF3n5ftZKsF3+abSAS6bo0cdF5N9buS1SoLUAg6A1H XAY4+8/L9qrbi8/NVFrFpmjyfCKgXdxyDEkGgaFQabH7QwiOPvPy/aqd6WPMj2yNqjWcNzyPqRWy yyJx5bUd2jNeP+TlUqvbkqZ5FXjv5zajLYatpc0bIr+kzQsbkwEPHKrAlBe2IYKaEVVt9tsVYDb+ ZPrZ+r3WqyooRpIOV6ysCqFSH/3NKVp6X2X371HLdSr2muXstzDaDVPilbksi3vFyQvJByi1zkQA 2w7dsVegflqdM1uOKSI6hI2ncWuL39JzSW73AIcIIlvLv4eLbo7cfEYoeqW/RsVeda95Z8469dLP qHl/T4w3GOc22s3CPJEjErzQ2BRioO2/05TkwRmQSNw5um1+TCKjXx6Mi8qT+ZLaaLSNQ0XT9KsI Letv9U1CW7f4WCgcHtbfY13bnWvY1y0Cg4uTJKcjKW5KE138xvJUM11YXmqvBDbn0LyW3iuHHqOr Aw+tFG4Qgb1Rg1ehFDlggWu0gvJvyyt7eG4u9X8xQWxi5QSy3XmFYyjbCQM5o396KN7inbBwFSQp WvmD8ppJrc2/mLWpngKhFF3rchcozyKJNyZPtNs3VdjsBQ+GV4gnNz58/L/zFcnRZdcntvXIjiii N3p7s1VkV/rCrDIhqvED1ADU1BqKJgaWwnWieSNG026ivbK/1OYISyxz6pe3UDEqU+KOWaRGpyO3 Su/UCkEskxV2KuxV2KuxV2KuxVKPNn6B/wAPXv6fkMOkemfrc4aSPgn83qRUdKfzAimKvOku/wAi LbShInmBktHn5R3r6heSVmVTFT1JXfnsT8LVG1f2dlWRaL5u/KZbFINP1OyvIIPgM3+9BBJ/bko3 c7VPgB2xVWj8/flPJqI0xNT01tRab6stmAnrGflw9IR8eXPl8NKddsVZBw0P/lg/6c5P+qeKvAL7 RtBN5KZ/PtpbqP8Aj2W4vYmjPqj0yULkRUSlQFHxE702zbxnt/dn5BDo9HtxpjD/AB/pjW5IU3Hq ajVZaLUB/rHbb4OnsK48Yv8Auz8h+pUFNpGhGF/U/MXTDFyLBPX1N/h4kFeP1vpXfpX9WSEv9rPy H6kM4sbT8mZbKO3fzXPcTsYvXe3v7oVlIVBSjO6qzUABY/MnfMWRy39H+xSiLJ/yS+sQNB5rmlmc RxwxnUJ2rQBFHp1pyNB1FfvwHxf5n+xW25h+Ssys/wDiuZfRjXmVv5SAhcqCymqsC0lCWB7e2I8U fwf7FLMfJ175AuLIW/l65j1SO2f4p1Vrl0aRiw5yBTTetK5jZoyBuQr7FZdlSvM/zN07Wru7t5bC Cd0traZ2kjkZIxUgMHAvrBelDU9Ote2KsB0zy75zuIHla3vg0DcR6d1KVDFmDKx/TKUJIpsBucUq lv5c88pcPdNpWoSSMDDbFA6RcDG6qGT9KKQByPGo22odxiqYWGg+Z4rk/pHQ9bktmiQBbG/midJC inkGl1KRWofg4lPfk3dQ9q0ok2UJaN4SY0JilbnIh4/ZdqtyYdCan54qkl/5qvf05c6Zp8duTZKj XJuGkDNzHL4BGrkeFT3w7d7iyyzMiIjYdd/em0Oo2d/Z2sqKzSXMS3EcCsFlVGAqa8loBWla4t8J 8UQR1fPnleTTo77V1uL/AFCzka7fnHaalaaahUSbcvrMqGU0LdB8NB/NVciSAhb7z0sF5NDDqXmK 5hQ0SVtXWNuQLV+xHcIQKrQq+9K96AiPuW0x0m4tr7RrSe88w6uL5aNNGdWsIk9ISAskYnuUlRvh DDknUDbvgPPkqV+Y40HmjSorLUbrUNOSWAW0d5e2t7LGxcKVX6rNOgFIxTp2HhhHJer3fzrC6C1n kDSaSZSNVtgHdSvoyLEzRxD1GBkZeVPBfAnMHJ0vk7DSH6uH+8r0/MXz8kL+XMbpJq31YOmhPMra XHIJEABLmT01lAYJTh7fjjjrpyZ62UjXHXib3VctquuvNmmWOA7FXYq7FXYq7FUs8zQzTaFeQw2k 188icRa21ybOZ6npHOrRlG9+Q+eKvNYdFuorkTp5K8wCW1jiWJ213aRUlVuJC3h5keoXPqDcAivb FWXTeZfNMfxR+R7uVwHAK3WnjZCaCpmB+KlV+YrTeiqAXzt5xe4PH8u9QUpzYyvc6ep5BOXwkStU t9mtcVTjTPM3mi9uoIZ/Kl1YRzBjJc3FzaGOLiKgSCKSRyW6Dgre9Bvirw/X9Y/Ln61/pulX7Shv 91a3bcSeh4qJqnbf4lFev7W+6hHNWxj8j+pBeg+UNWhPl8Po3ke5vrT1ZB6klxYSuzGQlhzaTdUY lQv7NKUzDzRlxeqYHz/UlM5db1oRVH5aTs3I8VMumU5b77SsR86ZWI/7YP8AZfqRbbaxqjIPV/Le YJUAhn09/hJAY0R3O3WnfHh/pj7f1Jbi1nVmEAf8tp41bgKmTTSI6t4CTlRevTEx/pj/AGX6ltU/ TGsehKf+VdT8VVTw9XTfiq1OIHq9R16Y8P8ATH+y/Uqb+VL7ULhLg/4XPl9RJR1meBWlNTyZRb+p yoe7UrXYnfKsor+Li+f6VZLlSvNfzPa2t7rTLm6tvL89vJ6tvK+ulUlQPxJMDt8JXgH5LselDvTF WCx6totvKiyaZ5FSGUIaLORz4s3BlkELKApRqn6Ou2KvU7Lz35Aitre2tda05ERBHDbQTxlVRABx RV/ZUe3QexxVMtK8z+XtXuJrfS9QgvJrYVnSFw5QFio5U91OKpjPqWnadbm41C6hs4OQX1riRYk5 GtBycgV2xVgF9qlzLdi81SLRrD14Q80sWvcRK8IZkBV7RQygIfjDAgfLFplgBN7g+TIPKnmiSeK4 XUo9I06zso1FvJYamt6nFOfqLIWhtvT9MR+/fpTFtEQBQR9x5L8lanM2oTaTZXUl1SVrn00b1OQr z5DrXx75ISK0p/8AKufIn/Vhsv8AkSv9MeM960Hf8q58if8AVhsv+RK/0x4z3rQV7HyR5QsLuO7s tHtILqI1imSJQymlKg02xMitLte8meU/MMsEuuaRaalJbAiB7qFJSgbqByB2PhkUqWm+QfJGmahF qWnaDYWmoQDjBdw28SSovD0qK4XkP3fw/LbFU+xV2KuxV2KuxV2KpT5o1q70bSJL+1sxfyxso+rN PHbVUn4yJJfhqFqQO/t1xVJW88a/680cfla5ZYvTHNruxFGlAbi/GV+PFTU0rt0riqGtPzA80yuk Vx5LvraY1WUvc2giVuNdpGkTkK9aLUeBO2Kqd3+YfmuJ5BD5PlmihdlkmOoWarQOqqVHItV6kgMF 7eOyqp/ysbW2JaDyrcXECheUsN7YPuwOygTfEfCnX50xVDwefNeuAqz+R7hJJgr20L3ViryJ6ZeT 4JnifknQqFPvTphsqybQteFzDci9shoskE7IlvNLAxdCA3rD0mYAOznrvXAVTODUdPuFDQXMUqsQ FZHVgS1aUoe9Dirv0jp/orP9Zi9Fl5rLzXiV8Q1aUxVel3aSFgk0blacgrA0qKitD3GKrX1CwRS7 3MSqGKli6gcgKkVJ6imKqsUscsaSxOJIpAGR1IKspFQQR1BxVdirBvzJv9NtNLtP0lb3MtpLdKhl tb2PT2R2Rwv7x57blWv2eVO56Yqw/RPzQ8kafYycbGUwiWrG51G0u5BzMleJnuWovGMEIhpUnbuV UcPzk8sCWS3/AEOUFvzDKbnSwEK/DICPrNF+L4ffbFWbeVNdtNc0xtQtbdbaJpGjCrJBKTwpXk1u 0iAgkinI4qoefNQ0Kw8uPca3p0OqWAmjDWlw9siFjXiw+tNHGSPCtcVedp5h/JqR5Lj/AAtZFfS4 lXutIJXgFRVSI3ZRaiTcrvUdzTFVy+b/AMpJDcXbeULRxJV5pWl0h1NG48qG5NN5utPvIGKpzH+d eiabD+jrXRTGlgvpJDFeaesMcUaL6e/rfAh5Kq8lH37YqrL+fGil+P6OeiITM/13TaLKKAxrW5HL 4qrX5GlDiq+b8+PLsd3DAthM8c1CkwutNCspLIGQm6Cn94vGhYdz2piqo/55+W45HjltmSRC9UN7 pdaIu2/1vhVnBWgY077EYqsuPz38twqT9UkLDkCn1zTKghwgrS7I3J7Vp323xVO7H8wbvUbFb/S/ LeoX9m4/dzwS6eyMQeLgE3IrwcFTTwxVlltK81tFLJE0DyIrvC9CyFhUq3EkVXoaHFVTFXYq7FXY q7FWG/m3bQ3HkueOaa0t4/XgJlv3jjgFJR1aWG5SvhVDirxBtE0mO3irf+X5fQaMNLHLp7wkksqC Zhp0bAOOrcjuKmm2KU1sPLui28VhLf6j5euWfl6cb3WmenKQooCx00HduIPxnrWvUYqoQ6LosrQw R6roZvJEhtUZb6wmdyJFjSMqNMq37v4aU40pXpXFV2n6R5aSYXkmr6EgpFLAqXmmu6tDQKnGTS+S AhSdyOm4riqpc6HobyKLXXNCijiVkSR7/TG4o4pIyxLpoXkEWh4MBQdd9lVGXyjpUFly1C90T6sC 8iSfXbHkqtRkReOmSMVWRSaIAPiNdq4qpS2nl2CZGi1vR62pM1iILqxZg0RMqf3ekAL8TNUbDwrv iqIubLys1pE8V75bEoklV1F3pyuwcN6bApplVMbUZTT2auKqSaLZQq8japocz+l6Gno2o2EcnBWq AoXTlr8abAkUrxO+4Va/Q2iXdvOkur6FHc1LXMh1HTv3rStUmV/0afU4hhxYbcu9cVeo+RLnRa6Z YQedxf3McYeHRoZLEIYxED6KpHDE7JGoqOIXYdAMUPRcVedfnFdra+V4JWmeEfXEHKOb0DUxycav 9Zstg1Gp6nbp3Crxyxku7q4jgttSaaZB+6jF8tG5kqvE/phivDkfs0amx64pVJp2tJY2ivq2kiBZ PXv6MsbKpVOI1hEdG9IilegpvQYq9t/Lex1CDy+lzqLTteXXFnM8jPVUUBXVTcXiLz3YlGHKtaYo V/zCm1aLyy7aUJmu/WQhLflzZVVmK0W2vqg8ejIB/lDuq81i1bz9e2aQPNqMc96Y0cSWbekzS8Qw JOkBONCK8u4+0w3ClkM/lT83DZyql4jTqCLdzcWfLiylGBppigVBBpU/ZFGFN1CJPlv81pEdXuwq ulqpK3tqWXhxaZl/3FirM8e4LcTXv2VUr/yl+bbqscGqKyc+bu15Asjlip346YFovp9KGtTvvTFX f4P/ADTNxbTtfK6IvqT273dtQyNMSyVXTByQoxNOlelAoxVseWfzjFUGooAAtH+u2oFQyNt/uI5f skdB296qqMPlr85FWST6zGJGYFR9aswQRVS1f0a++3IGo+XgqyjR/KfmoaJHDd+YbuwvCWaSO1Ww lVSWOwf6nEDy+0aIDUmpOKsutonhtoopJWneNFR5noGcqKFm4gCrdTQYqqYq7FXYq7FXYqgNc0Sx 1rTpNPvvVFvIVLGCWSB6qeQo8TK3UeOKscT8pvKKxyRn68/qyCUu1/dlwwZnXi3qchQud+p7k4qi I/y18uJ6FJdQrbMGiI1C8U1Cou7JKpb+7HX6MVW2X5Y+WLM8oJNQV+7nULwk/DxrQy0qOxptiq5v y08ttJzaTUGPJWUNqF46goGGwaVhvy3xVZdfll5fuFkVrnUkErrIeN/c9UJPGrO3JTyOzVA7UxVU m/LXy1KoVpNSpVSaanqG5UEb/v8AwOKprpHlnRtKtBbW8JkWpZpbl3uJWJAHxSTF3Owp1xVHPZWT o8b28bRyDjIhRSGFKUII32xVv6ra+mI/RT01pxTiOI49KCnbFW/q1vz5+knPry4ita16/PFXJb26 SNIkSLI32nVQGPQbkf6oxVUxVgf5nNq0WlWdxplxPDPHdDlHAhk5qYpOXJUs9Rc7f8V8fHFXmFrq /ntII5PW1CEODCCLeVeAAWq8RovDaijYk9l71VRlzrPna3t4zcJfTvKZAqtDOCAACqqI9ITh36oP A1A2UvVfJkvmCbR1n1oD1pyJYTzZm9N1BCsrW9oyEfystfHFCl5/jkk8vARwyTyC4jdUhlvIJPgD NVXsUlmrQbfDTxxV5ddyOpeCXQtQKRSosyzah5jZZI6Bhxragt8SD9g9+tQQpROm6lbzmS8tdH1J NTgeOUxteeYpE9USopV1jtT/ALrYA/Ca4q9KGp/mc80bpommLbE/vEe9mElKdVP1fpXf4lB7cR1x Qqwal+ZLwq02h6ZHIWFV/SUxIWorUC0p0r+0fliqql3+YLTqzabpiW9KlDeTl+VSAOQt6D4dyaGh 2364qorqH5lFE5aLpYcOokH6QmoyFTyNfqvwENx7N39qqtm//MkM4GjaUyiVgjDUJwTFy+E8TadQ p3339sVTjRZtdlt5H1m2t7W49QiGG1ladfS4rQs7pFVuXL9nwxVMMVdirsVdirsVSjzL5ltNAtIr m5iklSWT0wI6VBoW/aI8MxNXq44IgkXbk6XSyzSIBqmPL+bOjOwVbS4VmNAW4cQT4/F0zXntzHW0 S5x7HyDqGJ635p1yLVbyRb2NUgmtU+OCZljMrsrJJKq8AzqqunxKKMMzcGkhljGUgZSkCeLi5fb0 5fB1c8piSBtXSmXTfmZp1hIbO6t55p4aK8icOJNK92H05r8fbMYxAkCZB2UOy5zHECACs/5W3ov/ ACx3P/JP/mrLP5cx/wA2X2Mv5Gyd4d/ytvRf+WO5/wCSf/NWP8uY/wCbL7F/kbJ3h3/K29F/5Y7n /kn/AM1Y/wAuY/5svsX+RsneHf8AK29F/wCWO5/5J/8ANWP8uY/5svsX+RsneHf8rb0X/ljuf+Sf /NWP8uY/5svsX+RsneHf8rb0X/ljuf8Akn/zVj/LmP8Amy+xf5Gyd4d/ytvRf+WO5/5J/wDNWP8A LmP+bL7F/kbJ3h3/ACtvRf8Aljuf+Sf/ADVj/LmP+bL7F/kbJ3h3/K29F/5Y7n/kn/zVj/LmP+bL 7F/kbJ3hdH+bGiu6oLO5BYgD+777fzYjtvGf4ZfYp7HyDqFH8xdVazgtUtdah0vUFczJFcXSWcUs YBUlmeC5L8WI+AUr+B3sMUpchbqGGQ+ZdXGow21152s7axZ2SaaHUbO4dF4M3wrJYVLcvh+KT/hu k/y+T+aUpxLqGiPEy/8AKzpxGF+NxJp4YKPgPxLAKElhTvtt3x/L5P5pQyxvzC8jLKIm16wDkAit xGAQSQKGtO2P5fJ/NKrvPeo6zpvle7v9Ju4rO5tQ0zSTRxyKyRxO5QCSSFQTxG9foylWD+WPztnE RbXTDeetKEg+qvYW5jUCXdi9/IH5ekN/hUb/ABHFWWeV/wA2PL3mDUxpsa/Vbl15Rc7mymDioWg+ rzzb8mAA79sVYZH+bPmTTdcXTNTvrO6S3kjE8ipYxNLHIBKQvLUYwrcHCggMO9D3VTJ/+cgNMGmi 9XSi1ZfRMYvbM0rUg1Dse3QgHFVVvz+0IQtINOclTQj67pooPU9OtDchv+F/DfFU0P5gP5i8p6tf +XJl02806VE9W4azuRxJU1pFcGOjgkCr9elTirz+x/OfzhPaTO19aqbURwu4is25PI/H1S311EUD kBx/HFLPfy5/MuTzJcLpk0Iluo455pr6OS2MZEcqqi+lBNc8fhlUfb7e4xQ9BxV2KuxV2KuxVg35 t/8AHFs/+Yn/AJltml7c/u4/1v0O37G/vD7nlWcy9EmcfmHUkjVCUdkHGOZ0VpFA6UY+GWxz5Ix4 RI8Pc4ktDilLiITbypPJJBfc7oRkyRyurx2svOnIFqXLJTjXr75l6I7SF1y6RP8AuiGrVxAMaH+6 H+5ZG9pfsX5XwIljIuFMGnoQkgqGYGbdqoOvvTM845fzufPbH1/zvJwROP8AN928/wDiVO7/AEg2 1zfUJQmUi304lwzUXpMK7fa60+WDJxfxS/2OP/iv7GUOHpH7Z/8AEtRM0P1eBr+GRYqlecGmnhGq 0WjesRvzGwIP0dRE1Q4ht5Y+X+mSRdnhO/nP/iW447mJkQapFQ09RxDpoNEFYyX9apPJRseuEAj+ MfLH8P4kEg/wn5z+PRTijmCyLHqMQdW+ybbSwC7AMOs/Yt/nTIxB3qQ/0uP/AIplIjrE/wCmyf8A EpdfeX7S6mRrq9ZJVTiyxpYqKh6Nulyo+2/fenyyjJpoyPqlv/mfom3Y9TKI9Mdv8/8A4lDzeTtP 4qYNSWjM0a+qbdRyTl1pMaA8crloo9Jf7n/imyOtl1j/ALr/AIldD5S0JhSTV6SEniq/VjUKQp/3 f/N08RvhjosXWf8Auf8AikS1mTpD/df8SgNe0PSNNirBevcStQR0EDRk7cgWjmkK0B/l8Ppp1Gnh jG0rPw/RItunzzmd418/0gJNbf70xf66/rzEjzcuXIvfGRGYFlBK14kitK7Gmd+8OsNvbkgmJCRu DxG29f1nDZVv0IP99r4fZH+fbGyrQt7cGoiQEnkSFFajeuNlUVCqsjqwDK2zKdwQexwK42Nkwobe MioNCi9VNR27HFV5t4CamNCag1Kjqu6n6KbYq01tbM5dokLnqxUEnanX5Yq19UtOAT0Y+ArReIpv UHanvirS2NksYjW3jWNeiBFCintTFVsmn2bxPEIhGkgVXMRMTFUNVXlGVag8K4qxWD8pPJ0CSpEt 6qTcC4+vXVaxsrqQ3qcgQV8cVTLQvImgaHfm/sPrP1ho2iYzXVxOCrFSaiV3qfgFCemKsgxV2Kux V2KuxVg35t/8cWz/AOYn/mW2aXtz+7j/AFv0O37G/vD7nlWcy9E7FUTa6jqFokkdrcywJKKSpG7K GHSjAHfJwyyjYiSLYTxRluQDSKPmbzESzHUrmrqFY+q+6itB1/yjlv5vL/Ol82v8ri/mj5NL5k8w KQV1G4BVSikSNUKxDMBvtUgYBqso/il81OlxfzR8nSeY9fkUK+o3DAAqKyNXiwAYVrWhpidVlPOU vmkabGP4R8mh5i18VpqNyORq1JXFTTjXr4bY/msv86XzX8tj/mj5Lo/MvmGOT1F1G4D1BLeoxrTY VqcI1eUG+KXzQdLiIrhHyXP5p8xvIJG1K45rUKRIwpXrSnTpidZmJvil80DSYgK4QoXeuazeQmG7 vZ54SeRjkkZlr1rQnIz1GSYqUiR72cMGOJuMQCgcpbXYqq23+9MX+uv68MeaJci+gv3HvnfvDu/c e+Ku/ce+Ku/ce+KqkXDfjX3riq/FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FWN+ef8O/o+3/Tvq/V/ W/dejWvPietPaua7tLwuAeLdX0c/QeLxHw6uurC/+QV/8vn/AA2af/Av6Ttf8M/ou/5BX/y+f8Nj /gX9Jf8ADP6Lv+QV/wDL5/w2P+Bf0l/wz+i7/kFf/L5/w2P+Bf0l/wAM/ou/5BX/AMvn/DY/4F/S X/DP6Lv+QV/8vn/DY/4F/SX/AAz+i7/kFf8Ay+f8Nj/gX9Jf8M/ou/5BX/y+f8Nj/gX9Jf8ADP6L v+QV/wDL5/w2P+Bf0l/wz+i7/kFf/L5/w2P+Bf0l/wAM/ou/5BX/AMvn/DY/4F/SX/DP6Lv+QV/8 vn/DY/4F/SX/AAz+iuh/5Vd6qcPrfPkONeXWu2Efkr/iQfzlfwv/2Q== uuid:503b8de4-81d9-e44f-8845-90c135a33104 xmp.did:8608da7c-d0cf-48fa-8be9-5c6ae446743a uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:da6c9ef9-86fc-3047-acc1-48b53d15a8f2 xmp.did:b08db73b-034c-4ff9-b0b6-5826f4ca45fb uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:ab17be08-b65f-453f-ae7f-4fe23b51a1d3 2019-02-13T16:27:05-03:00 Adobe Illustrator CC 23.0 (Macintosh) / saved xmp.iid:8608da7c-d0cf-48fa-8be9-5c6ae446743a 2019-09-23T10:54:34-03:00 Adobe Illustrator CC 23.0 (Macintosh) / Print False True 1 215.900000 279.400000 Millimeters Chivo-Bold Chivo Bold Open Type Version 1.007 False Chivo-Bold.ttf Chivo-Regular Chivo Regular Open Type Version 1.007 False Chivo-Regular.ttf Colfax-LightItalic Colfax Light Italic Open Type Version 1.000 False Colfax-LightItalic 2.otf Colfax-Regular Colfax Regular Open Type Version 1.000 False Colfax-Regular.otf Colfax-Medium Colfax Medium Open Type Version 1.000 False Colfax-Medium.otf Cyan Magenta Yellow Black Grupo de muestras por defecto 0 Blanco CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Negro CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 Rojo CMYK CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 Amarillo CMYK CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 Verde CMYK CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 Cian CMYK CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 Azul CMYK CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 Magenta CMYK CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 P Charcoal CMYK PROCESS 100.000000 CMYK 65.792322 56.157774 58.059049 62.648964 P Citron CMYK PROCESS 100.000000 CMYK 13.846035 14.843976 94.692910 0.973526 P Cardinal CMYK PROCESS 100.000000 CMYK 24.188600 100.000000 95.858699 21.084915 P Charcoal CMYK 2 PROCESS 100.000000 CMYK 65.493244 58.352023 54.680699 61.406881 P Citron CMYK 3 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=22 M=93 Y=100 K=16 PROCESS 100.000000 CMYK 21.960784 92.549020 100.000000 16.078432 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 Grises 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brillantes 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Grupo de colores 1 1 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=9 M=11 Y=62 K=0 CMYK PROCESS 8.984375 11.328125 61.718750 0.000000 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 C=85 M=88 Y=0 K=0 CMYK PROCESS 84.765625 87.890625 0.390625 0.390625 C=61 M=83 Y=1 K=0 CMYK PROCESS 61.328125 82.812500 1.171875 0.000000 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 C=66 M=57 Y=54 K=59 CMYK PROCESS 66.406250 56.640625 53.906250 59.375000 C=40 M=32 Y=32 K=11 CMYK PROCESS 39.843750 31.640625 31.640625 10.546875 C=18 M=13 Y=14 K=0 CMYK PROCESS 17.578125 12.500000 13.671875 0.000000 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 5 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 7 0 obj <>/Font<>/ProcSet[/PDF/Text]>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 26 0 obj <>stream HWk\>?溫 av%oHqlFB>Tsg*(ZCs]>uO>6 {O>ow_K;'!LUFʛݼI!|$D4z$UwjCt8)ׇcp~r9G;T޹>71=7aSߏ^`sɋ< Tq0~4"uᘧ:ukh_0s&͜ȧYGoe6eqHn?blc:nv?C>l{M:a1ZFBFJSj+V^)7IBtWq'q|ҿSܦ\;:C֋3!| y^ E2I(`?Xj4KZgZ|.]gڣ8#5;0A۷;_<[p}Yh7 |!Bt3,!ݱjA7Tr`Zɽ:dmsM"B :F/z$-hW 䁊; ]jUU\M Nhh>_c]qO AB1efx@с`v9`p| Tb*.vtΥRh5%f1>sv"FG =P0%Hc1VINoI}k:gAkբ(b~\#@S1~$x3!'Aڑmf[dˌCt:=хk͠j80lTH**f}21lT3p*(Ime5?Wv:$v3CAgYKtQW5g')Vk+s6f"y`9B?Y1~q <ٶryO&b=+{+ΫT{ dۗ>Ê$f 9jF & ېWkusUAN8V㨅&kӼhb |3OEOBahz֝ \8j1VI7BQ7D$|:o\BoRr!Oh5PI=-*\Ѝb*+F`Nc*H tY?{MB@+A4vÒVb#acN:T}j%JܬֿٚM$šKD:sJg*`POK"ZΙeWlEP"'<Mf7?mnL;WyhMB_xXVߌ]Vu['3^#9A-d7dM}ёx?_C]!+0lPRzRq\e!Ltټ_SʅZR|,CḀj-[wlPG;>)EE4SS_ITĊZ©MjҸM$t+ig.+ʞe)Qj A'eO%!$ z<}cTZQ+p&H{ 8Xa(2gٴEHF&`8'9 Gac%SYXgzKd+t*_K$Mg\הvn~f# UXRH|xf6PY@gGg"hj]{550 ¹U@X3QېKևt"Jȥ[*Ƃ& x5L\饊 4Њ1iz L#qiᢊ @@E GqU0fԃbAxpErYImÎC| EHmn^݀-o}(/pnfy,Oի>Rq4h۫~ˤhfAw'#C?.RZA 5TX,S%2FR&R C(1X#J/+%EGu|00PԠ*ّ8:v}8C@ـ ar(s{U].J]YYDċ/OYRIJ,:hxXWGYmbMNh"gmE$8nh:8ɵB.` \+UǷ>n z 50O{ѓ#r O~8S.dR9$"*aN3%sEG)1rT䐮E7)29 l ܤ  `)KN,nL{31I(F5iϾZoH'{ڗK)F-',X6DA(?ʼ{XdTD{%=^d]x}͊, > :5/ .i9D9 *J֫#xqpM "TA aKA3ٜ6Umts@&N'皴UO=r0L1d M먊pF!j.Q >sT3 Vjq4_ؖ|*X5o$// md{Bx!,iҔ zD ȅ0Qp>K/x-IyVY7})Bjzcm ^?]\'/Wp/W>$1Z^~|o^MoNz_~:zz㋛ks.?t\0yrb tZX.x /]<~@Q|ι}W\⒏v8lm>mle]&vAՔwU"hl].a12޾# Mߤ~1LzXvuj_4'Luҟq~KU鄮WPCܒOnF;lo]l"%%2"K}]] K@O%^{vZ݋=zv7{?MHi~Y֦ݫ ;Fjk^b8}uxTȴ`^tAtX?>}@jkWHb;0 ]b(e[VF| yFs5l5o{vND(ܳKLgb_+BCaA9rx΍x# (,c4oy0)pC"z(@l7i`}%m|Pl 0$*xJ]P1H*6y4˲0uoHLYHǢo9sOAa`wdpq#_wplhe*F~s E>f %S7oJfpOoø<w=h''m9*3_i 5, B J1sN%j\>@;uqk6=cJ"rףV2+p<֞1i>켎V5k[r3"$ldr (d=K90/s@FK*yIeY7 L`Y$cDl8B-9} }T^'ov<EJ)+VhcMy\?Ji۠ƃP^ 3#3?٭q9">$ ; K#u> 6cr7Fa޿0 a_7a0{/ۓPy[>6%|yXoEm,"yM58m4w:Q :T 2Fۄ3V[f )1NQ Bdy?ͻR_==v8Oad̻-COA:ftEIQf}ؒ(?>tx_ysʞa=q㐙=nl8 TF:ʤH$\k/<`nEF>LOiDw Lc.fp <^.36' F(RFl7L\`9/;P~9KڂTOg/#7ڣ^;})GBr:Yqt(nBu@ƨZtzmtqP.T'ƎG7R ҠwJ:Dz' O򵉍׃!ELiԄUH,A7('ϗ9gopޱtGL -k:Nn|kqIUUxAylrQڔkWr4ۼz6\#!gcpn Ԑ ?}1;-+}`Y ÿz3oaߞ0CՀumi$2 p ,,˟/1$:R罎P)Ajȴ]2DM.z_T W"d͙nޱT+02O"K(2œ%sRY;<_SGs$$^bN%ReTC`T &k6L26+Oբ!odTtn⁛|WWB./Ymp UPPp{Ծ"ԃi+?.* G8,u;]uL7Nr$9^d2F«Iݑ?0-#?]l/pÍ 瞘 ~1oQr;,x)T%$2po}jژdOO/G^H1 S[zqzƏ=]>F{|^)Smn3ùo6{N)rd쳗,ceBɦ>vۙf_ [l,o>w7?7#ni:8N>'ϰ.E7~tp6̇u-V-ɠ?On_ `߽py|ϏS3Ha Yט͊G!j ky.ȋ^\&Xw~ 2%!`{2i3ԇF+Sz?™ILb$#b?hCq~LDJ05!|OtEdhL.s  Ԇ PSb쓴- ƞ|6J,Cio\3m h(phgQyĂURa22F#9%zƿ~Q N*Y>AÝE4, z~'N'Q6^Ǝ <`F]̚i\=g2d?{PVt|[T,UVPt EmIP<*UZ/-l0//'cN>uܨ_(~JiL X%`G0&&Z2O'O;pH{Ҡ}є_:.I"zV-pZU@1ms껗|2XE{ G3e!L5RW+: :*ELS2$V0BHbB!'2Z^@;_Iy\xurrU4jv L7f4 w*jSXZ]ÖYast`כhҥZV(2pl&)Z^kJ욧5=P!djѯW#Sd>xɨ1W(k}Rh1RAKV";6(> &$|ηaC6~U>N\T1mGr<\ưx;)VhgiCԻ;Tv1퉓Bh( 9f(Ͳ6fޝQt.9]NLdf\h{5OiΚd~ټ2!e2}m'ac~Qulc *"P]u"0gVtZ/Ruo oMdϻQ8mH>E &% ߇Gޏ^ȞL f)O\AaEr"$MچƟ,&"U0Nċp2;8]kZv ׻eRt: b۔nDq99e_KSKVoYtyky y g{\?K#ej<5*᨜vhy>5]$$i*ݜrm1,$ވ-Pmc֊gmMcr1J =T8|ދZT=\dy՝hQ-CX6(ڒM:X=rywz{8 "aC!OE ;G9أ]xN"_ffK6,QqTr wB|K3Τ\5"Wt/d@U5}A[ @dd0&'}- Eꥨwm%,H6G(h'/EmOGlLsي Ț]K -2vҮݼ=Rִ.j+6 XgoEOҞ,2%%'ᾆ4TVśDvC Ɛ#QdG%I]u yx_VsXm' nj]eѩcrw33\[Qסx(Ww/:%[fl G}wt l4ЮB;b娾^i GM&=XX[JB+9-w ƲFՂ]7iTl#PqV, .vow{WHEÅ7T/xW&xl iA=9N0B%s&1[6z:ݪꨡr'+~y w^[ ѦZLNi&6ߔZ_H64_RV/<Շ7]ܬvTv)ՖO;{TFKȜz> endobj 14 0 obj <> endobj 15 0 obj <> endobj 19 0 obj <> endobj 20 0 obj <> endobj 33 0 obj <> endobj 34 0 obj <>stream HVyxTW7Kɞiȃpg^(t&6,æ7L!PZwbUպ VQZRmv*X,֭B+΄~-|7߻{}9.x8_yroS=4pN9u>tnf>xXNL,RF 8o.܍!1#x?YsT0`}؁nGDZ_qr\MTE3WJjY4%P#G)DS(H&I<_`'<5Iddr ΃D*B*bi*G'~O<Ǩ ϑ+A:LB&#mH`-nP-e4bp:]g:ppؤh}]WTCMtFsj%ZVUixQjKz٫qEOrsKy==:s7OgYVG,b.c\y\c%:f\ pߞKQ-" ),}p_ΰY;}aO3ޠ: p;w3rp9[p:\xx'0ō0ac/L|!܂nff|a>a92fK㫸w& $[^,=X`z#p ~ҍb3~Mx+mwWDG:R>{]1KMT u6/0hLjٞ9eڑV9с0ĚD"v%+bҽjmBeew5 5$dRF瓰$"F/bCL)L)Ѹt6jH4h' u BnBRO,KsFfB(}y4`RxtU=ںmY.)hYD%OI)Yl`|J62>%'1>%)f4dr[D8v$Jju)CAb63KdH2TG]oM-yes h8uld^fY> ux~%:z6usν&_ ٹqG 7} $IJ1XKMcZl&?&!S4 U?:mJ60{s@(e4'{sy{|[Kk*"p&)t7*2x?UQU>reBΊvIТ UAI+8BWWRQk3` yj¯}ERFjGO6$H<53k -穑=}B{7R0 )_rI e0̲}iTH+ 9js%`k,`!іK2hRr/,-0r)I?ŵd𓻻e޳ҺAD$KV'K^7F%SQL<hrݾWg;…&CWT-Dqǀ\2'%:F݊-d?$+oiԢȖbDo -Qw(`(dyCX*p@-68?]h :&!?tILR~ `'3.gF]Mc!0N{·q&·un:%'4E<OiI4CsҜr4'p蓢x'04FөLS6Gs*l:W>og*)o3>Řկsպz*н!V]hW~iFн֎FCYݛ-'7?~^s"#dD܌lv{ZozB?~D$KqNaX 3SWY$-5֦j1תܶ`[ Qyj)F7u55;=5;3z/;O=2uX~+?>w!5< ˘ 6)jI&Ēd匕{=+@\դ"Θ88?q3}u65{5 )#_4gPbq,.1mE]reI/Z<^WpşX<[YgŨƋиctao9BqUYz12-e]1M2Y Q60p;0ɡaRzjƦ':m71 ^T},#G'rl0]rMJW&BW%"ř\Hv;5} p sʎycep}_D]ɣ)Qp(TELϖf kN^CpN15VdBCX&n8qȹMf:`WU1c4vLEc OU%eF].(Dufg{>28kݽgd}S!ֆH 7"+O劺J& Zg 7zv[OuuzpΘnY\a l\>{2-C)ctMm-5=䱃<ޞM-Ut<] /-{91ܒ;u"oz@]8ض=É̉̚$4GNb=b>h)\JnVߪCCt)0ur3˕L/]dJO6 U}c\,)]^}i>6[,ioٲSU73?? 2zֲz48\hG>-ڑjNGeQM+9Z` \ _\2Vn)ǛZ)Biz@(@lJƳs k]/}C&Gb֫'=f:5XޝBL-:.>emv@:MXI͘4͗Vx8ځ\ 9an{܆kR1xǶuGImy6qy4M$m4Yڐ6I:*RJژbH BZ LФR!2I+C;^'NۑZs}=|;~''fWcײݠ0 L~IbNgazah0)@ VʧFLcD ,sXtp7nD#I17w\xww 鱚"L*ysOЯPU!GIVnHzy={lok tx 榵Dr5w2 6,Ag5=w.G>4J~O~ם P3KC#OOG0@VUJ|Q1c@7$o.;SSRd 7kE"C^s ܢ@1u*Q J1TN:`Y {)b$?dGcodfَD>me@^>걏Qlvmm!vJ{a3_ML7"Ĉ"D ܯ(敜Q˽c;䲼ZՔn(HMZh7ume3t`Kge}e|-T$Z-m-sgΞ;Hdi 1LO2Ԁ *9opyA9YdQ"mf󇉠wl,;<ygF4t:\T2[x&3_f6+k@x6ޟHT˙O[HܑŹlqO\G5pCGx,bةҽ^Za=7G@zaF j0 b$ˣɹ}dc'Tn9rkGIa5a:cn ۍźfwѓc )u~2>}ONTs~2U_7sjAC5Nѣ %ZKԿ'3g6uwYEm;=!S K/fr ExWtр spDT?{F,guˡÂ_b`%kK|X onlXP$F0֪Ai\fa,=/c*;">Le'"W̓$I' Bgr;\z %:|OmPMlTrA:]Z5u:xɃ[K^SF gK[Fƽ'hS.>xv†,p4Ml_!10 f^Ӫ*xUto(@]0bMRiuB^/, Dx2:Ғ/p.;'C;FcFVLb #;(t rFqɔϗzS/yelT\>IZ,z`[xRBbuląg3.)P,cHAGd'R' q &"ٟϱuEpI!/.bO p>69fn˶gfll?#>/运m?nY{ouna>DA"_PcwwJ~d(7 lwqqf*d!Z{+i%4Г8ԃM' 2lOg1$vqSu7q0OئaZ i/Hhg; ML$QbRB2q~)ĄNgo Cvp>)oއQr[lǩ %m;=N qB r3y ߆ ycrg8eH#0K~6B$q2] ?"lBq>!Z'RD cz>'@"EHc0H."<{v؋b9JE}%&lM>l6ENd*>жm*BUچH4MiNȣЂP JQ,])\p .tFD<ƒ 9g{3sp)o)߬5̷4IhRA.wjXKdInQS.Q:le";Z^ԛ4 8Jݥf|ϢF'9h2F)wq_a֏/a4񝗹0|Y\CH)!bhיõ7lbpm$K%3@Ǯl|<o$yWmjEx'}-8;XuDj,ル7eҀoce Y®fs(M]Ɵ_ agQ8y>hc;žq.fuu>N{w_\-IO,a6wP?fs']mFxի3ZFB3׫RrgNbeDX'UZc]W<l`lIaŴU2'HKfg{9*6塑B`y [ކȜ ,G##(,U~QBIդ OP endstream endobj 32 0 obj <> endobj 35 0 obj <>stream HVyxTW7K!/;f@Rҙ 6-}$)(Ժw TbMmhjOXHݭ[B+4΄~-/߻{93c7.8]fLd_k'z}gүpM-b{{d};vN}n_GSpj3i?\7x%3)ԅ'㞕+8pAsKQgS:Jkw+k190gM/</fq<gO*4 pi7/_$~qs N WHqI5<阁\V,,E'V͸6؄n?cZb7n^ćA|_q71#p?2q ~AxÏ W keg38{ӧN?ڬh+i&:9bT+&h5Z֨ZzZMu>m{.{k7]̩}yʌx>òRÕ؂'- \5o[]Y-³xdqup)3:s?ʕJ{/XH51_k,$rW};Nf}ΰ{ 7qoa GHg^s6; (@ʸ6T dn7Q[a>8^|i_9 s/`> k%1 r |Q܃;Xp-~!6q?O?f%MSf4`2[8v(Jju)~`Ng,WȢk;ty,T%R. Ǹ)3GꙦw0;_ӸZY(+<̎xvk®ǻNb<^?k]; N1ȃ%1$88MDT@FRwQT4ʟJiH"Eҗ~(IU^;9sw<DFR#s暐D|SX$Z^noT(x7- >|rlчQ1#㠙1wRڊI`j-]~,IGm[iW'ihX[F_xHu -L6ۈ{If{&igjn)$ BXF4!{pb#S@T(KH; ;e[P L'8vquq'"_E耈C".B=""(r>_b]v>FI+ qf9Oؐ8O rVx ِG`'KxچDxƆD=oX 6$18!oC"܎b%ې/ؐ?ēYI bdP/ttZMɝx/x,{ iURVZ\T9. a=XRncؗv݅+ 7z'7of86|$.4 Z5Ll@RQ#zBF,\ժfL4Cu[O[סfIxcI'a[x4l@c2 ҸLUٸ$<|N'|>:Vz$ZE5z< F@cM!pXsu-CMx4j~>.\xL-N߸u_|5gG;j3=) 5X ;*J*OH\O` ^q΀C=fcs̤ЌP57&m pg_\ѡNmSW+#]v3wotX[okOfԃFZc`y QdTh@=GPϨ*vcp;J->HEqE,7\̞O*(SEync- fbjyʺ639:?f_Ʒ%PУGH7*qu﨟S-kYƜo;&>eėҷ&brj/,q$G!+rSu'LLQJr͚5MkBn63EZuX\uPʶQ_'Owb}`3smoZlY&wmy剉`oƫ6sw>۱kbvszI&m&iRW&ZPUi 4ݰ*`Tba* (j&1$>mBC/KҖ Yws~Z@_ZFwYV`r.![~D٠'Uء;l?B'hxc$D+9 KPL.Uj>(laXZh MdSF@GSC)z\.L+~poggȉm7K Ůs_,vKIoύ'^\.džl b}1A᷶" y34miɭƏiL@Э&&d5a{^.ҵ\rV?Q3C|ăp0I`=G7%P99C$ЋZqmy<㷘^J g1iEpv']+Cˣ]SZALd|(Ou:V\L_I@rQPYYBk@3AR.&\U,K,D Ǣj]jSZ3K&ChE{CzO/i/ רam\Aij*QUjF4,lAZ~ŀ>N|RZځt:lrPa{Fe@^Tj!٬$Zmbެj k5]4uۓ!`^92H{T(JC߅7l^ɉ]}Å@s3(#F{?dm1goC8,p(^+|֋}wkf} aH,u>\Džp^GQX*iRp00_54y@BXk]z kN?:x +slҀxXCi +SU5,؜/h_^߻sTD%6!ۈmP p!pq& iH¡&ZpSs:-jUd'!_mkrOpǭa~*dbVDߘ^!YzHhdߡ HX4*;R(ծ =:n&].OIϫf| y`c&û-0unXڬB6@*peXr40PǏWŕ ]*˥%|jpxX 74&R6&nl[\ᳩ=hs'HjGໍ:ᾨ1vUaW< RwPz@ȯP V^{;0Yd>mgLDTkt1Jl hOo\S!?8@y?Eߓ3lfi:AрJhhe~A|"QRS71 1ρJPA!IHr"Rɗ}b+3QQ* O<+ABWnvۮ78P趠`azohgq`r:Cy4? ui=˪8jjh XrMڬ Z$bnlT4<蘘̕#/:!#2 M [9J5} Eމ ј]m,Kw>oJ+ q6Z UhhUEo,f ]&*y||#+4&H6Z-.ɾOnIK;GH&]"5A'Ha@~Sx߂Y#i5$kTNv-s)/JI_W$1Mn 8'ZA1!FqDzS桻_*۰!v 6j8g\ @/V1{g@f]U% &k./VGUPWd^ٓA㌺>#)E ϥ3~ ־%=z`NW+Fci*_2>Wl+<M ò;e[_ѕ)quo~'_ybEQ~AauUuiAA^g,Y,ͮ-Mk1לٖPsjP7dQ=o'9Ej*ѻ[׉zXA4H185sT2 v>|7RnD0+;^DeϠHd^Cyq?D9| cC'2{(^A3GE > (%?-jr͆PG)5ϔ|vR&!Sҩ+n}_p"j -@߆9ss+hj^](t֔@<X)Pz4x==sA:tϗAv_`@]%/ ۱ƋʀV jp :*`™~oUKwYs3D) j*]P}DZ#6ζ`-کX8CSשXF @B5C OB^G +1F|UlrpM@Gv~ k tEcn\%(-ɑ+J̫$M7 xyߣDir{ԂoZ Y\пB݀L}gZw&)p}cܑV ]>'SiJU* ̣ .@mnP-Ѕ Cџ璆/@C һWL%*߭zʥQdԎs*h9VyN̫[T^~PuRy=5Ɇ`_URZa^kn zGcsAhpwp؈stPo+,ol'9]=oP6̣]=];͡Vez a "]p2%TJ֣e X3 []Oc(6L#=#p&X}aг Bڄt vj&[N0=9 {<|cD򹺀Q߅^ôm!ځw3; 9N/A =-SINn.@C_,T$KCޡ|:(d jFק$j Iq2O~`8 wC6㹔kH2pS $Ƌ56Gl!~ endstream endobj 30 0 obj [36 0 R] endobj 31 0 obj <>stream H\j0EY& ?c:[ZW*0sqūhI`PZZ=^fqR w'zƽ]fc9O]`sS[߭D6_Uތ$kg޺lHWny_e1 qtmȟڟ~,>= !!:쉲=Se@*ЙDYPY9PP2ΡfzE+yᗸY뭢!VwɀW 0^ R endstream endobj 36 0 obj <> endobj 37 0 obj <> endobj 38 0 obj <> endobj 39 0 obj <>stream H @"@L endstream endobj 40 0 obj <>stream HW[l>g] x9;0ekbC!%̲)B %-m[ڬ^RT}ԧQ~b.jEs\kao::c]o.0֖8wXdBi>z DŽO;xԅʥ?˰_bLbe_C\*]\oK+ 5_6c!*/+l{Xak~G91x>bB?b[n ddoSW[->Z kwV?EW?[C:<3b'#Dk?VPSՀ. [iX+Y0s2rsiM%ŴL1/Խ ZVWm@ҙ}6WlELe] B#>40U 5D!b+TJB5m3ẗ́ 8xqbE{q*` LY**$s*,sQM)ᗘicJse4DET`:J"c[K-*;gCSh5i2UJ-3TCȸ̕vvQ2P\mw쬠TuNy6ˑfsF#QZ4\+Yxb:T NֽDudi7ѲrՇULErKs֥ ifV5-KSin(jrsTf1j(:/%(îj\QqjGjY8nWSNj[*fم9R70*NՎKRNu$窭hC*H*%*/4$ձi 8d`RS*cٲ۷9ji*m!s"Zp%\N0XvUjIH!>IG܎H >)&c6a6 u-z&Ռ)-܁ 0#֩,MHdP8ͳキ>9Q(0nEi"ɴOT2PH\Tf ZW:+8]HZTBm-h*j*)d~"2^*0ridٷ5m?䨑6'K-qKoh;/U*CY%إFB{(iY~O1"D@B8Y'vŎQsϢ*B 0AN"E{* M6G2̎1W.y_W$F־=X*%l?^*xk~SMe0gݩ |֥ f&t,%.Ku }:83sKQPBkN|̣NyhwʐL"i= ?/p;3ju`;թƀjDG4ޥL2as 'p\L9F<,qq8aFI6l !'txzx2$<qbƮox#o5ҊױO N6<|Hooae>{ȣ߇DV?!~C"kގjZP{8]|Y֑mmokiFAR1#fpcc`vtn+Õ[Ғv)x|E|Ǧ#<#<@pi;!x(OD!]9tM{7%6E#])>Htw#ݞK#F`Ȯ##'GW~˧373MVpfP{xtNʧ9?2FA_Z~G 4ε5V6yߺX,lL1֫ m Jr\Pv9vP4 _@Av;l)0d %q} N6v#IG(W^o%0f#ק& wrKŚᱟ{ε'mn<(jm4MGS'ΫI&q{NyyqGN㶉Si(lSiUTPmh?JC[(i!?*X$*&%sB~>{={u{{HKGGˈ_5t*$y|M\:9dץɲb,$l[1ar7`g)상8fjsfTֻpm'{ڏV_iu6}fWn] Ľ@^C:Wrj9Ԧ8Gd݄JLM8A5)321lXϯ6pq؍J^F ՗֪Z|vAi?rwN0o8+Ar[}}^o|@/Hkj_Z!v zrM$L$kfڜ)"Jj7٘g{ާ=㞺=_k-2F-{R ggKQea&4cR=#BJ~SkqDV7Wj͎Faɒ[Uv^[nmxMM-*sLcG^Aa^zF=eJc̛g7g[ w;Mv lP.\fdW!;/¢c#вLOa\:O}=bފM@.2;Ԁͬӟ?0is= Z|gZE"[aDu0So&5Rh]M8\3uQPyF^b~4̖>%a/;/eO?̒L?s\O 5\I"FA/(Y@Lp4Σ}bg$F P$Sʇo6ڕv7WSӤ&~ >(!}{1 z]I~!^l詼C2J@;K/h<fx?m/aOug4^멗tNǣGft9=ǎEB !1+c3# sљPlfX`hlZY NPDD|2Ǧ{U QhN8E(M};LS3QD@;At vxH44~%̣l$}0C9ѐ"7sK)A2V.G&Ob6nىȩ>RMppWw d  9U ð *eOYKG/#p =VJمU߅Z) |BA!2ύ2CgVdWu]u--,SW?P1b endstream endobj 28 0 obj [41 0 R] endobj 29 0 obj <>stream H\ݮ0y^sqB!1&P b~2v9Nmىm>NyI>.n{$3M>CZM>/3 ^KC.*d =>)5S8kx Z'@ޒV᳥d]8q̺ >yF>%Pup_K6.yuw,\`g+ endstream endobj 41 0 obj <> endobj 42 0 obj <> endobj 43 0 obj <> endobj 44 0 obj <>stream HxDž@JAL}b ' endstream endobj 45 0 obj <>stream HWKp}-^5X;HˎV <# `lyǞJQJ "THRE8JR)|9]>$!RIe)urEVesljW/ߝzEC sK\(c7~}i9c=XX^ 0_ ń}pe<>XhQg 1%_ojxKMx5?b!芚/,^$! cGbf, Bۚv##f/{`jk{k_i_hk_!,bP츝uc 9Uv:(Y]brNs r34C, ]3+;yϪp֎@3qh c*B rQمSP=!惼-M TMv1#HWChЀ'G*TC``gB228]S B)4!uz*Ϋ@wJKEJ=N9ay0҉;Blt lT!CE L1LAisK 6Uj5/ҮCwsX2+鎯x5.<,lQ.^N9UB/QYMn\m*? m: h&b2tMUo4- j0@BYi98FcdFlD ,W]4S5i\uElsS|7lXu.56Z21Ag'9SG=μ]!L%qezZ@3"}TXD,ņW8^Z VbZvV2#Fe F9k`L-5Äށ4"bFlCIo -F)DrQ ԍR6TE9TMCV.2,ERStALսAٶ|W&6(֕}S!o"@|$㈏d#)툏d'#مH@|$w">!R15 Bm]+%Ag5i(3L]b*LN]ݥem42 p<5DxI#O5N[btXzyCƭ( HL58&S$8|P8.*l"Y8"ChQm fGSVbBoRÀ)KM#=aD@wV'C =Yzl9+l=~]jf{CVaj*.5ڻC1%,!> {  =+v:='-~_%rd )ڿRU~LQ^j=}L9lN^}yR_;1:iǺ\)IgOJ\+FHRTeu2EItD~g8hij f 7QotԦT4Xay!٬ԄeIR!xun) jQ).ĝY֡D%cMe9HփG1 喤}&omQ 5e`1wi%S/tUfp8fpo&L' 0IS!0MǍzNqd 9f硗硓)i̒M&l(g `8C`8=2@K_x~:E۞_y~zy/B}|a>DIFi^k̹C|2 _uo䭸CZ]} oooZ7!!2]>$=G~݇D+˄}H|HAj&U`{~67vbaVX#kL5TEAB= GCHHZo޾[=]|U[5|"u%ƜRќ^dH4 G2xݹ}u}wx@ڝvmeYt4~iU<B8O )ftwo "C o͝-E 7:±Xk\|pəigr׵{_*\M `68!5Y4?锬R(QNF])SS'JT%ҶȺ+wlm<|X R x|1 h_wH+iqkr r7"z!Vpz^0-aiܹ392%`"|,kZ]򭻔YӜfsr\ޖ& {C& ڵ: tT_.#=*RW7ڻQv =C6f AɏD9~Т @7xsOwBs/ PtWToxݮF 36( K "~0gu8vNG_r܁\(=]^:G=q't;kl乵6@<5ڼ˴z866Z3ŚdȖEe 4&U;M-r41fÆ5'%+-̃|M u#9L?d&TzةxҦ4|a S̖k`YV$U>R'O3nl= m,V5tO\9<`'cxV̛PxoÍSkinV9vO%1|L D[ӯ\x=OI_ ȃx [=63(XwY@E͊+鯓tr([I_?5.%Ґ'҇3ᡅlx*>5ଇȧq!HD(O<FB+GOކ])a7=\2Z];||e򩒲4yfIl5vnYDhM9H!"q6c!^aQ3`01 ,Ip&[`(4 N COIF"1f "vEvT0efFb;op Y}fu߆ ~tް??,]mYcm!^%Q9~ L~$y'oۏK1eԯE+`0c&â ,:4(E!C3,ZKI_a-]ԟx܊2n0Vv-``Bo\^`Wl5@۟}_7Wjs)Cﰞ:bPd p1>pv櫳m't0̫P0I"',OHɶwEK,iu[TL-Ay-qL[tf[ ZT8,3q?Z$fVȻyk3S6Qꉹ!1wCkh}Z4u5C }1|m^ST\h,*/ĵYn {a]חvIJ^:?02_2S4h'm-DO.5^쇐YI[vg IJ%p2 yD GoOt)"1LjtB}H,_=kkiv:p= !}Ǹa|F @dC Q2"8LzhuJrB&l vYӁcG̝=΅AoWWO¢r U@O{ - 7E.b1%jO*6f-,/3;0)ة!nɡCDC yUndܤ4N%@ֿzq񽟮r>wb> <ЫAR +kK>i(l%Fhԗ:Vu"].]۳{T] L/ ٖ--)R`r2ABJD@KQ,vo=,т+BM(|pr#׏S7Zu2qV+d;9kjDuN)`kh)Vß9=h?ښfBlM6khi'tem")3;㿴)zZ=DciV5.A6ѡ.i(Wֳ=2A\ag;HES50(vk2I"MDl{yi$4Z_ EjPd߾9xt)=!}8LԾ e}>ve PE<` m٨G B#Ђ7Ͼd2w>X IH d`vBs/0"&> itQPO-OQzKZq顧`bdBzn復hp<^iٝ/8(ûVhj`3C^.!g}䨟zE "Cv "< |"2(8VQU'*72 b&E,pγzwzqij+q/1yg~OӐ.xȘSer4TdEN0@0 ȨdlixۅD D'uNm,s{Ψsd.$+ёL8<=fw#{J|x>\ R`j"N@ bX 9 e,T17}vykŇ/eW/[lFwhMKJ%Sbz -ǔj>}*yJ4L@ܻ܃}fW^,zs8,sݳ}S'_̌ĦFٝ-llڢ]D#^jl(<q5Vjnpku 0535՝ǻ=]==cݘ1x@t.f_y B$AĽkqϵZX_ϯ7c Ya%Y܆5㊼2_jJ4 3  ǐ{-k|p@2C0 dx:\`E)Hmp]xmZ Xc=O UEe?]tU1ՒHW_@LR3d-7d2:4upe-c?NOh* ?x ,pğx!($M. H,)ʟiƾԳ:X.=  HJ`8ͩ*"TAHԪkkxߊͨ|DuEa ExA.UP(8Tp3ȌCC[koD[C}hlbմP#4CӘ>iB)%m?0Cʟo:ks}ڳY3KV{R?R?n-{1ƾ e\ՋZIc4d x!"^?>+g6=漚yEFZkfHS᱈}$l,}Qƾ?X gD}=C? UpKP&)$P4Kl%[/)csK<0:f([ 뢝 rs  ,$md,S0%HQ.L2& m;vцӁSpb$ƾyQ$ȧ# CNP$v"g6(ҖRڰnVRjX+ 6  ~`I\񉰢 [)21Oidk8P.js4X/FQ/ie2=!~N0`U0O1W#-Y5:Ml=6 2QJdDX9IVy8w#p)C>+0󼖇{N۫ZܥxCcbTևCD'yJ#Q\a2J<Ƴv-o@$&v3ƹߓ D[;u%V<,P|@G.'Fn$1\mC.Bbm=u eЏnR-7 ҉ 5DbEśXQ/rG*YB5Υb7Jpῥ;4{9 jd]TZB!m=5ߒ&Q`:#nN]qW&LǪBCg'4hh4R$S);)uЈ):fTdFyڄ٘?t %C#KsƵ]4Ze| wKUw;0&}4462I> endobj 8 0 obj <>stream HWۊ$ }Ǚ EHqyvm02 ^0\wYX9RdfU_cTfBQZd?No~.->UNeKm._ߟ>Sy3O#Kl=ϧ P ^פmf~PZ],W%w[ky-d<Nv:I֔|kǎ)$]M`%9/sYn71Vva!MkβK}kou͠ b]Rڂ#KYBYgJtw>}͆t* KwoB1x͵gũ4n&rF.4vڟ+yMmS M BVvu{mqCuQ7UG+CUȤ{ASږTU I$OHбyy*MJLSsB쨚Mfҡcԛ罼%Ϫ4m5,I/JJ0ZZĆ"*ejݎp~\mP`ׅ4V\|a:`+wؿ.HaIȲ=iC"Gm ⭲nb!~˘*"P?ޑg ҂Xx`Ns'c>$*M{/޽ '5N2IGx=d VٗW_]Wr5U茛?}޾D>d4l(ҫ^kï(Ʋ_e" X%kS0YۧyQ6yGi _KFuSbfel2:̣73_1=Թq(Tܾ?^ ųiluxlgnafZo6u>r#vٽ%׀$P.ͻOiKx?P|E%1IcYNFB)Ͼ^T F[H!W\!HxM B!p+ LD_Bb 5@ DF C.U0ꌆvS&:/'9)2TG \yVXMԡ^;5T5wܣpFJN{7(dGb`vm flK fofWf gtk̢3D$ J Q;(e0gdyxy&--B"2cC='^X*HN֜IDz6 @AZ̦L*GiV*p5ao= U jSn=zZf/2Fxŝ'cPȌ3r&ec[;hC[,[;  :oϽ6[6Rs`O $ddci+HΩ6*6 .&vI1^b{ZhR ("\[=@?D[}Dx8d1a-E9`D5p1D8cB 5zfw]Cw24Xn1*uUų^mHgַ9OH~:iA$=(da|-`e^)ԨBzkd[I\xqfo!+ŃL 9Ic%Ղ-!:f 2S' xBX $Gg3X_ז9S^-;rG_@Cap 2a˥DX+YկRN3]JpO 'hA MY #_O@ EDnG <#>X@P3gc9IFk#zR|k#-`d3g/ F: *M샛t{NJ~ĺl*mfylLPtIjq9x2SfZ:!.gFD!*ZjmmY!H;>DWP\%HsgI,JUrjFTԈ5\QOM[!VuLH%RfCI5)]B`];`MG`BMz>dh+7*8d"Yl5 sEtQG`QYV~x~74IVQF(K3 H>< a1peE1x:6'jhV9u~̜l0+%g圜-eI@dRٛȹ6rRC9e$!!)A cLTER&Ovh'THf (}`G|OT@1e[T&;@ hK$U e]+ȇ5cMvr^[< GoOɴ/fdO=]ɎTkrSV+;̂ୗeY'›30(}jqL pPE9~" >{LhAC׀h\ѻP<Mg0NFɤ,~)h& Uh2>(o &L)ӇN+LOaį @B*| ݰ2k'1X,$9!%x\(|3Ӈo!N7BϚ1WexlȂaO{DNj#J5^x|7urNv#**DG3`'$h50?EqtdMO\O v[y4tLG)u?a8 #y;8]38wp ';СHö 4}ŐUN#M-i=l(ѻߢ|ԖWI$ZL2w=7SMoos/gY߻3o޹|Ұڱg]/9{'f>+a+ۚΧPmYAѾ~v䥝5[[x S?;WcyRyW< bl{7.ބDhFH4L׶9Z #W}D"֗s@ 8r#[p\A } =n9>i7۴ƾqKJ\ Zn Ręw;lӜݰyԂ<گqYŵ"f<}~.3w>*jSi c~O}Ij]k.JsXr] h^ՏTtKsG 2Cݨ˒C0KP˸^CafÝ=e~>F1mFJ)3V$o|[C9M8nfò֌iN.W+&Xc&r34z%u6Fk_J cz2a^!wmegkӛjr~ۄz([QM."tv$r9jJ*y)'}Fʼ9noaQ˴g3q2ԻmFX':SޞF]^I-q.M[7H I4 w}Fq^Ji.&Dρ!XLSVwlJE2ڭMWP"ER[Z&{ obSB:%axvIq)g1 X8 `6 _?MOMSΔ2rpGJ$hX妷cdy痣* F90=ގ?j8sf d '|H@^QIV>W=;3.i[9z|ն̵,̞KuEH烩T&Oܪ0ԬچyBjRh^i S0J%:_]n>"0suCtaX 6#a#Բ%U܂~94^v~7r 9w&4]tҀUXUTDpNk4$ƍ6]iG76o7ť˿HscIʣpULrwqcD(}@O߾2`\#$ 6")рiNOÄіQgHpEQp5ye@[V2$S~e}AԳ/ٹT柶,<\!j5OMkΑBf|w>~t}]((B[q-lxJ22j5m'8l&+/_k'f!TjNksU# a)zω_[XHk6gr\ FCȢq/p=&#K`,1|lpƕ!1qS,$}#4QB6b->4mIFOBFS5JɮuSd@8FE-H||G1xC[ՅnRg4I8(F`<@]SteD1k"~$Jo !0RIJdXhAYkYڠ\k2C|*X 8UP n-I fgQj1_qSH``P6Z$ A6 ! Q)e_&0O< ݍ%_R@ , : ?q/;qy_.F[f[G02PoU^Dƪ .֐l'[;@X5;>'EݙD2-+-+]#k""[}Hة9&ix$⮈pj:h҆1:MRځv1 *\OP (: UTxq[1OUI_Y޲+Jz00,aw#E$7Fr:1;"$W@POS湶0̝v}b<"O6\K8[RMx=7Ԋ gW,ScYV&z7LCH[0^x`'&"ƕ 䌓L&o0I4- fE娅 &##OQPP14*?R3Nd"r Xe{Ieh#*^|([̎׾{ M۰ֈ/\&$UxC-Y A4J5ru8m ]tWB<BD0 f''EMHY>p)p@p/MD(7.E髮"LPλ{, ĢsAnw3Ѽ1F"cbϸ8.N'&/aJ'm%#|qj0EF+sib-.Mg,+y˂eGw2 #>R[M80) *FDy= ʜ| =)\A3JᐭLkk%5=R,Wa!ki#LĢzdr 2@EOg1,VU= Smm bX-QӒIr"4˹rHAcҖY [},oVLj%ۀZrn[hԝA]>ݱ!(vo<[](IxmEs_]"y nшr4 NX@]Z#1PTY0Q)A^Ch{1wDƹ&A;8z6B=34`$T- UF7ڂ`pa\WicaAmw&ӶLVOzL}cz8_ $K7EwŢNabAAEע%@(N"%;q˲5m>c1.ߥ59͓ W;bu((Φ*&ીȶ *J?VIghQ3 w'Cy٭v{ID?XuA0N*Z 8Vydh+HV.*YpU`fK]3! ؉Q *:4,Y7Yf%и"Ά*d@F(,)YP(ܝ?Yp_Mi$ʹ.?K_rs.ӱd 瘟%XaO&<,  S_~?l^]n>"3:bb00t0nb"36W[s[~8pFM!tYvҒ+)M}Q|I'A".ͣZFYp|6LtGgYDYL>UbO MZ1i#wڬ@e}ďE˚e. MqŅbG[XRNs='IJfs-ct` w,̠E~☵㘵SکeƬs>U8$6˄kW&nWw]h< >H4}=S#o3F!0'ް-(vcx߂ˆ :Gy*\' L".q#8׃l6/u_6#!_̈́=\Aᚂ,{ay!xtͩEqOˋ ʋ5K6#w'; YQ˥9^ineq\X+ L1AT@^ llرQ$WZ]v" ΒfAȱs#Bv9w,(YL0P8=di #P\ρ$i#i=>PEνlZpi8 DF=R꜠d//,-HP&o/<9K(\мnqXJ"ے\#f=Rs$){ɖS=3$1J.:OhΗӟÑ&X._\\@"rR-ʲD juE.,Y~JE՛ۻ4g7oVbO TֽL,?3uFBaf7p ܱpK)u%B-z +SP/tϹQ8hmi߸4>ץ8`bAk ,k]* * "B!=YҲz[72*TXYDR!UʆZiNCesj$fK傠' FiR-nӎz'w-N `}&^>шd"_Sō.BM&o2߀oVLJ]wEE+ǁY^)O^>( LiX911{\Lc&'W:0$JzUOu1#T6;v4œ7&NY2`dtU3,%JO;r6QDZ:UY%<4T@Ofz_bVto?4cBDV p J{2Hm 0=7)abtc W7O ƕa`߆o*UF:.˾ޙp4%Mtvxr<^C|^O{Cwah|75׾Ps1v_.Jm/rfrY(>'w9|S毟ߥv=dSO_m>|b0ȫm֍r~dtwpExXF+ =l1qǻ<ă96ZP)Ï2&[g"ߣ~y{z_-oOwٿ^= 0U֌x\ W ~h.o_^^_7/n^6LW\_847ׯ{h^ݾinkݾZykCsuK0Po8r3cvɘxjL1əq~sa8>s;;O~O~)~'݅mj)-rp>57VڽO [OD]y2=s=w[O>DI*Cg)WSi~㙱#)Ί" ß5;C~08!4egUYyEn3GۻW7ِWܬk;Dij~We~7V\]Q󓡫v<}|0$ҧCj[C0?gN+AKs+j04y />pC/ËWwoW<;k#U}2w/0KfD?~u?N!tKZo@Q(j0+;=7O*\qx-)<. =#Z\vQxߖ h7˦,~8&^<<+lf+ubNfnf٣F7ʙ \l\ak;a 76Qmx5q]Őeq2:pQ$9o HKͭr7asX*MzLKealׄr~}k1?tzm0m#u3H'\ h\eY'Mo_a}+fG-as]|ϥUn-[S^chVw~Yjb"Jw:  veZiv!Κ1φ Ω5w>g#g:-ձEK߹n: >Xn[u( %g!k-}.r鴄',}֍w+63,XպV;gɡGQZ]p=E{7>7):q [ҡsm|ŶF/UqD+&\LLwυIK99 OZ2-J^UuOR"NGwuիWrŎO wKEM?*EhOwEޯoFtTg]7:AMy$o3;?)sJTn:ÏlW;Y[: fBoV`I;U N*)$AUs#OZK Kcb` :¯R@dK-R62iN 3Tָ[~vVU)ј+B#w"U \i|`~F]Õ9Q-1c2VF߉_\S7R :x°$[%ۀaPiCx V}3 !m5?!jھXizޗԶXE3,(hm(s̹-ҟSeMٰv6mJQ49~I:޲\)͵ut#uT~[ɢ.[g'+1R+$F5n^M~d8d&N'x0|fV6w?`x~o~vrI#} fѓS#WZQR|FWBc5IU uĿ.hn:!d%PF-ڲkciY6 %߮C[rS6sN镞UJd@tGsMm7_o×+Sj>\Mh|y/E)9::æ=npayZv5?==Qp_BkB6f%3.AV%;Ҋ©~T$#d-Nlҫ Dmᰑ*YMA"мGW]kRogM)tŸTo~z^j*]U~ъdĂ 0SbL]͜Pl;BgBv ,?Dfܩ qP}4~Efd6q(3ssT3u?H74/~H8/>8<>?X@o#mKHa~tyy/X \zu'D]sFxaFx\q]699@Rv DbN-(o<S~;cj&̄5x kW RZ<%0Zf4n^#bF( =B}H,\S<1a?R"o-ΝXdlĺ$^plH- .bAgb~%ռ8/+@5|\mԙ˂ V ETBсx%YaxN?3 5:M<;xm|PJ: sQ,1/ )%뻹Y^N Q= (~pHH.>?3tLKGN XJKjV+qWM51Q\eK0wY|ipk[S6@uuz}<͌Gٟ,z+\I{;_[ic?"A5le95/UdWr(d #)h”: u-j8;85@E$\$QMtחOOd@+:9x?)I$FQZ@`f ⼴a^צ}\Kzz;ZewknޝF\}:ྱbz" 7@{?$)՞vv+A^ t}iF\kEG%lHǨ=a^G -R x7w [<ax7]$DQ-cg|<^oˏI3'u6RrWH|SKKYKN\C*lbc? zۤ[@^]ţa5=? Ifn EvEyZ}3UMƖ/+EdScς?^_8kx lHK%,Mg3j B\F>M#7-dV̖>θ SS9Ir#66S!/(y7w.pX :? ܿHDa&'_kh]n]4//Xr:*G \?yicTȴ~`BMfw? 7yſxc 7i𥈎˞kG-AnGTI-:14GgP h0ZwӮ{k`xlwzO.F,:W|Z_; w:D);GHtjׄװ28U5t&)M~`Sɖ`[qYF:Hج>YKYibu_~]4 @IlNQW̓+Vsbm@6쓾åˍjns?|5H/wWO2,Xb(׀LQu9\((zC:2nZ_x`^ױױ[GWZ: Y3ԌBpXws6*͹j`M 6/ZN^MAv;O3EE#KeijRs gDtsWq;煙L;_T~ǚo^/_ gǃt~bᥐoc YWus4̷6$C9_><@`qlNI.~w`>_pr]l&~YaA<P_v'n?kL _&h"َ FۯnŔts_Mgazv{_/~׉ $A(H?#Ce߅-v\ nuvR50ՇJᝇ-{e' ƚ()ܤ璒ڻ3mUm֨'M>x~+>}/EXPZ* !q Cs/0Uɺ_a-6|~W( +;ypC cjlRF6dR5ᄲxLN>|qPI nShvzYrEĕ 0HyXht 5ST5RՂƷ;{ܫLm8wDSo?%՚[<Ӕ[v}04HV4qEC?@Dvɿrܣ_Vw_cKZIX7-[9-' Xѐ~eMy96:'3bS#~ܻ:EG^viQis2K F)edžI抨o~fri-`͙ 39MŠ0:di bx1hH2Ҿ`bE>̪# WfV8U'YT@x XYZ9tcAEPZϮt0BK?ѥM5,ٕP|;})RHf"Ȃ}9UC:RH/x9kRQbjdfp}cMd-%y8Ȓy+U;8eϟ8f![etOѲE 4ijRH_'In)RA۸]ɶ~\:ᮖ 6*N G(JZm 条qC.4i76 =7`mpzÙYpp|<4aDCCi(f(%Oö+;UG+aKQ\´G)l(6OK=&}8,Ehrs^)joLxQletz޸aJ@VE)3ѐ9ƣCx2Dq#kEJXn5%!BYNkWWEޓr%(r-Lh&֯Y9|2sţlrgf{_ެmUʺ'> J"vFn!?5wfm+UF|cd撅A)e5uFBBQTE@OB'/܂ݛCBB VP]*C}- B,6ub{͖P$٪ y7J-Odxڽo ^:+r}Xzc8#}˅f }h}mkZ;J vpO͘ 5*{dMb*wVa uJ0*-( !O߼/-/j1; } ^3j4:Er{4MU ZUeXhc4]-H^^#YV+PX5̴٢e@~x]Ӻ\Z͒kf{5(69CjE@﫢dx!`J]1Eq)& !豊2 `Dlif uzPw'^D~g3M2*P kQe)>{%5`0}58;9ؙܕZ?̰%W[BJ΄p =>J醎."@6#$'JviI*6BQx+ɪ[h Gё*?. "juy@sRx_X#r~-]]ͩ0tY$=:^F?@$PfB:p܏>v!qOQU?G~Ghj>=Ga<:>?0  BYq/+)h<~IDڙatU+Oꏿ_jakb`^ f|uyWJ}Ŝ`׈NS|tlOW7/nnWOv7ߜo?^ۋ͛7:l/ooޜ|޼~qupͫ|/rE),ą˓!B{,!b_yZkR[h;i6gأ==ٷGXڏߝ}|7}xstKk}?_"6}[iݻ^_fɩ `% endstream endobj 9 0 obj <> endobj 23 0 obj <>/XObject<>>>/Subtype/Form>>stream q 613.509 627.696 -613.375 164.17 re W n q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS0 gs 0 TL/Fm0 Do Q q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS1 gs 0 TL/Fm1 Do Q Q 0.398 0.316 0.316 0.105 K 0.268 w 10 M 0 j 0 J []0 d /GS2 gs 613.509 627.696 -613.375 164.17 re S endstream endobj 24 0 obj <>>>/Subtype/Form>>stream 0 0.91 1 0.55 k /GS0 gs q 1 0 0 1 218.7202 768.5254 cm 0 0 m 21.575 0 39.094 -17.314 39.448 -38.805 c 39.451 -38.584 39.465 -38.367 39.465 -38.146 c 39.465 -16.349 21.795 1.319 0 1.319 c -21.795 1.319 -39.466 -16.349 -39.466 -38.146 c -39.466 -38.367 -39.452 -38.584 -39.449 -38.805 c -39.095 -17.314 -21.574 0 0 0 c f Q endstream endobj 25 0 obj <>>>/Subtype/Form>>stream 0.293 0.941 1 0.391 k /GS0 gs q 1 0 0 1 97.0952 593.1733 cm 0 0 m 16.881 0 30.59 -13.548 30.867 -30.363 c 30.869 -30.191 30.88 -30.021 30.88 -29.848 c 30.88 -12.792 17.054 1.032 0 1.032 c -17.054 1.032 -30.88 -12.792 -30.88 -29.848 c -30.88 -30.021 -30.87 -30.191 -30.867 -30.363 c -30.591 -13.548 -16.881 0 0 0 c f Q endstream endobj 52 0 obj <> endobj 51 0 obj <> endobj 46 0 obj <> endobj 49 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.05 k /GS0 gs q 1 0 0 1 285.8794 340.5039 cm 0 0 m -2.102 1.728 l 432.008 371.323 l 434.096 369.57 l h f Q q 1 0 0 1 276.4453 348.4619 cm 0 0 m -2.085 1.7 l 432.008 371.284 l 434.08 369.542 l h f Q q 1 0 0 1 266.9795 356.3662 cm 0 0 m -2.039 1.754 l 432.057 371.296 l 434.143 369.583 l h f Q q 1 0 0 1 257.5298 364.2969 cm 0 0 m -2.054 1.74 l 432.04 371.324 l 434.127 369.57 l h f Q q 1 0 0 1 248.1274 372.2539 cm 0 0 m -2.085 1.7 l 432.025 371.311 l 434.094 369.556 l h f Q q 1 0 0 1 238.6464 380.1719 cm 0 0 m -2.055 1.74 l 432.072 371.336 l 434.127 369.583 l h f Q q 1 0 0 1 229.228 388.0889 cm 0 0 m -2.07 1.74 l 432.041 371.337 l 434.112 369.584 l h f Q q 1 0 0 1 219.7783 396.0332 cm 0 0 m -2.054 1.727 l 432.04 371.324 l 434.126 369.583 l h f Q q 1 0 0 1 210.3442 403.9644 cm 0 0 m -2.07 1.74 l 432.04 371.337 l 434.111 369.583 l h f Q q 1 0 0 1 200.9262 411.895 cm 0 0 m -2.07 1.726 l 432.008 371.323 l 434.096 369.57 l h f Q q 1 0 0 1 191.4765 419.8257 cm 0 0 m -2.054 1.728 l 432.041 371.323 l 434.11 369.596 l h f Q q 1 0 0 1 182.0424 427.77 cm 0 0 m -2.07 1.726 l 432.024 371.323 l 434.096 369.57 l h f Q q 1 0 0 1 172.6401 435.7266 cm 0 0 m -2.086 1.714 l 431.993 371.297 l 434.079 369.544 l h f Q q 1 0 0 1 163.1743 443.6313 cm 0 0 m -2.039 1.753 l 432.041 371.31 l 434.094 369.583 l h f Q q 1 0 0 1 153.7246 451.562 cm 0 0 m -2.054 1.74 l 432.024 371.323 l 434.11 369.57 l h f Q q 1 0 0 1 144.3222 459.52 cm 0 0 m -2.086 1.712 l 432.009 371.296 l 434.079 369.556 l h f Q q 1 0 0 1 134.8569 467.437 cm 0 0 m -2.039 1.753 l 432.024 371.337 l 434.11 369.583 l h f Q q 1 0 0 1 125.4228 475.354 cm 0 0 m -2.07 1.741 l 432.025 371.351 l 434.094 369.597 l h f Q q 1 0 0 1 116.02 483.312 cm 0 0 m -2.085 1.714 l 432.01 371.324 l 434.096 369.596 l h f Q q 1 0 0 1 106.5547 491.229 cm 0 0 m -2.039 1.754 l 432.025 371.351 l 434.095 369.597 l h f Q q 1 0 0 1 97.1211 499.1602 cm 0 0 m -2.07 1.728 l 432.009 371.337 l 434.095 369.583 l h f Q q 1 0 0 1 87.7026 507.1045 cm 0 0 m -2.086 1.728 l 432.01 371.323 l 434.048 369.597 l h f Q q 1 0 0 1 78.2373 515.0352 cm 0 0 m -2.023 1.753 l 432.025 371.337 l 434.095 369.583 l h f Q q 1 0 0 1 68.8032 522.9531 cm 0 0 m -2.054 1.754 l 432.025 371.336 l 434.111 369.583 l h f Q q 1 0 0 1 59.3535 530.9102 cm 0 0 m -2.023 1.767 l 432.071 371.351 l 434.094 369.583 l h f Q q 1 0 0 1 49.9194 538.8271 cm 0 0 m -2.086 1.755 l 432.025 371.337 l 434.095 369.583 l h f Q q 1 0 0 1 40.5014 546.7456 cm 0 0 m -2.086 1.753 l 432.025 371.349 l 434.079 369.596 l h f Q q 1 0 0 1 31.0356 554.7021 cm 0 0 m -2.039 1.767 l 432.072 371.351 l 434.111 369.583 l h f Q q 1 0 0 1 21.6176 562.6206 cm 0 0 m -2.086 1.753 l 432.025 371.349 l 434.079 369.596 l h f Q q 1 0 0 1 12.1992 570.5513 cm 0 0 m -2.086 1.753 l 432.01 371.337 l 434.08 369.582 l h f Q q 1 0 0 1 2.7338 578.4956 cm 0 0 m -2.039 1.766 l 432.025 371.349 l 434.095 369.609 l h f Q q 1 0 0 1 -6.6846 586.4263 cm 0 0 m -2.086 1.753 l 432.01 371.335 l 434.08 369.596 l h f Q q 1 0 0 1 -16.1026 594.3706 cm 0 0 m -2.102 1.726 l 432.008 371.323 l 434.047 369.596 l h f Q q 1 0 0 1 -25.5684 602.3013 cm 0 0 m -2.085 1.753 l 432.01 371.335 l 434.079 369.596 l h f Q q 1 0 0 1 -35.002 610.2183 cm 0 0 m -2.07 1.753 l 432.024 371.337 l 434.095 369.609 l h f Q q 1 0 0 1 -44.4204 618.1763 cm 0 0 m -2.102 1.726 l 432.009 371.324 l 434.063 369.596 l h f Q q 1 0 0 1 -53.8858 626.0933 cm 0 0 m -2.07 1.767 l 432.025 371.337 l 434.111 369.61 l h f Q q 1 0 0 1 -63.3042 634.0376 cm 0 0 m -2.086 1.754 l 432.024 371.336 l 434.096 369.583 l h f Q q 1 0 0 1 -72.7232 641.9824 cm 0 0 m -2.101 1.753 l 432.01 371.31 l 434.065 369.596 l h f Q q 1 0 0 1 -82.1875 649.9126 cm 0 0 m -2.102 1.74 l 432.024 371.336 l 434.079 369.583 l h f Q q 1 0 0 1 -91.6216 657.8301 cm 0 0 m -2.085 1.753 l 432.024 371.323 l 434.096 369.583 l h f Q q 1 0 0 1 -101.0713 665.7607 cm 0 0 m -2.039 1.781 l 432.057 371.323 l 434.095 369.596 l h f Q q 1 0 0 1 -110.4893 673.7051 cm 0 0 m -2.086 1.753 l 432.008 371.323 l 434.08 369.583 l h f Q q 1 0 0 1 -119.9087 681.6616 cm 0 0 m -2.116 1.714 l 432.01 371.297 l 434.096 369.583 l h f Q q 1 0 0 1 -129.3892 689.5801 cm 0 0 m -2.086 1.753 l 432.073 371.337 l 434.096 369.582 l h f Q endstream endobj 50 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 290.544 336.62 m 288.442 338.348 l 722.553 707.944 l 724.64 706.19 l h W n q 0 g /GS0 gs -51.105423 284.5582581 284.5582581 51.105423 532.0919189 380.0013123 cm BX /Sh0 sh EX Q Q q 281.11 344.578 m 279.025 346.278 l 713.119 715.862 l 715.19 714.121 l h W n q 0 g /GS1 gs -51.0985336 284.5198975 284.5198975 51.0985336 522.6533203 387.9584961 cm BX /Sh0 sh EX Q Q q 271.645 352.483 m 269.605 354.236 l 703.701 723.779 l 705.787 722.065 l h W n q 0 g /GS2 gs -51.0991821 284.5234985 284.5234985 51.0991821 513.2484131 395.8741455 cm BX /Sh0 sh EX Q Q q 262.194 360.414 m 260.141 362.153 l 694.235 731.737 l 696.322 729.984 l h W n q 0 g /GS3 gs -51.1044312 284.5527344 284.5527344 51.1044312 503.782135 403.8019104 cm BX /Sh0 sh EX Q Q q 252.792 368.37 m 250.707 370.07 l 684.817 739.682 l 686.887 737.927 l h W n q 0 g /GS4 gs -51.1027794 284.5435486 284.5435486 51.1027794 494.3436279 411.7520752 cm BX /Sh0 sh EX Q Q q 243.311 376.289 m 241.257 378.028 l 675.383 747.625 l 677.438 745.871 l h W n q 0 g /GS5 gs -51.1055946 284.5592041 284.5592041 51.1055946 484.8991699 419.6769714 cm BX /Sh0 sh EX Q Q q 233.893 384.206 m 231.823 385.945 l 665.933 755.543 l 668.004 753.79 l h W n q 0 g /GS6 gs -51.1068077 284.565979 284.565979 51.1068077 475.4659729 427.5913696 cm BX /Sh0 sh EX Q Q q 224.443 392.15 m 222.389 393.877 l 656.483 763.474 l 658.569 761.732 l h W n q 0 g /GS7 gs -51.1044426 284.5527954 284.5527954 51.1044426 466.0294495 435.5380859 cm BX /Sh0 sh EX Q Q q 215.009 400.081 m 212.939 401.821 l 647.049 771.418 l 649.121 769.665 l h W n q 0 g /GS8 gs -51.1068077 284.565979 284.565979 51.1068077 456.5821228 443.4664001 cm BX /Sh0 sh EX Q Q q 205.591 408.012 m 203.521 409.738 l 637.6 779.335 l 639.687 777.582 l h W n q 0 g /GS9 gs -51.1054115 284.558197 284.558197 51.1054115 447.1540222 451.3953552 cm BX /Sh0 sh EX Q Q q 196.142 415.942 m 194.087 417.67 l 628.182 787.266 l 630.251 785.538 l h W n q 0 g /GS10 gs -51.1044312 284.5527344 284.5527344 51.1044312 437.7212219 459.329071 cm BX /Sh0 sh EX Q Q q 186.707 423.887 m 184.637 425.613 l 618.732 795.21 l 620.803 793.457 l h W n q 0 g /GS11 gs -51.1049194 284.5554504 284.5554504 51.1049194 428.2702332 467.2703857 cm BX /Sh0 sh EX Q Q q 177.305 431.843 m 175.219 433.557 l 609.298 803.141 l 611.384 801.387 l h W n q 0 g /GS12 gs -51.1013756 284.5357361 284.5357361 51.1013756 418.8486023 475.2236633 cm BX /Sh0 sh EX Q Q q 167.839 439.748 m 165.801 441.502 l 599.88 811.058 l 601.934 809.332 l h W n q 0 g /GS13 gs -51.102047 284.5394592 284.5394592 51.102047 409.4204102 483.1350403 cm BX /Sh0 sh EX Q Q q 158.39 447.679 m 156.335 449.419 l 590.414 819.002 l 592.5 817.249 l h W n q 0 g /GS14 gs -51.1049194 284.5554504 284.5554504 51.1049194 399.9684143 491.0653076 cm BX /Sh0 sh EX Q Q q 148.987 455.637 m 146.901 457.35 l 580.997 826.933 l 583.066 825.193 l h W n q 0 g /GS15 gs -51.1006432 284.5316467 284.5316467 51.1006432 390.5318604 499.0172729 cm BX /Sh0 sh EX Q Q q 139.522 463.554 m 137.483 465.308 l 571.546 834.891 l 573.632 833.138 l h W n q 0 g /GS16 gs -51.107296 284.5686646 284.5686646 51.107296 381.1105042 506.9421692 cm BX /Sh0 sh EX Q Q q 130.088 471.471 m 128.018 473.212 l 562.112 842.822 l 564.182 841.068 l h W n q 0 g /GS17 gs -51.1096611 284.5818787 284.5818787 51.1096611 371.6536865 514.8551025 cm BX /Sh0 sh EX Q Q q 120.685 479.429 m 118.6 481.143 l 552.695 850.752 l 554.78 849.025 l h W n q 0 g /GS18 gs -51.105381 284.5580139 284.5580139 51.105381 362.2414551 522.8115234 cm BX /Sh0 sh EX Q Q q 111.22 487.346 m 109.181 489.1 l 543.245 858.697 l 545.314 856.943 l h W n q 0 g /GS19 gs -51.1096535 284.5818176 284.5818176 51.1096535 352.8020935 530.7331543 cm BX /Sh0 sh EX Q Q q 101.786 495.277 m 99.716 497.004 l 533.795 866.614 l 535.881 864.86 l h W n q 0 g /GS20 gs -51.107769 284.5713196 284.5713196 51.107769 343.3495483 538.6605225 cm BX /Sh0 sh EX Q Q q 92.368 503.221 m 90.282 504.949 l 524.377 874.544 l 526.416 872.818 l h W n q 0 g /GS21 gs -51.105381 284.5580139 284.5580139 51.105381 333.9023743 546.5997314 cm BX /Sh0 sh EX Q Q q 82.902 511.152 m 80.879 512.905 l 514.927 882.489 l 516.997 880.735 l h W n q 0 g /GS22 gs -51.1072769 284.568573 284.568573 51.1072769 324.4908447 554.5400391 cm BX /Sh0 sh EX Q Q q 73.468 519.07 m 71.414 520.824 l 505.493 890.406 l 507.579 888.652 l h W n q 0 g /GS23 gs -51.1070366 284.5672302 284.5672302 51.1070366 315.049408 562.4571533 cm BX /Sh0 sh EX Q Q q 64.019 527.027 m 61.996 528.794 l 496.09 898.377 l 498.113 896.61 l h W n q 0 g /GS24 gs -51.1082153 284.573822 284.573822 51.1082153 305.6082153 570.4152832 cm BX /Sh0 sh EX Q Q q 54.584 534.944 m 52.499 536.699 l 486.609 906.281 l 488.679 904.527 l h W n q 0 g /GS25 gs -51.1072769 284.568573 284.568573 51.1072769 296.1427917 578.3266602 cm BX /Sh0 sh EX Q Q q 45.166 542.862 m 43.08 544.616 l 477.192 914.211 l 479.245 912.458 l h W n q 0 g /GS26 gs -51.1093979 284.5803833 284.5803833 51.1093979 286.717926 586.2439575 cm BX /Sh0 sh EX Q Q q 35.701 550.819 m 33.662 552.586 l 467.772 922.169 l 469.811 920.402 l h W n q 0 g /GS27 gs -51.1082153 284.573822 284.573822 51.1082153 277.2907104 594.2073975 cm BX /Sh0 sh EX Q Q q 26.283 558.737 m 24.197 560.491 l 458.308 930.086 l 460.361 928.333 l h W n q 0 g /GS28 gs -51.1094055 284.5804138 284.5804138 51.1094055 267.834137 602.1189575 cm BX /Sh0 sh EX Q Q q 16.864 566.668 m 14.778 568.421 l 448.874 938.005 l 450.944 936.25 l h W n q 0 g /GS29 gs -51.1077461 284.5711975 284.5711975 51.1077461 258.4150085 610.0495605 cm BX /Sh0 sh EX Q Q q 7.399 574.612 m 5.36 576.378 l 439.424 945.962 l 441.494 944.222 l h W n q 0 g /GS30 gs -51.1094093 284.5804443 284.5804443 51.1094093 248.9832764 617.9998779 cm BX /Sh0 sh EX Q Q q -2.02 582.543 m -4.106 584.296 l 429.99 953.879 l 432.06 952.139 l h W n q 0 g /GS31 gs -51.1075096 284.5698853 284.5698853 51.1075096 239.5323792 625.9248047 cm BX /Sh0 sh EX Q Q q -11.438 590.487 m -13.539 592.214 l 420.571 961.811 l 422.61 960.083 l h W n q 0 g /GS32 gs -51.1054077 284.5581665 284.5581665 51.1054077 230.0887451 633.864624 cm BX /Sh0 sh EX Q Q q -20.903 598.418 m -22.989 600.171 l 411.106 969.754 l 413.176 968.014 l h W n q 0 g /GS33 gs -51.1075172 284.5699158 284.5699158 51.1075172 220.6485901 641.7998047 cm BX /Sh0 sh EX Q Q q -30.337 606.335 m -32.407 608.089 l 401.687 977.672 l 403.758 975.945 l h W n q 0 g /GS34 gs -51.1072998 284.5686951 284.5686951 51.1072998 211.2312775 649.7198486 cm BX /Sh0 sh EX Q Q q -39.755 614.293 m -41.857 616.02 l 392.253 985.617 l 394.308 983.889 l h W n q 0 g /GS35 gs -51.1054077 284.5581665 284.5581665 51.1054077 201.7788391 657.6717529 cm BX /Sh0 sh EX Q Q q -49.221 622.21 m -51.291 623.978 l 382.805 993.547 l 384.891 991.82 l h W n q 0 g /GS36 gs -51.1072578 284.5684814 284.5684814 51.1072578 192.3564606 665.5964966 cm BX /Sh0 sh EX Q Q q -58.639 630.155 m -60.725 631.908 l 373.385 1001.49 l 375.457 999.737 l h W n q 0 g /GS37 gs -51.1070557 284.5673523 284.5673523 51.1070557 182.9194946 673.5374756 cm BX /Sh0 sh EX Q Q q -68.058 638.099 m -70.159 639.853 l 363.952 1009.409 l 366.007 1007.695 l h W n q 0 g /GS38 gs -51.1029968 284.5447388 284.5447388 51.1029968 173.4796295 681.4781494 cm BX /Sh0 sh EX Q Q q -77.523 646.03 m -79.625 647.77 l 354.501 1017.365 l 356.557 1015.612 l h W n q 0 g /GS39 gs -51.1070633 284.5673828 284.5673828 51.1070633 164.0190582 689.4094849 cm BX /Sh0 sh EX Q Q q -86.957 653.947 m -89.043 655.7 l 345.068 1025.27 l 347.139 1023.53 l h W n q 0 g /GS40 gs -51.1049271 284.555481 284.555481 51.1049271 154.6021881 697.3295898 cm BX /Sh0 sh EX Q Q q -96.406 661.877 m -98.446 663.658 l 335.65 1033.201 l 337.689 1031.473 l h W n q 0 g /GS41 gs -51.1039352 284.5499573 284.5499573 51.1039352 145.1782532 705.2649536 cm BX /Sh0 sh EX Q Q q -105.824 669.822 m -107.91 671.575 l 326.184 1041.145 l 328.255 1039.405 l h W n q 0 g /GS42 gs -51.105423 284.5582581 284.5582581 51.105423 135.7266235 713.2032471 cm BX /Sh0 sh EX Q Q q -115.244 677.778 m -117.36 679.492 l 316.766 1049.076 l 318.852 1047.362 l h W n q 0 g /GS43 gs -51.1008606 284.5328369 284.5328369 51.1008606 126.2967911 721.1580811 cm BX /Sh0 sh EX Q Q q -124.724 685.697 m -126.81 687.45 l 307.348 1057.034 l 309.371 1055.279 l h W n q 0 g /GS44 gs -51.1058121 284.5604248 284.5604248 51.1058121 116.8343277 729.0796509 cm BX /Sh0 sh EX Q Q endstream endobj 54 0 obj <> endobj 101 0 obj <> endobj 55 0 obj [/DeviceN[/Black]/DeviceCMYK 103 0 R 104 0 R] endobj 102 0 obj <> endobj 105 0 obj <> endobj 106 0 obj <> endobj 103 0 obj <>stream {1.000000 2 1 roll 1.000000 2 1 roll 1.000000 2 1 roll 0 index 1.000000 cvr exch sub 2 1 roll 5 -1 roll 1.000000 cvr exch sub 5 1 roll 4 -1 roll 1.000000 cvr exch sub 4 1 roll 3 -1 roll 1.000000 cvr exch sub 3 1 roll 2 -1 roll 1.000000 cvr exch sub 2 1 roll pop } endstream endobj 104 0 obj <> endobj 107 0 obj <> endobj 56 0 obj <> endobj 57 0 obj <> endobj 58 0 obj <> endobj 59 0 obj <> endobj 60 0 obj <> endobj 61 0 obj <> endobj 62 0 obj <> endobj 63 0 obj <> endobj 64 0 obj <> endobj 65 0 obj <> endobj 66 0 obj <> endobj 67 0 obj <> endobj 68 0 obj <> endobj 69 0 obj <> endobj 70 0 obj <> endobj 71 0 obj <> endobj 72 0 obj <> endobj 73 0 obj <> endobj 74 0 obj <> endobj 75 0 obj <> endobj 76 0 obj <> endobj 77 0 obj <> endobj 78 0 obj <> endobj 79 0 obj <> endobj 80 0 obj <> endobj 81 0 obj <> endobj 82 0 obj <> endobj 83 0 obj <> endobj 84 0 obj <> endobj 85 0 obj <> endobj 86 0 obj <> endobj 87 0 obj <> endobj 88 0 obj <> endobj 89 0 obj <> endobj 90 0 obj <> endobj 91 0 obj <> endobj 92 0 obj <> endobj 93 0 obj <> endobj 94 0 obj <> endobj 95 0 obj <> endobj 96 0 obj <> endobj 97 0 obj <> endobj 98 0 obj <> endobj 99 0 obj <> endobj 100 0 obj <> endobj 152 0 obj <> endobj 153 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1054115 284.558197 284.558197 51.1054115 447.1540222 451.3953552 cm BX /Sh0 sh EX Q endstream endobj 154 0 obj <> endobj 155 0 obj <> endobj 156 0 obj <> endobj 157 0 obj <> endobj 158 0 obj <> endobj 151 0 obj <> endobj 159 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1068077 284.565979 284.565979 51.1068077 456.5821228 443.4664001 cm BX /Sh0 sh EX Q endstream endobj 160 0 obj <> endobj 150 0 obj <> endobj 161 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1044426 284.5527954 284.5527954 51.1044426 466.0294495 435.5380859 cm BX /Sh0 sh EX Q endstream endobj 162 0 obj <> endobj 149 0 obj <> endobj 163 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1068077 284.565979 284.565979 51.1068077 475.4659729 427.5913696 cm BX /Sh0 sh EX Q endstream endobj 164 0 obj <> endobj 148 0 obj <> endobj 165 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1055946 284.5592041 284.5592041 51.1055946 484.8991699 419.6769714 cm BX /Sh0 sh EX Q endstream endobj 166 0 obj <> endobj 147 0 obj <> endobj 167 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1058121 284.5604248 284.5604248 51.1058121 116.8343277 729.0796509 cm BX /Sh0 sh EX Q endstream endobj 168 0 obj <> endobj 146 0 obj <> endobj 169 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1008606 284.5328369 284.5328369 51.1008606 126.2967911 721.1580811 cm BX /Sh0 sh EX Q endstream endobj 170 0 obj <> endobj 145 0 obj <> endobj 171 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.105423 284.5582581 284.5582581 51.105423 135.7266235 713.2032471 cm BX /Sh0 sh EX Q endstream endobj 172 0 obj <> endobj 144 0 obj <> endobj 173 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1039352 284.5499573 284.5499573 51.1039352 145.1782532 705.2649536 cm BX /Sh0 sh EX Q endstream endobj 174 0 obj <> endobj 143 0 obj <> endobj 175 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1049271 284.555481 284.555481 51.1049271 154.6021881 697.3295898 cm BX /Sh0 sh EX Q endstream endobj 176 0 obj <> endobj 142 0 obj <> endobj 177 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1027794 284.5435486 284.5435486 51.1027794 494.3436279 411.7520752 cm BX /Sh0 sh EX Q endstream endobj 178 0 obj <> endobj 141 0 obj <> endobj 179 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1070633 284.5673828 284.5673828 51.1070633 164.0190582 689.4094849 cm BX /Sh0 sh EX Q endstream endobj 180 0 obj <> endobj 140 0 obj <> endobj 181 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1029968 284.5447388 284.5447388 51.1029968 173.4796295 681.4781494 cm BX /Sh0 sh EX Q endstream endobj 182 0 obj <> endobj 139 0 obj <> endobj 183 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1070557 284.5673523 284.5673523 51.1070557 182.9194946 673.5374756 cm BX /Sh0 sh EX Q endstream endobj 184 0 obj <> endobj 138 0 obj <> endobj 185 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1072578 284.5684814 284.5684814 51.1072578 192.3564606 665.5964966 cm BX /Sh0 sh EX Q endstream endobj 186 0 obj <> endobj 137 0 obj <> endobj 187 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1054077 284.5581665 284.5581665 51.1054077 201.7788391 657.6717529 cm BX /Sh0 sh EX Q endstream endobj 188 0 obj <> endobj 136 0 obj <> endobj 189 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1072998 284.5686951 284.5686951 51.1072998 211.2312775 649.7198486 cm BX /Sh0 sh EX Q endstream endobj 190 0 obj <> endobj 135 0 obj <> endobj 191 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1075172 284.5699158 284.5699158 51.1075172 220.6485901 641.7998047 cm BX /Sh0 sh EX Q endstream endobj 192 0 obj <> endobj 134 0 obj <> endobj 193 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1054077 284.5581665 284.5581665 51.1054077 230.0887451 633.864624 cm BX /Sh0 sh EX Q endstream endobj 194 0 obj <> endobj 133 0 obj <> endobj 195 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1075096 284.5698853 284.5698853 51.1075096 239.5323792 625.9248047 cm BX /Sh0 sh EX Q endstream endobj 196 0 obj <> endobj 132 0 obj <> endobj 197 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1094093 284.5804443 284.5804443 51.1094093 248.9832764 617.9998779 cm BX /Sh0 sh EX Q endstream endobj 198 0 obj <> endobj 131 0 obj <> endobj 199 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1044312 284.5527344 284.5527344 51.1044312 503.782135 403.8019104 cm BX /Sh0 sh EX Q endstream endobj 200 0 obj <> endobj 130 0 obj <> endobj 201 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1077461 284.5711975 284.5711975 51.1077461 258.4150085 610.0495605 cm BX /Sh0 sh EX Q endstream endobj 202 0 obj <> endobj 129 0 obj <> endobj 203 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1094055 284.5804138 284.5804138 51.1094055 267.834137 602.1189575 cm BX /Sh0 sh EX Q endstream endobj 204 0 obj <> endobj 128 0 obj <> endobj 205 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1082153 284.573822 284.573822 51.1082153 277.2907104 594.2073975 cm BX /Sh0 sh EX Q endstream endobj 206 0 obj <> endobj 127 0 obj <> endobj 207 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1093979 284.5803833 284.5803833 51.1093979 286.717926 586.2439575 cm BX /Sh0 sh EX Q endstream endobj 208 0 obj <> endobj 126 0 obj <> endobj 209 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1072769 284.568573 284.568573 51.1072769 296.1427917 578.3266602 cm BX /Sh0 sh EX Q endstream endobj 210 0 obj <> endobj 125 0 obj <> endobj 211 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1082153 284.573822 284.573822 51.1082153 305.6082153 570.4152832 cm BX /Sh0 sh EX Q endstream endobj 212 0 obj <> endobj 124 0 obj <> endobj 213 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1070366 284.5672302 284.5672302 51.1070366 315.049408 562.4571533 cm BX /Sh0 sh EX Q endstream endobj 214 0 obj <> endobj 123 0 obj <> endobj 215 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1072769 284.568573 284.568573 51.1072769 324.4908447 554.5400391 cm BX /Sh0 sh EX Q endstream endobj 216 0 obj <> endobj 122 0 obj <> endobj 217 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.105381 284.5580139 284.5580139 51.105381 333.9023743 546.5997314 cm BX /Sh0 sh EX Q endstream endobj 218 0 obj <> endobj 121 0 obj <> endobj 219 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.107769 284.5713196 284.5713196 51.107769 343.3495483 538.6605225 cm BX /Sh0 sh EX Q endstream endobj 220 0 obj <> endobj 120 0 obj <> endobj 221 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.0991821 284.5234985 284.5234985 51.0991821 513.2484131 395.8741455 cm BX /Sh0 sh EX Q endstream endobj 222 0 obj <> endobj 119 0 obj <> endobj 223 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1096535 284.5818176 284.5818176 51.1096535 352.8020935 530.7331543 cm BX /Sh0 sh EX Q endstream endobj 224 0 obj <> endobj 118 0 obj <> endobj 225 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.105381 284.5580139 284.5580139 51.105381 362.2414551 522.8115234 cm BX /Sh0 sh EX Q endstream endobj 226 0 obj <> endobj 117 0 obj <> endobj 227 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1096611 284.5818787 284.5818787 51.1096611 371.6536865 514.8551025 cm BX /Sh0 sh EX Q endstream endobj 228 0 obj <> endobj 116 0 obj <> endobj 229 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.107296 284.5686646 284.5686646 51.107296 381.1105042 506.9421692 cm BX /Sh0 sh EX Q endstream endobj 230 0 obj <> endobj 115 0 obj <> endobj 231 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1006432 284.5316467 284.5316467 51.1006432 390.5318604 499.0172729 cm BX /Sh0 sh EX Q endstream endobj 232 0 obj <> endobj 114 0 obj <> endobj 233 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1049194 284.5554504 284.5554504 51.1049194 399.9684143 491.0653076 cm BX /Sh0 sh EX Q endstream endobj 234 0 obj <> endobj 113 0 obj <> endobj 235 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.102047 284.5394592 284.5394592 51.102047 409.4204102 483.1350403 cm BX /Sh0 sh EX Q endstream endobj 236 0 obj <> endobj 112 0 obj <> endobj 237 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1013756 284.5357361 284.5357361 51.1013756 418.8486023 475.2236633 cm BX /Sh0 sh EX Q endstream endobj 238 0 obj <> endobj 111 0 obj <> endobj 239 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1049194 284.5554504 284.5554504 51.1049194 428.2702332 467.2703857 cm BX /Sh0 sh EX Q endstream endobj 240 0 obj <> endobj 110 0 obj <> endobj 241 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.1044312 284.5527344 284.5527344 51.1044312 437.7212219 459.329071 cm BX /Sh0 sh EX Q endstream endobj 242 0 obj <> endobj 109 0 obj <> endobj 243 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.0985336 284.5198975 284.5198975 51.0985336 522.6533203 387.9584961 cm BX /Sh0 sh EX Q endstream endobj 244 0 obj <> endobj 108 0 obj <> endobj 245 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -51.105423 284.5582581 284.5582581 51.105423 532.0919189 380.0013123 cm BX /Sh0 sh EX Q endstream endobj 246 0 obj <> endobj 53 0 obj <> endobj 47 0 obj <> endobj 48 0 obj <> endobj 21 0 obj <> endobj 22 0 obj <> endobj 248 0 obj <> endobj 249 0 obj <> endobj 10 0 obj [/DeviceN[/Magenta/Yellow/Black]/DeviceCMYK 250 0 R 251 0 R] endobj 247 0 obj <> endobj 252 0 obj <> endobj 250 0 obj <>stream {1.000000 4 1 roll 2 index 1.000000 cvr exch sub 4 1 roll 1 index 1.000000 cvr exch sub 4 1 roll 0 index 1.000000 cvr exch sub 4 1 roll 7 -1 roll 1.000000 cvr exch sub 7 1 roll 6 -1 roll 1.000000 cvr exch sub 6 1 roll 5 -1 roll 1.000000 cvr exch sub 5 1 roll 4 -1 roll 1.000000 cvr exch sub 4 1 roll pop pop pop } endstream endobj 251 0 obj <> endobj 253 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <> endobj 18 0 obj <> endobj 256 0 obj <> endobj 257 0 obj <>stream HTTiTW "tDEY]pk"r4Q\2 `#MCC趛fOf MXQF0BԸ!F#4g^cNNԿz޽)EӴlr˧FocĠ-G bi,;g9\{0>7ʊ%[*nk",>vsTBbmr\?vW̖`_wŲhE|TBT*jي-Q[)&%(gLQY4SVJ >)NAQ(_ʟZMGYES1IVDŽ>", G[hZ*nDrCK=c2w'Xo8l9fb38ɦaL#1q$쭑yώI|!M1Ns}r>ݤz:j2![$J0.8%3 e3¥R «YuA蠸y zJ4>c7=og!H^GdfFT\_I>d"r{rce| !pJl3ঝr;sx ^7^ЁD. O}0K.`}f5-Bű9}^4C-f֏jxYM M"kf3p `#{!'d04B9U>$^ҔzzD~RSq#T#p*vVaοv]o"O,u&Ôgƶ`["7栍.ax 96mE NT:QZ$/դ@y G Gd_>gp_׸/ܣK0Bu159l7gxir̃'SW@PrZ[r>m~rTJN¸0/| |"a;?@'H0.1Dmi劂/*=\cwׯ<ttMӧdhrr$V[%W- kDp9֋2~()tL%s Xh ~F .n }an1aGR<15SOȰuBBh6 ^Hק2e9[I[uNTw罓SP/pB; y/>FS h~lerғQ:/p㏡07ktZ@"R>JmùFc!,X].⥽B!3fq:c |JKץeX;l E5k8_婖X>YT1y+՗ }v>ХVsJTBE5Ĵ5{3RuM,t#c1PyA;mC`u56CLe 4ҒUFKNtwiA&B`H/ö8ÑUh].,&ļ_z^6SOMao.L;P*ؤ؄YpcvInFy<2[Mѹo 7"dvS\;*u[j."9`w G~`,Kux$#b{yF}psB9נr 9l/u?${pkPGKqQ75dAz|y.$00vd1¶d:](q}aۤ~Wp32½BND$^: |s.9VkІyѼXJacC]Mn=YC@|E,6-_^Y("/F}M\z< K@>>ٝc]Ŧݖlh :1&[coCwF2H0]O UF;9MWǙk&1V0߀ Yy0{b2}Flw{4yeH ih4[ͬmcޚ3o&>* jj=}vqٕrJRV˅r2RѧD{%8#5wΟ +O~437b;"P/}XC~=5nV>5`jiWx N{^~wGk8?Qf?jlyx|{「v?q,zkkB#|3Lc&o웸vsoFCQm endstream endobj 255 0 obj <> endobj 258 0 obj <>stream HTS PTU~o߾p ַ P1u"]d!\@A(Mqpjr&IdX&'IPSj' *N;w{}~^R(\KfnV3厒Wkۋv1=U+! ?X =LhښX^QWYVyqQl20[d[eyJ^_Wa;W-e!J{^ܚ=S+K(& ghJJ )HߔPm4CDOU.3 sR M^cchf#GFc3ؑ‘ؕlFw Jk4PA6А`M@>6]EI\n(߈@QWI$E5#@ U`!eGYΆ׋mfx+ 1^$H̳?.%xP_$q m$ŘҥdiPp$8K=^'y~#bDX"mȊ8fs^͌4 4!xt@&;$1~ݜU{m5*TA(-'(p|%iP\sݚU'<.xh{`.9/_wu{|AlY+jj`ED[:0(h{ lj/;{{kGAֲM.0<@{1h/ (q\Dj:ot?tBfe]<=7mywRfCEOh ps h7̃jNBqBLшFS$fCGQҍn?7\<do*z3O swH0B|\`F ᗟ]lwPy&i2{}EiRK2E 0?mOřwkd\VM( Eo*z.jş%W)#<m5Fww{.44AƯG U Gv($MM<UJƄK}m9p5&1׻{;N䀳vs?4ffᩩƀ00*(OZ endstream endobj 254 0 obj <> endobj 259 0 obj <>stream HmLSg>x^.b{ma B/CZ[\)oV/Uaa œnlؔH:ll";O} a(egnp:seBבe&,y%qUt  uLZ̕;GL0V*³¢'y׶I=+g4ӟyAsPgޒ-JpK&(EgJ~gG88y"N2$B ZjljL`Vo(/,Dyb̃|UQ͎!M$_ݓSs);Bڐr\g?ɬ_`jEH?޻ IV:/4m$5tMm}=Nɋ WRDc,7m5C&Hżl}F! \;0&ٸ{˷&n>>#tt*ፈ,Xũ+AŖ | ?  ,JP..~ލfnk%[ΛÈ'uպaaB"$<\FIs.YDc1nNY+[g+1hԸ}υJe3IGpALX <dQL̻U*hLt@eSd,(/b|c{BgPDHtGi&ѤوR C:ō(Ě\(aUC/0&D eOH%XlA\WjWd&j)p%ˣz1׬gHs Xpނ|%Occإ'T_Z3# endstream endobj 12 0 obj <> endobj 13 0 obj <> endobj 6 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 261 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000074108 00000 n 0000000000 00000 f 0000074165 00000 n 0000190465 00000 n 0000074629 00000 n 0000119744 00000 n 0000139067 00000 n 0000182037 00000 n 0000119631 00000 n 0000190219 00000 n 0000190342 00000 n 0000084301 00000 n 0000084436 00000 n 0000182897 00000 n 0000183253 00000 n 0000183728 00000 n 0000084568 00000 n 0000085020 00000 n 0000181516 00000 n 0000181660 00000 n 0000139132 00000 n 0000139616 00000 n 0000140121 00000 n 0000074932 00000 n 0000084235 00000 n 0000109051 00000 n 0000109076 00000 n 0000103496 00000 n 0000103521 00000 n 0000093666 00000 n 0000085491 00000 n 0000085742 00000 n 0000093920 00000 n 0000103883 00000 n 0000104130 00000 n 0000104199 00000 n 0000104466 00000 n 0000104563 00000 n 0000109694 00000 n 0000110277 00000 n 0000110346 00000 n 0000110610 00000 n 0000110723 00000 n 0000140749 00000 n 0000181269 00000 n 0000181393 00000 n 0000140812 00000 n 0000145184 00000 n 0000140686 00000 n 0000140623 00000 n 0000181206 00000 n 0000154253 00000 n 0000154461 00000 n 0000155342 00000 n 0000155458 00000 n 0000155574 00000 n 0000155690 00000 n 0000155806 00000 n 0000155922 00000 n 0000156038 00000 n 0000156154 00000 n 0000156270 00000 n 0000156386 00000 n 0000156502 00000 n 0000156618 00000 n 0000156734 00000 n 0000156850 00000 n 0000156966 00000 n 0000157082 00000 n 0000157198 00000 n 0000157314 00000 n 0000157430 00000 n 0000157546 00000 n 0000157662 00000 n 0000157778 00000 n 0000157894 00000 n 0000158010 00000 n 0000158126 00000 n 0000158242 00000 n 0000158358 00000 n 0000158474 00000 n 0000158590 00000 n 0000158706 00000 n 0000158822 00000 n 0000158938 00000 n 0000159054 00000 n 0000159170 00000 n 0000159286 00000 n 0000159402 00000 n 0000159518 00000 n 0000159634 00000 n 0000159750 00000 n 0000159866 00000 n 0000159982 00000 n 0000160098 00000 n 0000160214 00000 n 0000160330 00000 n 0000160446 00000 n 0000154316 00000 n 0000154523 00000 n 0000154816 00000 n 0000155204 00000 n 0000154644 00000 n 0000154727 00000 n 0000155259 00000 n 0000180758 00000 n 0000180308 00000 n 0000179859 00000 n 0000179409 00000 n 0000178959 00000 n 0000178511 00000 n 0000178061 00000 n 0000177611 00000 n 0000177163 00000 n 0000176713 00000 n 0000176265 00000 n 0000175815 00000 n 0000175365 00000 n 0000174917 00000 n 0000174469 00000 n 0000174021 00000 n 0000173572 00000 n 0000173124 00000 n 0000172676 00000 n 0000172227 00000 n 0000171779 00000 n 0000171330 00000 n 0000170880 00000 n 0000170431 00000 n 0000169981 00000 n 0000169531 00000 n 0000169082 00000 n 0000168632 00000 n 0000168182 00000 n 0000167732 00000 n 0000167282 00000 n 0000166832 00000 n 0000166382 00000 n 0000165932 00000 n 0000165482 00000 n 0000165034 00000 n 0000164584 00000 n 0000164136 00000 n 0000163686 00000 n 0000163236 00000 n 0000162786 00000 n 0000162338 00000 n 0000161888 00000 n 0000161440 00000 n 0000160563 00000 n 0000160618 00000 n 0000160933 00000 n 0000161011 00000 n 0000161160 00000 n 0000161281 00000 n 0000161360 00000 n 0000161495 00000 n 0000161810 00000 n 0000161943 00000 n 0000162260 00000 n 0000162393 00000 n 0000162708 00000 n 0000162841 00000 n 0000163158 00000 n 0000163291 00000 n 0000163608 00000 n 0000163741 00000 n 0000164058 00000 n 0000164191 00000 n 0000164506 00000 n 0000164639 00000 n 0000164956 00000 n 0000165089 00000 n 0000165404 00000 n 0000165537 00000 n 0000165854 00000 n 0000165987 00000 n 0000166304 00000 n 0000166437 00000 n 0000166754 00000 n 0000166887 00000 n 0000167204 00000 n 0000167337 00000 n 0000167654 00000 n 0000167787 00000 n 0000168104 00000 n 0000168237 00000 n 0000168554 00000 n 0000168687 00000 n 0000169004 00000 n 0000169137 00000 n 0000169453 00000 n 0000169586 00000 n 0000169903 00000 n 0000170036 00000 n 0000170353 00000 n 0000170486 00000 n 0000170802 00000 n 0000170935 00000 n 0000171252 00000 n 0000171385 00000 n 0000171701 00000 n 0000171834 00000 n 0000172149 00000 n 0000172282 00000 n 0000172598 00000 n 0000172731 00000 n 0000173046 00000 n 0000173179 00000 n 0000173494 00000 n 0000173627 00000 n 0000173943 00000 n 0000174076 00000 n 0000174391 00000 n 0000174524 00000 n 0000174839 00000 n 0000174972 00000 n 0000175287 00000 n 0000175420 00000 n 0000175737 00000 n 0000175870 00000 n 0000176187 00000 n 0000176320 00000 n 0000176635 00000 n 0000176768 00000 n 0000177085 00000 n 0000177218 00000 n 0000177533 00000 n 0000177666 00000 n 0000177983 00000 n 0000178116 00000 n 0000178433 00000 n 0000178566 00000 n 0000178881 00000 n 0000179014 00000 n 0000179331 00000 n 0000179464 00000 n 0000179781 00000 n 0000179914 00000 n 0000180230 00000 n 0000180363 00000 n 0000180680 00000 n 0000180813 00000 n 0000181128 00000 n 0000182114 00000 n 0000181808 00000 n 0000181905 00000 n 0000182305 00000 n 0000182759 00000 n 0000182211 00000 n 0000182814 00000 n 0000188752 00000 n 0000187014 00000 n 0000184182 00000 n 0000184533 00000 n 0000187330 00000 n 0000189052 00000 n 0000844873 00000 n trailer <<80BE7FDD469F4B88B72C433538D41B24>]>> startxref 845132 %%EOF 2 0 obj <>stream application/pdf Datasheet_Percona_Server_for_MongoDB 2019-09-23T10:57:35-03:00 2019-09-23T10:57:35-03:00 2019-09-23T10:54:37-03:00 Adobe Illustrator CC 23.0 (Macintosh) 256 140 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAjAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9HQ+VPLRhQnTLYkqCT6a +HyzF/I4f5kfk5P5zN/OPzX/AOE/LX/Vstv+Ra/0x/I4f5kfkv5zN/OPzd/hPy1/1bLb/kWv9Mfy OH+ZH5L+czfzj82v8KeWv+rZbf8AItf6Y/kcP8yPyX85m/nH5selbyq83Cz0i0kjNeEkgVTIFJUt GiqxZaj7RpmsySxXUMcSPPr7nOj41eqcvx3pjpmm+Ub4mIabaLcKodo1VXBUgGqtRaj4hXbuPEZl YMODJtwRtx8uXPDfilS0RflsQCH0ohpzaKfUg3uB1hG/94P5OuZP5HD/ADI/Jp/OZv5x+a6K0/Lu WFZ4hpkkDzi1SVGhZDcHpCGBoZP8nrj+Rw/zI/Jfzmb+cfm6a1/LqCOSSb9FxRxTNbSu7wqqzopd omJOzqilivWm+P5HD/Mj8l/OZv5x+aLh8v8Ak+eWeKGys5JbZglzGixs0blQ4VwPskqwbfscfyOH +ZH5L+czfzj81X/Cnlr/AKtlt/yLX+mP5HD/ADI/Jfzmb+cfm7/Cnlr/AKtlt/yLX+mP5HD/ADI/ Jfzmb+cfm7/Cnlr/AKtlt/yLX+mP5HD/ADI/Jfzmb+cfmi9N03T7B5UsreO3RwjOsahQT8QqaZbj wwx/SAGrJllP6jaOy1rdirsVdiqXa15f0vWoo4tQjMiRMWQBmWhIp+yRmPqNLDMAJjk34NTPESYn mwL8w9K8peT9AXVv0UbzncxW3pPdyW6j1SRzaTjLQLTf4cxf5Jwd32lyf5Uz9/2BiF3r+i20RkOg 6TKo509LzNE1QoZgR+6/b4Hj38QNsf5Jwd32lf5Uz9/2Bif/ACufyj/1Jj/9xST/AKoY/wAk4O77 Sv8AKmfv+wO/5XP5R/6kx/8AuKSf9UMf5Jwd32lf5Uz9/wBgRmj/AJreUdR1O3sf8IPF67cPU/Sc jU2rWnoiv34/yTg7vtK/ypn7/sD0y30ny1OImGm2kaSosgaTVivHmK8WXhzBFaHbrj/JODu+0r/K mfv+wJMdR8o/9WB/+k2T/mjH+ScHd9pX+VM/f9gd+kfKP/Vgf/pNk/5ox/knB3faV/lTP3/YHfpH yj/1YH/6TZP+aMf5Jwd32lf5Uz9/2B36R8o/9WB/+k2T/mjH+ScHd9pX+VM/f9gd+kfKP/Vgf/pN k/5ox/knB3faV/lTP3/YFayufKNzeQW36CdPWkSPn9ckNObAVpwHjj/JODu+0r/Kmfv+wM9/5Vt5 R/5ZX/5Gyf8ANWP8k4O77Sv8qZ+/7AyKD+4j/wBUfqzZOvX4q1iqhfwyzWNxDC3CWSJ0jepFGZSA aj3yMxYIDKBAkCXgejza7NZRJqELtDaSNa31hJVB9ZtwVioBT1GCIqJDvViSftZoI4zVHl3eY/HJ 6rLwA+k7ncHyPP3d99zKfy9s/Mcnno3E0UkOkWlgERpBQszBEPMVI5yOjOSpINNmPXMrR4iMl9AP x+twdfPH4Fc5GX4/Um0/k6WDVjBB5cjm02yum1bTryK5WCVrwjkfV5F2cszsFJACgDNgZTEjtYdd HHhMATMifUVa2y8lpDaSLb+W5bK7jupr+0YagGQzoqxL6siOkgSdEFUAYDvh4p19P2oOLCCPXY2v Y3517ksvPJ/1nSxaX3kist3dNeNDBffALlIrjj8S1EcdX+BSwXlJ2pvDxMnWO/vbvy2nJNZfSP6P u/b8mR+QNE1ux1XW7/U9NSxl1NopnlWUuZpKyMxZPXuVTh6nEcSBSnWmSxGZviFfj3tWrhgiB4Uj I73+joGa5e4TsVdirUf98/8Aqr+tsVVcVdirsVdirsVQOt2en32mTWeoStDaTgLI8cz2zjcEcZY2 jdTUfstirEB+XfkL1zNJqmoSv8QX1Nbvm4h04MFrcV6fTiqIj8k+S45BJHrGoqwf1B/uc1AryrX7 BuSpHsRiqN0Ly/5R0OSGSw1Cf9xG0SRz6nc3EfF2LtWKaZ4yanrxqO2Kp9+ldL/5bIP+Rif1xV4n f2nmltX1d7KO/iaa+klsblLsi39Nrz1d4hr0SsGRSP7uOoNKKNiqgrzS/Pt7dPHPcXPCSGNYr2O4 uI0jYekarEdfYhhxIJ9Pdq9RiqHOjeeYI7cQyX9y7RxhybuaOhl5M3wHzBHGhiQKrL3bo2Kp/B5C 1zVLGzvh5iTSLkxyCayuZ9SEqO8zO+9trUiUdjyFGJAoCewVTIflq00jS3/meGeU0KyRXerQkEk+ oPi1SYhWViOKkDFVbT/y/uLfXLO6n82CTTIwxvbaO91OOSRgX9Li76jKBRSnIsCfhPZtlWXWWg+W LfVl1GHU7uS658lik1W7lgLFWSn1Zp2hIo+w4dd+uKsmxVSg/uI/9UfqxV5nqv5x2Y1Jho2raHPY NGFhW9mubWZZ1Px8z6Ui8aEU2Hz8FUrj/PC7kSzlS70JVkceuk0t/CGQEiTg7244FW4j7Ld8VTbT /wA3ork2sZvtAaZ7hUuFS/nVvRclVMSNbVaQtTb9Q+IKsN1LzbH5mhtDcQeVb+7vZlhaUXl3btyK /uTLCVimK8mCgsTuegoTlM8EJ8w5OHV5cf0ypkGkfmJB5dsLe0e48sW9qkkiyJYXMyx7brxMcdxy crTk2+/bbLIQERQasmSUzcjZRdv+aus3rzw2Vz5be4DyRW6i/uHQuPijBf0I1IMaSHlsGp2yTW0P zW1trx7aOby6/rCWTT2N/OpliQOA1FgkAo0ZBDFTsR4HFUOPzj1I24ka98sikczMV1Cd25KpEX7v 0VIrINxU1HgKEqomP84Z0uJoLufQYmimji9T69c+mSas6s/1UhPgU8S3cdN9lUNZ/nHq95dSQW03 l1/TlVD/AKddCquUVSGNv05vTl+HfFV8f5yXiG8iurjy+s9pJHC6m9vIwJA4Eq0a0PL4a049KftY qz/yt5u0LzNZPdaRdJdJCVS4MYkCrI0aycQ0iRFtnG/H7jtiqcR/3z/6q/rbFVXFXYq7FXYq7FUn 83S6NF5fun1qVoNM+AXM6Tm0ZAZFCn11eFk+OgqHGKvPk1P8ooWuLebXrqQXalWgutflk4qisrMn q3pZKcWPOu3iMVV5YPyvnuzcjVrxZrd29RovMEy0CIJGjJW9qqKtH4igXtSu6qN0Sx8ka+kq6JqO o6nFblTcfVdbkuCpaoQmQXbuleDAcWAO46bYqyHy95etdBaZrODVJmnAD/XL97sChJHFZ7iRVPxb kCp71OKvLtVS01LzXeWtl5ttbadZbz1tO+t3yzQy/WX5qY49ZhRWT1OJ4qtaHiAp+FVBWuo2cV1L Hb+ftLWPk3rxteXfP4vUZ/TpraN/x8N9g7EV6rsqn1lrP5Zw2ywaj5waa6XiySwa+8ScIwoA4NqE yty51qxJbrvxqFUZDqf5S3YheHXbx6O8cLDzBPzdrsejwVje835GA8QD1BPjiqFM/wCTJ+KTzDeI VPBvW8yToSUbmP7y+B+BvDodjviqYfpf8qIw1m+uS1uSyhZtdLSOr1gZI5JLwvxDxH7DfCw2pirM PKTaVDpzJoxur6zedy9zNffX+MlQrr6ktxMyheP2F2HhUnFWRYqhEmlRFTgp4gCvI9v9jiqhPbWk 7xvPYwSvCwkhZwrFHHRlJTYivUYqkeu+Q/LOuXkN5fWTCeCIwRtb3M1uPTNTTjEUH7XXFULD+Wfl aGD0IoblY+aPQ390/wBiSKShDswILQL196Urirdh+VnlS3toLaC3uVgtZVmij/SF5xDrSnwh6dEA 6dBTFVdvyv8ALDPE5guC0JiKk6heMT6HP0waudh6rH371xVTl/Kry3LC8LreGNwi8RqV6u0dSteL jmak7vU+GKqv/Ks/L31mO54XXqxV9M/pG9FKyPL2ff4pD/t4qhf+VQ+VPq7W/p3npMoQr+k76lA3 P7PqcevtiqL1H8svK+pXhu72zkncxmJo3vLoxlSWqCnLj+2fl2xVQH5UeVwsKiK6/cHlGf0je1B4 ha151/Z+jtirJ7jTLa5p9Ys7ebi4kX1FDUdSSrCqHcE7HFVaOBogRHFGgO5Cmm4AHZfAUxVUiSQO zOAKgAAEnpX2HjiqpirsVdirsVdiqE1UlbJ2W2luyrJ+4gcRyEFwCQS0f2QeRFe22+KsNl1nU4JF EXkbWpJHR25R3dmFARiFBY3o+0AGod9+mKtnXdU4sf8AA+uE82SVTd2daKoPL/e6jA8qCh7Yqnvl 6Fbu2mkm0i+0NllZfq9zcIXk/a9QfVLi4ShLHq1a4qmv6Nt/55/+kif/AJrxV4pqHnfzja6rfQxa Rqs0EeoXFrDcDQ7uQFUeQoyuuqIZkX4W58E2B79FUNF5987FWs00jVTLCha4uX0C+SP4pUChY21O NiF5svSu1elTirrj8w/zAfS/UTy1qyXE8zkRLpl45S0Clg2956Zfam5+0PsbqMVWL5x/MsK0dpol 4YEh40/Qt9CA4VQVEZ1J5KKWY09McqUWtRiqw/mH+YKD49G1EQOPThEWiX3MyBdnEc2pxPRWPP7F KbVriqf6fqX5pXnp6hHpd5+jZf3kdtNZLDOwVNh8erhk5kll5oN6g02qqzPyRF5rMl3B5jsnt/Tc SWdzAxhhdWVGdWjF7eNy9RmrXbr12JVZliqEPXFWO+bfM8mjrbwW0PrXl0HZa/YSOOnN3OwAFe5p mDrtTLGAIC5H7HN0elGQkyNRCA0DznLc3jW13JHKwkjhk9FXDRPLUL6nILT4gF6bFgCa7ZjaPV5D KslH3Dk3anRxjG42Pf1Zhm3dYkXnh9FTy3K2s6tcaLYCeAvf2jtHIrCQFF5KrkBm2O2KsBF35Fj+ BvzQ1pfTVTIWu6FmIMwcF4SOJUigXYjbepqqn2g+UtJ8xWw1HTfPGs6hZhvSlezvjCDNHbxw/vCi hgw4+px2qWqajqqmkX5XwJcW1y3mLW3uImH1mVrw850Dc/SZwvNIyRusbKOvffFUE/5T6jHbTR2P nbXreWR/Ujd7hZVUkBSCvFGI4bKOQod+2KpvoHkJ9J1hNTfXtTv3VXVoLqbnE5kjijJdab09Hl8z irK8VdirsVdirsVdirsVdirsVS3zHYtfaRParcfVGk4hboGNWjPIUKmaOeOvb4kPXFWK3/lC/kid I9a+puWBSVWsyy7jmtJLNlPI+K7dsVZE0NrFGhks9OAbZXeRRyopb/fIHQE7YqqrYKw5LpliynoQ 9R/yZxVv9Hf9qux/4L/rzirzbUru2SfVo1vdZtjDJKHWLS2lSIi5Ib6vI2kSCVB6gVaO/wAAqPHF VGykSC3M1zrGrXfIRv6J0ujqZpuaERRaV6x+wVK70BO1KAKpZa69psvBf09r0onJt4x+hgCZCpX4 WTRftLxLeO2/fFUxS9ja9al95gRY5Iz6R0RmR1KqKD/cKz8Cep+47iqqiLyG5nEiar5gVR6oES6K 4QMkJr8X6F+Ij7QUsfi7YqqQ3PMTtFqPmDihilJbRwrFTKY2CCXRqEVcF+K7AbbVGKs68ta7p2uT yCz0Rrb6uEd5Lu0urOnJiB6f1i1h5sOJ+z0xVluKoQ9cVYn+YflTWPMGlpHo+oGwvYyeQLMsc0bA gxyFQT38COoI3zG1OEzGx3c/QaqGKXrHEPuY/wCV/wAs9Vt/MMGpak8UFlYnnFa25Nbida8ZZhUq qx1HBAxpT/WrRh0hErPRy9T2jE4zGNky6noO4fpel5sHSoXWWuk0LUJLUoLiOB5I/UjEqkopanBn jUnbbk1PHFXnB1L82DHDFbaRahkT04SLG0UI0LqVB46nKoVk5KOP0Dviqld+YPzktpDaQWqQxp6n FktLIScVNVYRm/YfFTj07+OKUxg8w/m+slP0c11H6TUZbKzHx/FxY01XfpuPh+jFCo2ufnBAbid9 NaZIZYw0C2dsQ0cdFm9CmoLJ8e7ryB7Ad8VQx1z87ligjGnGSQiISyCytgauKuatqQXklf5QpIxV MbPXvzUX02u9NeQON0SwgRgU9QMpb9KSKC3pihpT4hiqWHXPztEvF9PcwRNHWSKxtA8nUutH1FqD jQcgDv8Aiq9K0a/vL6xFxeafLpkxZ1+qTtG8gVWIDExNInxddmxVHYq7FXYq7FXYq7FUg8+ep/hS +MdimpMPT/0CSNpUlHqrVWRYbpjQfFtE1KdMVeRTtYLc3ItvIVq44/vnl0+6hL/v15AcdGk9RfU4 yA9f2uNPixVXlTTJLNoJvKduI3ESW9odPvYY6RwCdaSNpKDknKbiFSvT9o0xVE6Z571/RdLFlYeX jptrbnlFZw2t/DbqGaSSTi66Rx+JeLcuIoWIZajdVmvkLzRrHmGK5TU47vTb6F+SRfVblIjDRQD6 17YWQMnPl8KjpT3xV5/fXkEGua76XlOxvo/rVxFc3i2N6jXAjkKP6hj0W6jlfkx5cHfap6b4qktx qemtfNLdeRtNMgAR5JLO9INQiAvI2hheCof2q9sVTazvrBtWgvtM8n2H1+3EZW8+r3MMsLQxxhqM dFqPTDUQEqxAFB2xVkeo/mV5ut242+kzzK8YeOT09RO9SrDjHo0n2SNwzK3enTFUUfPvmkuHhs5Z bWMg3TtFfRTJHzIbjB+i3YsE3WpAbsaYqhL78x/O8ckS2Wky3DGBpJYXi1KOTmoY8Vro5XpG1OVC T4d1U/8AJ3nW81ieO01OC/0/UJXJii+qXf1Zo1iWQl7i50+yCEkstCO2xOKs6xVKrnU9NtZ1gubu GCeRHlSKSREdkj3dwrEEqvc9sVecN5O8uQX9nMNV0iMwcGt42aRWK2901wW/3qAYrNM1TSm9DlNT 7x8v2uVxYa+mV/1h/wASuj8k6Mhtb231LShBYtDLBKHuCIvqfKRCHN2ykK0xY1HQite7WTvHy/an iwfzZ/6Yf8SyfQtT8o+X9BtbA61YJb29Ujka6QLR3LKA0sjt+1TdssiDW7jTIJ25J1r6TP5c1RYR Gzm2lqkyLKjrwPJCjvEh5Db4mC+O2SYvIrTTPMdqyMvlLTVuPjKmPSrCtKKBIaar0DqK/CPprspW 33l3W5ErJ5O0ylXAhTS7BQuyqrFk1MUDDZfiI270GKGS+TrfzlHbz2VpbWHle4LIwMljCEmUEgIk UF9IfhHj44qnrv599FvT8y6G0kkUbW7fU5FUlzxDf71PUOwop6Hw7Yqrwt5ziZVuPMujtShkU2Th vioKAi7UUr9n4fbfrirccPnv1BKvmLS7iJmjSaMWbRhCrUf02FxIat0KtXfoV6YqpBfP0QjjfzNo zyqgLl7F1ZizMqNRbsbFhTYeNMVZTpiXiWUaXtyl3dLX1Z409NGJJIolWpQUHXFUVirsVdirsVdi rsVQWsDVTp8v6K9M344mFZX9OM/EOQZ/Tmp8Nf2DvirG1f8ANE3Sq1pYJa8jzkGoF5OIO1EOnoNx /lbe9N1XM/5pekeNnp4l/eUrqTEbU9Pb9GL9reu+3XfpiqHSX83mukDWWnxWokIlb696jmP4fiQf UUFeuxp/HFU209fO0mpPHqEcEGmgfBcw3ayzE8RsYWso1+1Uf3mKsQufIutJqF9c23lLQJp5buV4 r6SWGOWaKVmLSTU06RhI605Dk3xHFVPUvy61C9eK9k8naBcXxWl1688QNVjVECyLpr81CFkIdR0H hirofy0u7y59TU/KegiG45TXNGhaX1vVqob/AEHi9U4lmru1R03xVlvlTy/f6ct3C1la6NAzhol0 1oHEpYFnaQfVLfieRPjXriqf/U7j/lun/wCBg/6pYq76ncf8t0//AAMH/VLFW1tLgMCb2ZgDUqRD Q+20YOKonFXk35txXl3qul6fbafYXZmilZp7yKzmaFVdOcipczRMUSMsWoNtjXwVYdPoOrpdSqfL 2jww28lIpGsNOCSCOZ0Kgm+U/HxoSE5fDTbeqlT0o3K6ZNcDSNH5R/WFuRLbWEYWaaGNgvJ7sCP1 omEVBy71+LbFUrGh+aLmQ/o7y1pR1Ax8li+qWDpII3AYIyzyR8xzYnioNAPbFX0D5kSOTyfqa30I nX6m5nUegApEZJf/AEk+iOB+L46gU74oeDRP5MgtfURpbdljkZwW8s0kM0LOifBxZeXShDCgG1dg pXS2HlNowHs3tXlkWGPTwfLpmaWOTg5UsvJzU/ZoPDoRirI4fy/khuInj8ta0bg+l+/MPlscBGwb b4CpJMa05dPf9pQi4PIdsk1ncXHk3UbiO2BV7T0PLwSUOzMRKUWFxQmnwHp/LXdVPrbR9BmjiWX8 rJY1UPEn7vSqrGQTQc7lCK8zX398Vdc6Xoluohi/K9pEIj9Mxx6aATw9WjES8l4NUVIpXv4qun0f RBJxb8sHkEIZFeJdO48Q/McazITVt+nX78VZX5SkhSF7W28tzeX4KtK8ci2yI0jEBjS3kkqzda4q yHFXYq7FXYq7FXYqxX8ytFGq+WqNM0SWFxDfOq2j3/qi3bl6Rto2jeRX6FQdxirzZPLnl6+hlMdq iLpySNJGfLWtQtIoVmYBjdoZCack+It0A22xVTi8t+WhaBlg4xN6kLxt5Z12SUuWhqwP1l5AVP2e BoQWoDQ4qk2r+UfK+vC2hs7670dkmaKtn5a1pTKzniA7SzSj4eBNNu+3gqyDSP8AnGu70/Ure9Pm ySYQNz9I2hXl7V+st+rFURqmueT0jSCXUbq2k5Au0ekX3Kp3PxcmRgFkU/BXalMyho5nu+YW1sae XZbX6zHrGpPGKV46Pfk0NN6U6b/a6ZE6Wd1t8wtqTPoARjHqOsSyKSvopomoc+QANNwFrRl79xh/ KT8vmFtELZ6SYWlF/q/FXEdBouoEkkA7AAn9qm+D8tLvHzC2q2+laXPIsaajq1WCGp0XUeI5qGAL caA0OROnkO75j9a2tudO0m3XlLqWqheAcE6NfhdywALMAqmq/tEdsI08j3fMLbIfL/kZrkW2px6n cpGkob0Lm1kt5D6T90kcMA3HY06ZVKPCaV6HkVeWfmp5Yn1jVdLmj0a71RYYp43NudP9NRLQfEL1 ZPi7ginsa9FWFQfltNDbGH/DGqM8hJUyDRW6gylSwiem8QUcvhPL9k4pQsX5Z6rdvN9Y0DUrdjCC p4aSyusJULH/AHf7s0NKd6V7UxV6X5K/LDQNKkXV5rWRryURSwWl7HaVs5VB5GNbRI4eZJHxgV26 9cUPQYACGB3B6jFWFeavN91Ya3Lp+n6ZbyxWkay6nfXIIjRXUkAcaEngffr0zA1euGE1zJ5Dvdrp NBCePikTZ5AMi8vXOla15ftL2Kzjjtrkep9XKKVVw5LbUAP7xSQae+ZsJcQtwdThOLIYHonOSaHl v5r6x5ntNXtILJpobBoWZZoW4gyhXIDCqV5OFUmvwg1pkg6/UyHH6pGMa6M68oXGp3Hlyxm1IEXj oefL7RHIhSfcrTAXJ0xkYDi5t+brrUbTy5fXOnKzXccfJOAqwFRzKjxC1yeEDi3XUmQgeHmxP8v/ ADHeaprk0dtBeRaZHbj1vrsjSn1a0DBmGxbwGWzsx9UeE3s0YaE/RLijW+90f2vQ8xnOdirsVdir sVdirsVS3zJd61aaHd3WiWi3+qQoXtbJyFErD9jkWQLXxJxV55ZedvzzuLw2z+RbaECaOMzy3ipE qPQFywLlkXepQFv8jfZVk31z82CY/wDcXoqg/wB4frlySPjI2H1cV+Ch69du1Sqpy3v5wenC0Ok6 EZCP9IR766AU/FQIwtjy241JA32oeuKpxojec5YJzra6faTrMy26WnrXCtDQcWZnMBDE1qtPpxV5 K0Pmtbp+H5WaYWo4e5Zac/35LKKIzDm1XHUU+7NptX96fx8UIH0NeW25H8mrFZAq0CxxGqgCm6jl y8RT5nJdf75fgmGjSee7LU7R9M/KjS9MvI2EMGp1jQQrIChdnRfV48WPMjele5yExEg3lJHd+Cj4 PQhe/m2YmP6L0US8gFQ3lzTjQVNRAe9cw+HF3n5ftZKsF3+abSAS6bo0cdF5N9buS1SoLUAg6A1H XAY4+8/L9qrbi8/NVFrFpmjyfCKgXdxyDEkGgaFQabH7QwiOPvPy/aqd6WPMj2yNqjWcNzyPqRWy yyJx5bUd2jNeP+TlUqvbkqZ5FXjv5zajLYatpc0bIr+kzQsbkwEPHKrAlBe2IYKaEVVt9tsVYDb+ ZPrZ+r3WqyooRpIOV6ysCqFSH/3NKVp6X2X371HLdSr2muXstzDaDVPilbksi3vFyQvJByi1zkQA 2w7dsVegflqdM1uOKSI6hI2ncWuL39JzSW73AIcIIlvLv4eLbo7cfEYoeqW/RsVeda95Z8469dLP qHl/T4w3GOc22s3CPJEjErzQ2BRioO2/05TkwRmQSNw5um1+TCKjXx6Mi8qT+ZLaaLSNQ0XT9KsI Letv9U1CW7f4WCgcHtbfY13bnWvY1y0Cg4uTJKcjKW5KE138xvJUM11YXmqvBDbn0LyW3iuHHqOr Aw+tFG4Qgb1Rg1ehFDlggWu0gvJvyyt7eG4u9X8xQWxi5QSy3XmFYyjbCQM5o396KN7inbBwFSQp WvmD8ppJrc2/mLWpngKhFF3rchcozyKJNyZPtNs3VdjsBQ+GV4gnNz58/L/zFcnRZdcntvXIjiii N3p7s1VkV/rCrDIhqvED1ADU1BqKJgaWwnWieSNG026ivbK/1OYISyxz6pe3UDEqU+KOWaRGpyO3 Su/UCkEskxV2KuxV2KuxV2KuxVKPNn6B/wAPXv6fkMOkemfrc4aSPgn83qRUdKfzAimKvOku/wAi LbShInmBktHn5R3r6heSVmVTFT1JXfnsT8LVG1f2dlWRaL5u/KZbFINP1OyvIIPgM3+9BBJ/bko3 c7VPgB2xVWj8/flPJqI0xNT01tRab6stmAnrGflw9IR8eXPl8NKddsVZBw0P/lg/6c5P+qeKvAL7 RtBN5KZ/PtpbqP8Aj2W4vYmjPqj0yULkRUSlQFHxE702zbxnt/dn5BDo9HtxpjD/AB/pjW5IU3Hq ajVZaLUB/rHbb4OnsK48Yv8Auz8h+pUFNpGhGF/U/MXTDFyLBPX1N/h4kFeP1vpXfpX9WSEv9rPy H6kM4sbT8mZbKO3fzXPcTsYvXe3v7oVlIVBSjO6qzUABY/MnfMWRy39H+xSiLJ/yS+sQNB5rmlmc RxwxnUJ2rQBFHp1pyNB1FfvwHxf5n+xW25h+Ssys/wDiuZfRjXmVv5SAhcqCymqsC0lCWB7e2I8U fwf7FLMfJ175AuLIW/l65j1SO2f4p1Vrl0aRiw5yBTTetK5jZoyBuQr7FZdlSvM/zN07Wru7t5bC Cd0traZ2kjkZIxUgMHAvrBelDU9Ote2KsB0zy75zuIHla3vg0DcR6d1KVDFmDKx/TKUJIpsBucUq lv5c88pcPdNpWoSSMDDbFA6RcDG6qGT9KKQByPGo22odxiqYWGg+Z4rk/pHQ9bktmiQBbG/midJC inkGl1KRWofg4lPfk3dQ9q0ok2UJaN4SY0JilbnIh4/ZdqtyYdCan54qkl/5qvf05c6Zp8duTZKj XJuGkDNzHL4BGrkeFT3w7d7iyyzMiIjYdd/em0Oo2d/Z2sqKzSXMS3EcCsFlVGAqa8loBWla4t8J 8UQR1fPnleTTo77V1uL/AFCzka7fnHaalaaahUSbcvrMqGU0LdB8NB/NVciSAhb7z0sF5NDDqXmK 5hQ0SVtXWNuQLV+xHcIQKrQq+9K96AiPuW0x0m4tr7RrSe88w6uL5aNNGdWsIk9ISAskYnuUlRvh DDknUDbvgPPkqV+Y40HmjSorLUbrUNOSWAW0d5e2t7LGxcKVX6rNOgFIxTp2HhhHJer3fzrC6C1n kDSaSZSNVtgHdSvoyLEzRxD1GBkZeVPBfAnMHJ0vk7DSH6uH+8r0/MXz8kL+XMbpJq31YOmhPMra XHIJEABLmT01lAYJTh7fjjjrpyZ62UjXHXib3VctquuvNmmWOA7FXYq7FXYq7FUs8zQzTaFeQw2k 188icRa21ybOZ6npHOrRlG9+Q+eKvNYdFuorkTp5K8wCW1jiWJ213aRUlVuJC3h5keoXPqDcAivb FWXTeZfNMfxR+R7uVwHAK3WnjZCaCpmB+KlV+YrTeiqAXzt5xe4PH8u9QUpzYyvc6ep5BOXwkStU t9mtcVTjTPM3mi9uoIZ/Kl1YRzBjJc3FzaGOLiKgSCKSRyW6Dgre9Bvirw/X9Y/Ln61/pulX7Shv 91a3bcSeh4qJqnbf4lFev7W+6hHNWxj8j+pBeg+UNWhPl8Po3ke5vrT1ZB6klxYSuzGQlhzaTdUY lQv7NKUzDzRlxeqYHz/UlM5db1oRVH5aTs3I8VMumU5b77SsR86ZWI/7YP8AZfqRbbaxqjIPV/Le YJUAhn09/hJAY0R3O3WnfHh/pj7f1Jbi1nVmEAf8tp41bgKmTTSI6t4CTlRevTEx/pj/AGX6ltU/ TGsehKf+VdT8VVTw9XTfiq1OIHq9R16Y8P8ATH+y/Uqb+VL7ULhLg/4XPl9RJR1meBWlNTyZRb+p yoe7UrXYnfKsor+Li+f6VZLlSvNfzPa2t7rTLm6tvL89vJ6tvK+ulUlQPxJMDt8JXgH5LselDvTF WCx6totvKiyaZ5FSGUIaLORz4s3BlkELKApRqn6Ou2KvU7Lz35Aitre2tda05ERBHDbQTxlVRABx RV/ZUe3QexxVMtK8z+XtXuJrfS9QgvJrYVnSFw5QFio5U91OKpjPqWnadbm41C6hs4OQX1riRYk5 GtBycgV2xVgF9qlzLdi81SLRrD14Q80sWvcRK8IZkBV7RQygIfjDAgfLFplgBN7g+TIPKnmiSeK4 XUo9I06zso1FvJYamt6nFOfqLIWhtvT9MR+/fpTFtEQBQR9x5L8lanM2oTaTZXUl1SVrn00b1OQr z5DrXx75ISK0p/8AKufIn/Vhsv8AkSv9MeM960Hf8q58if8AVhsv+RK/0x4z3rQV7HyR5QsLuO7s tHtILqI1imSJQymlKg02xMitLte8meU/MMsEuuaRaalJbAiB7qFJSgbqByB2PhkUqWm+QfJGmahF qWnaDYWmoQDjBdw28SSovD0qK4XkP3fw/LbFU+xV2KuxV2KuxV2KpT5o1q70bSJL+1sxfyxso+rN PHbVUn4yJJfhqFqQO/t1xVJW88a/680cfla5ZYvTHNruxFGlAbi/GV+PFTU0rt0riqGtPzA80yuk Vx5LvraY1WUvc2giVuNdpGkTkK9aLUeBO2Kqd3+YfmuJ5BD5PlmihdlkmOoWarQOqqVHItV6kgMF 7eOyqp/ysbW2JaDyrcXECheUsN7YPuwOygTfEfCnX50xVDwefNeuAqz+R7hJJgr20L3ViryJ6ZeT 4JnifknQqFPvTphsqybQteFzDci9shoskE7IlvNLAxdCA3rD0mYAOznrvXAVTODUdPuFDQXMUqsQ FZHVgS1aUoe9Dirv0jp/orP9Zi9Fl5rLzXiV8Q1aUxVel3aSFgk0blacgrA0qKitD3GKrX1CwRS7 3MSqGKli6gcgKkVJ6imKqsUscsaSxOJIpAGR1IKspFQQR1BxVdirBvzJv9NtNLtP0lb3MtpLdKhl tb2PT2R2Rwv7x57blWv2eVO56Yqw/RPzQ8kafYycbGUwiWrG51G0u5BzMleJnuWovGMEIhpUnbuV UcPzk8sCWS3/AEOUFvzDKbnSwEK/DICPrNF+L4ffbFWbeVNdtNc0xtQtbdbaJpGjCrJBKTwpXk1u 0iAgkinI4qoefNQ0Kw8uPca3p0OqWAmjDWlw9siFjXiw+tNHGSPCtcVedp5h/JqR5Lj/AAtZFfS4 lXutIJXgFRVSI3ZRaiTcrvUdzTFVy+b/AMpJDcXbeULRxJV5pWl0h1NG48qG5NN5utPvIGKpzH+d eiabD+jrXRTGlgvpJDFeaesMcUaL6e/rfAh5Kq8lH37YqrL+fGil+P6OeiITM/13TaLKKAxrW5HL 4qrX5GlDiq+b8+PLsd3DAthM8c1CkwutNCspLIGQm6Cn94vGhYdz2piqo/55+W45HjltmSRC9UN7 pdaIu2/1vhVnBWgY077EYqsuPz38twqT9UkLDkCn1zTKghwgrS7I3J7Vp323xVO7H8wbvUbFb/S/ LeoX9m4/dzwS6eyMQeLgE3IrwcFTTwxVlltK81tFLJE0DyIrvC9CyFhUq3EkVXoaHFVTFXYq7FXY q7FWG/m3bQ3HkueOaa0t4/XgJlv3jjgFJR1aWG5SvhVDirxBtE0mO3irf+X5fQaMNLHLp7wkksqC Zhp0bAOOrcjuKmm2KU1sPLui28VhLf6j5euWfl6cb3WmenKQooCx00HduIPxnrWvUYqoQ6LosrQw R6roZvJEhtUZb6wmdyJFjSMqNMq37v4aU40pXpXFV2n6R5aSYXkmr6EgpFLAqXmmu6tDQKnGTS+S AhSdyOm4riqpc6HobyKLXXNCijiVkSR7/TG4o4pIyxLpoXkEWh4MBQdd9lVGXyjpUFly1C90T6sC 8iSfXbHkqtRkReOmSMVWRSaIAPiNdq4qpS2nl2CZGi1vR62pM1iILqxZg0RMqf3ekAL8TNUbDwrv iqIubLys1pE8V75bEoklV1F3pyuwcN6bApplVMbUZTT2auKqSaLZQq8japocz+l6Gno2o2EcnBWq AoXTlr8abAkUrxO+4Va/Q2iXdvOkur6FHc1LXMh1HTv3rStUmV/0afU4hhxYbcu9cVeo+RLnRa6Z YQedxf3McYeHRoZLEIYxED6KpHDE7JGoqOIXYdAMUPRcVedfnFdra+V4JWmeEfXEHKOb0DUxycav 9Zstg1Gp6nbp3Crxyxku7q4jgttSaaZB+6jF8tG5kqvE/phivDkfs0amx64pVJp2tJY2ivq2kiBZ PXv6MsbKpVOI1hEdG9IilegpvQYq9t/Lex1CDy+lzqLTteXXFnM8jPVUUBXVTcXiLz3YlGHKtaYo V/zCm1aLyy7aUJmu/WQhLflzZVVmK0W2vqg8ejIB/lDuq81i1bz9e2aQPNqMc96Y0cSWbekzS8Qw JOkBONCK8u4+0w3ClkM/lT83DZyql4jTqCLdzcWfLiylGBppigVBBpU/ZFGFN1CJPlv81pEdXuwq ulqpK3tqWXhxaZl/3FirM8e4LcTXv2VUr/yl+bbqscGqKyc+bu15Asjlip346YFovp9KGtTvvTFX f4P/ADTNxbTtfK6IvqT273dtQyNMSyVXTByQoxNOlelAoxVseWfzjFUGooAAtH+u2oFQyNt/uI5f skdB296qqMPlr85FWST6zGJGYFR9aswQRVS1f0a++3IGo+XgqyjR/KfmoaJHDd+YbuwvCWaSO1Ww lVSWOwf6nEDy+0aIDUmpOKsutonhtoopJWneNFR5noGcqKFm4gCrdTQYqqYq7FXYq7FXYqgNc0Sx 1rTpNPvvVFvIVLGCWSB6qeQo8TK3UeOKscT8pvKKxyRn68/qyCUu1/dlwwZnXi3qchQud+p7k4qi I/y18uJ6FJdQrbMGiI1C8U1Cou7JKpb+7HX6MVW2X5Y+WLM8oJNQV+7nULwk/DxrQy0qOxptiq5v y08ttJzaTUGPJWUNqF46goGGwaVhvy3xVZdfll5fuFkVrnUkErrIeN/c9UJPGrO3JTyOzVA7UxVU m/LXy1KoVpNSpVSaanqG5UEb/v8AwOKprpHlnRtKtBbW8JkWpZpbl3uJWJAHxSTF3Owp1xVHPZWT o8b28bRyDjIhRSGFKUII32xVv6ra+mI/RT01pxTiOI49KCnbFW/q1vz5+knPry4ita16/PFXJb26 SNIkSLI32nVQGPQbkf6oxVUxVgf5nNq0WlWdxplxPDPHdDlHAhk5qYpOXJUs9Rc7f8V8fHFXmFrq /ntII5PW1CEODCCLeVeAAWq8RovDaijYk9l71VRlzrPna3t4zcJfTvKZAqtDOCAACqqI9ITh36oP A1A2UvVfJkvmCbR1n1oD1pyJYTzZm9N1BCsrW9oyEfystfHFCl5/jkk8vARwyTyC4jdUhlvIJPgD NVXsUlmrQbfDTxxV5ddyOpeCXQtQKRSosyzah5jZZI6Bhxragt8SD9g9+tQQpROm6lbzmS8tdH1J NTgeOUxteeYpE9USopV1jtT/ALrYA/Ca4q9KGp/mc80bpommLbE/vEe9mElKdVP1fpXf4lB7cR1x Qqwal+ZLwq02h6ZHIWFV/SUxIWorUC0p0r+0fliqql3+YLTqzabpiW9KlDeTl+VSAOQt6D4dyaGh 2364qorqH5lFE5aLpYcOokH6QmoyFTyNfqvwENx7N39qqtm//MkM4GjaUyiVgjDUJwTFy+E8TadQ p3339sVTjRZtdlt5H1m2t7W49QiGG1ladfS4rQs7pFVuXL9nwxVMMVdirsVdirsVSjzL5ltNAtIr m5iklSWT0wI6VBoW/aI8MxNXq44IgkXbk6XSyzSIBqmPL+bOjOwVbS4VmNAW4cQT4/F0zXntzHW0 S5x7HyDqGJ635p1yLVbyRb2NUgmtU+OCZljMrsrJJKq8AzqqunxKKMMzcGkhljGUgZSkCeLi5fb0 5fB1c8piSBtXSmXTfmZp1hIbO6t55p4aK8icOJNK92H05r8fbMYxAkCZB2UOy5zHECACs/5W3ov/ ACx3P/JP/mrLP5cx/wA2X2Mv5Gyd4d/ytvRf+WO5/wCSf/NWP8uY/wCbL7F/kbJ3h3/K29F/5Y7n /kn/AM1Y/wAuY/5svsX+RsneHf8AK29F/wCWO5/5J/8ANWP8uY/5svsX+RsneHf8rb0X/ljuf+Sf /NWP8uY/5svsX+RsneHf8rb0X/ljuf8Akn/zVj/LmP8Amy+xf5Gyd4d/ytvRf+WO5/5J/wDNWP8A LmP+bL7F/kbJ3h3/ACtvRf8Aljuf+Sf/ADVj/LmP+bL7F/kbJ3h3/K29F/5Y7n/kn/zVj/LmP+bL 7F/kbJ3hdH+bGiu6oLO5BYgD+777fzYjtvGf4ZfYp7HyDqFH8xdVazgtUtdah0vUFczJFcXSWcUs YBUlmeC5L8WI+AUr+B3sMUpchbqGGQ+ZdXGow21152s7axZ2SaaHUbO4dF4M3wrJYVLcvh+KT/hu k/y+T+aUpxLqGiPEy/8AKzpxGF+NxJp4YKPgPxLAKElhTvtt3x/L5P5pQyxvzC8jLKIm16wDkAit xGAQSQKGtO2P5fJ/NKrvPeo6zpvle7v9Ju4rO5tQ0zSTRxyKyRxO5QCSSFQTxG9foylWD+WPztnE RbXTDeetKEg+qvYW5jUCXdi9/IH5ekN/hUb/ABHFWWeV/wA2PL3mDUxpsa/Vbl15Rc7mymDioWg+ rzzb8mAA79sVYZH+bPmTTdcXTNTvrO6S3kjE8ipYxNLHIBKQvLUYwrcHCggMO9D3VTJ/+cgNMGmi 9XSi1ZfRMYvbM0rUg1Dse3QgHFVVvz+0IQtINOclTQj67pooPU9OtDchv+F/DfFU0P5gP5i8p6tf +XJl02806VE9W4azuRxJU1pFcGOjgkCr9elTirz+x/OfzhPaTO19aqbURwu4is25PI/H1S311EUD kBx/HFLPfy5/MuTzJcLpk0Iluo455pr6OS2MZEcqqi+lBNc8fhlUfb7e4xQ9BxV2KuxV2KuxVg35 t/8AHFs/+Yn/AJltml7c/u4/1v0O37G/vD7nlWcy9EmcfmHUkjVCUdkHGOZ0VpFA6UY+GWxz5Ix4 RI8Pc4ktDilLiITbypPJJBfc7oRkyRyurx2svOnIFqXLJTjXr75l6I7SF1y6RP8AuiGrVxAMaH+6 H+5ZG9pfsX5XwIljIuFMGnoQkgqGYGbdqoOvvTM845fzufPbH1/zvJwROP8AN928/wDiVO7/AEg2 1zfUJQmUi304lwzUXpMK7fa60+WDJxfxS/2OP/iv7GUOHpH7Z/8AEtRM0P1eBr+GRYqlecGmnhGq 0WjesRvzGwIP0dRE1Q4ht5Y+X+mSRdnhO/nP/iW447mJkQapFQ09RxDpoNEFYyX9apPJRseuEAj+ MfLH8P4kEg/wn5z+PRTijmCyLHqMQdW+ybbSwC7AMOs/Yt/nTIxB3qQ/0uP/AIplIjrE/wCmyf8A EpdfeX7S6mRrq9ZJVTiyxpYqKh6Nulyo+2/fenyyjJpoyPqlv/mfom3Y9TKI9Mdv8/8A4lDzeTtP 4qYNSWjM0a+qbdRyTl1pMaA8crloo9Jf7n/imyOtl1j/ALr/AIldD5S0JhSTV6SEniq/VjUKQp/3 f/N08RvhjosXWf8Auf8AikS1mTpD/df8SgNe0PSNNirBevcStQR0EDRk7cgWjmkK0B/l8Ppp1Gnh jG0rPw/RItunzzmd418/0gJNbf70xf66/rzEjzcuXIvfGRGYFlBK14kitK7Gmd+8OsNvbkgmJCRu DxG29f1nDZVv0IP99r4fZH+fbGyrQt7cGoiQEnkSFFajeuNlUVCqsjqwDK2zKdwQexwK42Nkwobe MioNCi9VNR27HFV5t4CamNCag1Kjqu6n6KbYq01tbM5dokLnqxUEnanX5Yq19UtOAT0Y+ArReIpv UHanvirS2NksYjW3jWNeiBFCintTFVsmn2bxPEIhGkgVXMRMTFUNVXlGVag8K4qxWD8pPJ0CSpEt 6qTcC4+vXVaxsrqQ3qcgQV8cVTLQvImgaHfm/sPrP1ho2iYzXVxOCrFSaiV3qfgFCemKsgxV2Kux V2KuxVg35t/8cWz/AOYn/mW2aXtz+7j/AFv0O37G/vD7nlWcy9E7FUTa6jqFokkdrcywJKKSpG7K GHSjAHfJwyyjYiSLYTxRluQDSKPmbzESzHUrmrqFY+q+6itB1/yjlv5vL/Ol82v8ri/mj5NL5k8w KQV1G4BVSikSNUKxDMBvtUgYBqso/il81OlxfzR8nSeY9fkUK+o3DAAqKyNXiwAYVrWhpidVlPOU vmkabGP4R8mh5i18VpqNyORq1JXFTTjXr4bY/msv86XzX8tj/mj5Lo/MvmGOT1F1G4D1BLeoxrTY VqcI1eUG+KXzQdLiIrhHyXP5p8xvIJG1K45rUKRIwpXrSnTpidZmJvil80DSYgK4QoXeuazeQmG7 vZ54SeRjkkZlr1rQnIz1GSYqUiR72cMGOJuMQCgcpbXYqq23+9MX+uv68MeaJci+gv3HvnfvDu/c e+Ku/ce+Ku/ce+KqkXDfjX3riq/FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FWN+ef8O/o+3/Tvq/V/ W/dejWvPietPaua7tLwuAeLdX0c/QeLxHw6uurC/+QV/8vn/AA2af/Av6Ttf8M/ou/5BX/y+f8Nj /gX9Jf8ADP6Lv+QV/wDL5/w2P+Bf0l/wz+i7/kFf/L5/w2P+Bf0l/wAM/ou/5BX/AMvn/DY/4F/S X/DP6Lv+QV/8vn/DY/4F/SX/AAz+i7/kFf8Ay+f8Nj/gX9Jf8M/ou/5BX/y+f8Nj/gX9Jf8ADP6L v+QV/wDL5/w2P+Bf0l/wz+i7/kFf/L5/w2P+Bf0l/wAM/ou/5BX/AMvn/DY/4F/SX/DP6Lv+QV/8 vn/DY/4F/SX/AAz+iuh/5Vd6qcPrfPkONeXWu2Efkr/iQfzlfwv/2Q== uuid:a3364c09-fb8e-1b49-8802-3743a09925b1 xmp.did:8608da7c-d0cf-48fa-8be9-5c6ae446743a uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:da6c9ef9-86fc-3047-acc1-48b53d15a8f2 xmp.did:b08db73b-034c-4ff9-b0b6-5826f4ca45fb uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:ab17be08-b65f-453f-ae7f-4fe23b51a1d3 2019-02-13T16:27:05-03:00 Adobe Illustrator CC 23.0 (Macintosh) / saved xmp.iid:8608da7c-d0cf-48fa-8be9-5c6ae446743a 2019-09-23T10:54:34-03:00 Adobe Illustrator CC 23.0 (Macintosh) / Print False True 1 215.900000 279.400000 Millimeters Chivo-Bold Chivo Bold Open Type Version 1.007 False Chivo-Bold.ttf Chivo-Regular Chivo Regular Open Type Version 1.007 False Chivo-Regular.ttf Colfax-LightItalic Colfax Light Italic Open Type Version 1.000 False Colfax-LightItalic 2.otf Colfax-Regular Colfax Regular Open Type Version 1.000 False Colfax-Regular.otf Colfax-Medium Colfax Medium Open Type Version 1.000 False Colfax-Medium.otf Cyan Magenta Yellow Black Grupo de muestras por defecto 0 Blanco CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Negro CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 Rojo CMYK CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 Amarillo CMYK CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 Verde CMYK CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 Cian CMYK CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 Azul CMYK CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 Magenta CMYK CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 P Charcoal CMYK PROCESS 100.000000 CMYK 65.792322 56.157774 58.059049 62.648964 P Citron CMYK PROCESS 100.000000 CMYK 13.846035 14.843976 94.692910 0.973526 P Cardinal CMYK PROCESS 100.000000 CMYK 24.188600 100.000000 95.858699 21.084915 P Charcoal CMYK 2 PROCESS 100.000000 CMYK 65.493244 58.352023 54.680699 61.406881 P Citron CMYK 3 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=22 M=93 Y=100 K=16 PROCESS 100.000000 CMYK 21.960784 92.549020 100.000000 16.078432 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 Grises 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brillantes 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Grupo de colores 1 1 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=9 M=11 Y=62 K=0 CMYK PROCESS 8.984375 11.328125 61.718750 0.000000 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 C=85 M=88 Y=0 K=0 CMYK PROCESS 84.765625 87.890625 0.390625 0.390625 C=61 M=83 Y=1 K=0 CMYK PROCESS 61.328125 82.812500 1.171875 0.000000 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 C=66 M=57 Y=54 K=59 CMYK PROCESS 66.406250 56.640625 53.906250 59.375000 C=40 M=32 Y=32 K=11 CMYK PROCESS 39.843750 31.640625 31.640625 10.546875 C=18 M=13 Y=14 K=0 CMYK PROCESS 17.578125 12.500000 13.671875 0.000000 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 5 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 260 0 obj <> endobj 261 0 obj <>/Border[0 0 0]/H/I/Rect[19.6665 57.6431 180.168 69.4531]/Subtype/Link/Type/Annot>> endobj 262 0 obj [261 0 R] endobj 263 0 obj <> endobj xref 0 1 0000000000 65535 f 2 1 0000850507 00000 n 5 1 0000924357 00000 n 260 4 0000924836 00000 n 0000925095 00000 n 0000925234 00000 n 0000925261 00000 n trailer <]/Prev 845132>> startxref 925369 %%EOF