%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf PMM 2.0 2019-09-23T10:55:09-03:00 2019-09-23T10:55:09-03:00 2019-09-23T10:55:09-03:00 Adobe Illustrator CC 23.0 (Macintosh) 256 100 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAZAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FVK7j9W1li5snNCvNDRlqKVU9iO2RlGwQmJo2x//Dn/AGtNQ/5H/wDNuYn5L+nk/wBM5X5v +hD5Nf4d/wC1pqH/ACP/AObcfyX9PJ/pl/N/0IfJv/Dn/a01D/kf/wA24/kv6eT/AEy/m/6EPkpX Omw28i2y6pqUl0YjP6K3Br6akLUAIzHc9hlGXBwmhPITz+r9jbDMZC+GAHLl+1JNQ8xeXLAz+tqu ssLay/SEzxSeoix+u1tx5qOPP1EYUrQ02OTx6YSjYnk/0zGecxNGEPkp23mvylcPOi63q6vbXVvZ SK8hH726DNHQ8SKUjau/bxK1n+T/AKeT/TMfzX9CHyd/ivyj9ctrQa5rBmur6TTY/jYKLiJo1YMS o4r+/U1P69sfyf8ATyf6ZfzX9CHyTzy5FpXmLR4NX0rW9TlsrguI3acqaxuUaqlajdcP5L+nk/0y Pzf9CHyTP/DH/a21L/pI/wCbcfyX9PJ/pl/N/wBCHyTeCL0oI4ubSemoX1HPJ24ilWPcnvmXGNAB xZGza/JIQ9/As9uYmZ1ViKmKR4m23+3GVYffkZwEhR+8j7mUZGJsfr+9K/0Na/7+vP8ApNu/+quU /lo98v8ATy/W2/mJd0f9LH9Tv0Na/wC/rz/pNu/+quP5aPfL/Ty/Wv5iXdH/AEsf1JfeRWsNzJbR yXhmihW4Ia9uwHVnK0QmUAkcanevTY1zGzYxE1Hi5X9cv+KcjHOUhZ4auvpj+pjur+aBYRXssWj6 veRWi2xWSO8uwsj3BAKAF+dUrv8ACem9Nq3QwwkAfV/p5fra55ZxNen/AEsf1Ii08wQz3ctu+max Esepvpv1hrq79IohZRc8vU/u249aU98l+Wh3y/08v1sPHl3R/wBLH9SFTzbEZLLnomvRQ3RuBJK0 95+6FuCwLKJCfjAoP8rbfYl/LR75f6eX61/MS7o/6WP6mSaFHb6rpFrqDR6jZSTpWSzuLu8SWJwS rowMg+ywI98P5aPfL/Ty/Wj8xLuj/pY/qR/6Htf9/Xn/AEm3f/VXH8tHvl/p5frX8xLuj/pY/qbT R7Xmv7676j/j8uz/AMzcfy0e+X+ml+tfzEu6P+lj+pPMyGh2KuxV2KuxV2KuxV2KuxV2KrZf7tvl irzrUfzc0HT9RuLCa3Z5bedrasd3pg5OhINFku43WlNw4BB2IxVCn86/LYi5i1lJoWK/W9KFACBW pvelTT54qmPl3809B13WY9It4JIbqXnx9S409941ZiOEF1NITRT0Q077b4qh/wAxvN2h6Jq1hDer cR3f1ZpIbq1u7S3ajFhwkju3RJFPDYlWofAneqeISN8i3YsxgCKBB72N3P5meTr6OJpLC8jPpJBL Fb6tYwp8XKUDgt3GrkmStePt+zTE4Qe9nDVSj0ifeAfvaf8AMTyZFPIr22pROCEuIX1i0SgiowPD 658RLHv89sHgjvPzT+bl3Q/0sf1Ktn500G/vY9P0zTdXu7/94sVgus23qGRByccPrjOOPBiT7V3x 8Ed5+ZSdZLuh/pY/qZhpPmTXLKBrWHybq/oRuQHmuLWSQkjkWZpJ/iHgVZvDwyyMaFOPkmZGzXw2 ZrC7SQpIyGJnUM0TU5KSK8TxJFR7HJMF+KuxVa6BxQ7Yqxqfzp5et72WymXUFuIZGicLpt/ItUNK q8cDoynqGBpTFVC3/MHypcRmSNr8oFL8jpmoAFRQVX9x8X2hsN8VQtxr/kbU7y2mljv/AK2hCW1y thqUDjky/CJVijNPiBK16Vr3yuWKMjZ5tsM0oggHYqF1qn5cXt0v1nTLqaZ6RpK+j35DCP4Rxf6v Tio71oBjLDA8wzhqssRUZEIc6j+VyK0Z0y5AY0aI6RfhQxAXjvBxU7jb78HgQ7mX53N/OLvrv5V1 VjplwKrRR+h9QIoTvsLcioI774Py8O5fz2b+cUztPOnk60tktrSDUIoo6LHbx6TqC05/EAq/Vx1r lsYgCg485mRsmyqL+YPlUgn/AHJfD9r/AHFajsPE/wCj9N8LFkli1teWsF5buXgnRJoiVZCUdQy1 VgrKaHoRXFUZirsVdirsVdirsVdirsVdirsVWy/3bfLFXzD5u1Dy5D5o1kTT2huor24LAxxhg3rO xDf7iZi3ECp+J9zUsSAcUpcNX8nW1xC8Vxp88EZWQq0cKVqqk7LoxZTVqHi3btTZVnf5V2ddfiv9 Js7eaD0ik1yI1t4/SZgDLFIuk2vqNtTgs2/jTooT782PO0mg6zY20epCxY2yzsknEJJylZACX0+/ 32PRx8u+KsFH5szIYXbX4plYgMpMaq3B1O7DRFI2+HtQb4qsb81ZHk5DzCkkjRhS9VCozMvxkNoq jeihi2w+Kg3GKqln+al9bFZn8xRxDkI425AKEqrHhCmjVrxb7RHHc8dzsqqy/m5rlzemGy8yPyuK LbWiFnfmWoVAGjNI3xbAVrt7gYq9s8jXWt3Pl+GTV4ys5LenI0rSySITUO4e3syhqSoX0+gG+Ksg xV2KuxV8/eaD5D/xDrAuJJBMt/K12iL5ZZamYmT+/ZJ93WjeoeX81cVS76n+WrzyUuGtEkZpE9WH yuVAKhvTHJ27Gi/edqHFVWzXyBZ3CXErS3VvE1JLd4/K6RyCM8pIfglVqqsh5FT0J3xVkJ8xfk00 aPN5StUR6sGabRirFm4Egi8PLdD92KuvfN35Ml5mfypbT/FzMgk0ejcn+FyDdh1DGWvxL33xVVXz T+TTyKo8r2YKhj8Mui8QkVCT8N5vx4j58dq0xVZF5j/JJq8vKtpCy14gPo9SvFST8F2f91tyPyPf Yqo6x1j8mjqMMf8Ah6wtQWFsl+ZNJ+rqsitQlkui3xLXbhyNdgRvir0vQdE0DSbL09DtLe0s7gia lqqrG5ZQA/w7Gqgb4qmOKuxV2KuxV2KuxV2KuxV2KuxVbL/dt8sVeP6wdDh1+6F3qthCy3Ujzwy+ YLi3ZVaUNR7cjiNuq9B9nplRM75ByRHDXOV+4frQGg23lGaaVdX1+xig4FUksvMV1LJ6jOAGKu8f 81OW/h0wwM79VLmGGvQZE+YH62VWC/l0bu0isvNLSys6C0tE1yaYSMCVRVjM7899qU375Y4yj+ZW l+Yr7WLRdPgvJ7UWqg/VWdFWVpGUNUajpwLUI2CVp+1Q0CrFo/LnnURtG2l6kxB58WluDGjElfjV tcPIBaEUPvXqMVUW8s+e41lLaZqJBBHqK83MbEuC/wCnD8BZhX4vi470oMVWjyr+YXoqn1DUhMyI eUckxB5nk3Jjra7/ALNafZGKs18t/ljdyRrda1qV4PVRZI4Le71G3miZqMyScr67Sq7g8W+nFWba HoFnpCSLbXF3cCSgY3l3cXdOJY/D67ycftb8eu1emKpnirsVdirGb38vNBu7u5upJtQSa6kMsvp6 hdotTWoVBJxVd+gG3bFUO35X+XmABu9VPFuSV1O9bi1QarylO+3XqOo3ocVQV7+XGjWZWa3/AE3d yOaOYdWuldeI+EkvOlafZG+VZcko8omXur9LbjgJcyIoKDyJpvoQQHTNbjhgVmUDU3U8+PSqThmJ HwjkaAdKVOUjUT/1OX2frbTgh/Pj9v6l0PkjThciR9M11SoZA36VkIZCOhpcg7mh+eI1E+uOX+x/ WpwQ/nx/2X6lkfkKygZDHYa5KCFHJ9WkVgrAckbjPutUqRUjfE6jJ0xn5j9ajDD+ePkf1J4Pyy8u 7lrnU3Y8RybUrw7IVKinqcfh4+HzzLcVEWH5faFY3sN5FPfyPCQVinvrqaEkLxq0UkjI30jrvirJ QABQbAdBirzvSvPWv3PnJtLlhQWvqyR+mEmDqqLGVYs0YjoTIf2vDc98ISkIRycRJlw7emtz9I63 H8eU/wCIxr73omZrB2KuxV2KuxV2KuxV2KuxVbL/AHbfLFXzt+ZeoXFv5/1Sl1dL6bW7xRx65ZWU akW8Rp9WnBdeRJ5V2brTfZVJNN0vzpqKzHSrbXL17aQpO8XmC1l4UqnA0h/aNagjoMVegeTvIPnG y1/TNQvpboWMTSTSRy6s05BkTZZITaQqwBpRQRQ1NemKoz837M3GoWYltnuLcWtUCWwuB6wdgtT+ jtQZaB+vMf6u9cVYCdPtwVhfTkR0/eShNPUgxuVp8H+HyKlkrvTpT5Kqb6eHijs20p55D8cJexYy ha1dUH6CIoXNSaH6MUqx0uc6dEj6bSGILFApshzMkxYsqodDPJ2Kcdv2dyN64qr6J5fsHv4tOv8A TVWB5f3kqae0vEepycRh9GiX41otefSlCMVe96H5X8t6CJl0bTrfT/rNDP8AV0VC/Anjyp148zTw rihNMVdirsVea3v57+WbPV59LmtHE9vctayN9f0YDksnpk8GvlkH+qU5DuMVVrP88PKV3qem6baq bifUWiiQx32juUeYqoV1W+5lgzUKxq1f2a7YqjNe/NSHR9Uu7B/LWu3qWsqwLeWVmJYZXaJZPgLS I3EFwhYgLy70qQqlNr+eFmZFtx5P81+tJydVm00K3IuapVpQvwg1G/TbrtkIR4RVk7nn5m/s6eSS bZLd+fPQ8rWnmKHQNXvILqP1HsILdDewH+WW3eRH5cvh+Dlvv9nfJoYbafnfYi/vro+WvOTq8cbL YSaZGY0IIT9yEbmpb4mPN6bGm9BgAHPr7z910PgAu7Np/PNlZ+Vx5g1azm0aIuI1s9TltLWYktQf E8/oglasAZK0GFWIxf8AOQXlF5JZuEnoenWOM3uiVqhJdgF1AyfErA0Zei+OKs48oebdN806QNTs KLHzaN4vWtrhlZT3e0luYt+v28VTcW1usplWJBKesgUct/frlYxQEuIAcXfSeI1SpliHYq7FXYq7 FXYq7FXYq7FVsv8Adt8sVeC+f/OnmPSvOt/pttcc7UtGwU3mjxMoMCymsdxbSSoE3p6jbj54qk9t 5982RxqlreOszsqLFHqOhJ8ShCVoLQuWRmoV4dO/UYpZ35Fn/NO48xI+vW13b6Sscvq/W57IqSd0 VI7e2jdmVtqlwCN/8nFC781/J3l3WdXsr3VtX0vS2S2jt1OotMHYGV2ovC6tUCsOQrTkd96dFWDP +Wn5d8OP+KPKxKVqzXFz4k0AGojam3fFV8X5afl8ssjJ5k8qspoeDTXLKhHxbH9I/wCSevauKsh0 zyR+SCGVtY1bRLmT009MW968KLEE4JyWW7n5NxYUbr9+KpppXlL/AJx4sZWuorvSLqkRiYXV/Fco FO9eMsjgMFWgPUDFWZ+VdN/L2K7urryvDpwuwqpeS2PpGQLL+8USFCSA9OQr1xVkuKuxV2Kvn7zz +TXnAarNq8M9rrIu5rmeS3g0DSZHi5u8gDNPJBJIT6m27Fn3brXFUV5Q/Kvz5ca7Br15dWulzWdw kkttd6HpiyTFWVi6SWskpQtxG6ykgjY/sqqlP5t6fdP55vbvT9Ov79J0WO8kHlmyvoxKf3SL9ZuP QeVU9BCgYMDsOdGWirCotC1uSX6uNM1SNrhVVoz5M0hSSxXgzO0ijhzNWHam9OuBXvUnkHT/ADX5 B0i0tbmWzksoJYbSe/0mzWVamnpy2VzbKkaLLEh4xonIIKN0bCrER/zjn5iMdvbyeY9KNpASxjXy 5pwLM5Xm3xB1DMqqvKn7IqMVTP8AMHyBbaL5DsdF0lJZEbUDLJJBoulX0ZmlBUTXFoYYY14xj01k jAI/aNMVeRXOj30byqmnX8Ng6mS2lbyVp8nMRuVVmAcUkorD41UU3oKjAr2z8hIryPTdU+s2t5aP 6kQaO50i20WMkIaenFDydyikRszsR8I49ySr1TFXYq7FXYq7FXYq7FXYq7FXYqtl/u2+WKvBvP8A r2v2vm/VYLXzAttHamIR20lvo5ZRJAsm0lzPFMQodqckHzpyfFVFPzU1VbVLoS6LJcrSOMPHYpLT iDVqarQKdulOlKDqFWf+QfPp1+4uLC5kgnvYTK6TWjW4iMMZiWvGO7vHarS/b2HYhT1VSf8ANu11 CbWLE29zqUUIs/3keny3kKgiQ/GTbWV6pcbUq6nan7WKsDfSdcMjn9Ia+sjuBI31rVpG4LUFEppX UtQKelAfs1GKWQJ+V/nu4t4ZbO+1F7KUCW1Da1JbMqFRxDRtY8hyXieLCq7g+JUNx/lH5+iuophd XzBGBp+n5AF5fap/oXKgqejV964quk/KHz5G8ixX+oTAArFI+uuAVIpQp9SPHqT9o9sVet+VdCGi 6PDbNJLLcskTXck873DGZYUjejyb0/d12AFamm+KpxirsVdiqyaURxyOFMjRqW9NSoY0FaDkVXf3 IGAlIFleCD0NcKEFq2kaNqsCW+q2kF5DHIs8cVwiuqyJ9mRQ1aMvLY9sVY/5T8qeR2W08waf5Zj0 jUET0oTcWqQXkKwq1uoI+Ir+72G+6kZKceE1dsYysWywuobiSOXhXfIskm0jzHNf6tf2EunT2cdo xW3upQwjnCuyFkJUCnwgrua/Rk5RoA2gFM760sr2yntb6KO4sp0aO5hlAaN42FHVw2xBHWuQSwmb yN+W0OvW2ir5L094byF52ulsojCrR1Chvg41oW3rtUfzZIR2tF7s2sLGysLOGzsYI7azgUJBBEoR EUdAqjYDIpV8VdirsVdirsVdirsVdirsVdiq2X+7b5Yq8K89X7ReebqFPL6Xtwrw1vxosl0HkeNf SVpheQh+KELuvUfcqvsfzH1mDU4WvPL15LDyM91bWWgskzNJUAmR7x+D86A/CenXFWVaP+a2j3t9 HCfL2taf6zen9auNPb06qaAEwmV+p/loO5xVV/MfW/0bf6cx1TUdMUR7vZz6ZHA5cttIl/JG1QqM eQBA+eKsUsvPWmR6lDPP5l1q4ZJYZDbSX2gpFNxqeHGOdKJJ8IPSte1SQqytvzx8rqATbSgsRwBv dHFQWKlgfr9KArTFVQfnZ5WLORBKYIhH6lx9Z0wIvqkca1vK9yem9Nq4q1b/AJ1+W7iaOGK1lkkk kSFVjvNJcmST7KgLe1ap2+GuKs5028lvLGK5ltJrGSQVa1uOHqpQkUb02kT32Y4qicVdirsVeBed /wAuvOuo+cdU1aK3kvFlm9S1lXQ9BnIjj+COP17q4juHZFVaM3H4RQGtKKoXyD+XH5h6R500y99H 6naRyqZ7kaJodoDASTNE8trO1whZfgqiN8XfjRsVRn5y6xFqGttpN9qGkW8ulzTCH65baPcSpDcQ W5UenqF8rg/vDJyCJXhTi3w8lWFeW79dJvrS9/SWjxGzluJrWOWx8tJGLgIjbSQalHLGaqqfC3I/ tMAfhCvZfNnkHUfP2ieXNSFzp1hqawRT3l3PpVteyMsiK4ii9aS5SJQzMSA770o1OpVjE/8Azjz5 kaC1ig8x6XELWrKW8vacxEjBeRQhV4gsvIACoPc9lXog8gE+S7HyvFqA023ggMN8NPs7NYLkuP31 be5huYkSR2ZyqjqeuKsFl/5x+1J9Vu501nTFsLkyD6u2gaa8pR5Of7yTgoZl24njTkFJBoQyr0vy j5Wby3p409NRmvbONQttBJDaQJCOTM3BbSG3X4i/cdvniqe4q7FXYq7FXYq7FXYq7FXYq7FVsv8A dt8sVeFeeL+5j856nA3liHUwWiRr06E10JU9FJUje4+uRBytAPsjcU6Yqluh+d9T0maU6d5XOnzy oE9S28vtb7hgeMrG/UcNiTuPnirLvK/5meYr7W7Oz1DTbs2105g9SPSJ7dUYfD6kk73UyBC4P2VO w3xVOPzU0vzDqUGnQ6VFcXKqJWkgtvVWhCgBpGjvrDrWiD4t64qwO28p+eXnFq9tqaJK0aQyO11w hANKnhrLsEUV5e/SuwKlk3/KoPMbInqa5CSp5S1k1gqKEMKD9IjpStdvoxQqSflT5qKJGNagAccZ uUurtUciwp/uQFaD4ex6702xVSf8oPM7tI769E1aMAZNVARgASQBfjatSB2rir1W0tktbWG2R5JE hRY1eZ2lkYKKVeRyzMx7kmpxVVxV2KuxV59qH5la1balf2kOipcJZySxpJ/uSUvwkMcdKae6MWbr wdlHXkRiqBP5ueYRIVby1QKfiNdUNFpXl/xzASKVI4g/KlTiqWax5vt9fAi1zyXZagsUlIPrEWo3 FH+FW4q2l1Y8W/Z608MVQdnrei6XdRajZ/lzY213yMsNzDb6isgkII5l/wBEqQeLN4nfwNcVZBH+ beuFo0PlwRhiAd9VIVSNif8AcWABuO+Krrf82PMU/phfLYUSSmDmW1WgkU0ZT/uLFN9tyPwOKqcf 5t+Yn9Qjy4OEbcOY/S5B+EEmi6USB8VfiA6HFV8f5u6yyxM3l8ASEbj9KkEGtCK6WB1B6n33xV6T bySSW8UkienI6KzoKniSKkfEEO3uo+WKqmKuxV2KuxV2KuxV2KuxV2KuxVbL/dt8sVeU+bfyhbXv MWo6wrWMUl4IhG8iXjyViiRA0gS5jiYgp8PweHU74qlI/IRUkLxDSgeJVmeG/cvyXixYfXQN+tDX feuKsk8k/lJofl3UE1V7a2GqwErb3Fl9aiT02j9Mh457i5BY1O/8cVQ/5xaMtydLuobb17tleElb YXDCMEHqun6m9KydDxHhU1xV5xNojVIudPkMk/JJCNPp9lFdRT9BCoBHXf4d1BxSq6b5W1HX7ldO s9LjDIpeNZII7VVjR+TJ6kuhxIV9R68WPXFWQ/8AKoPM/pNw0+1Wdi3qB5NMKkEHfl+imblU03HT v8RAUJlo35Y61YmSW98t6TqhWMC2t5p7SNVYMWqrW+lW7hgNvtUJ3+Sr1TRYZYNIs4JbSKweGJI/ qVu/qQxKg4qiOUiqqqBT4RiqNxV2KvPPzo/MPWvI+iWF/pMFtPNdXJgkW6WR1C+mz1AjeI1qvjir yTy95nvfNrXmof4e8tR3klxxuZJNM1GV5JZzzUl7Vp25yNyI7/CTirIYND1b0hLbaB5XZ53UD09F 1owkL8SEOEI5VJqAvbc9sVRWk/440W5lu9G0Hy7aXCKsHr2mi62jPHIVY/EsVSo2J77bA7VVTqLz h+cTqoeHSIZmUsYX0vXiaClacUatC1D7+IocVdL5x/OCPjWPR6NL6PL9Ga5QvQn4RwLMPhpsOvag 5Yq2nm7842j+KHR45wzh4W0zXCQisVV6ojij0qK9vpoq3P5x/NmLiC2ihqqsgfTNeXi0jcIxTgW/ eNsppuagdMVWv5u/OdbeKY2mlqWSR5o20zWapwYBRVeQPNGVh07g04nFWBax/wA5I/mFpmq3mnPZ 6TI9nNJA7i3vI6tGxVvgknR13HRgDir6WxV2KuxV2KuxV2KuxV2KuxV2KrZf7tvlirFtb856Zo+p w2F1HKzzehWRApUG5laGIUJDMSyGoUGgzFzargmI0Tbl4NHLJAyBG1/YLKxPPmgtcLbkXaSMQFDW lwK8jGB+xXf1lI9qntmU4lIjSPN2jatdC1tDOJTGZR60EsIKhY26yKu9Jl2+fgcVYh+b1zfWN5pt 2l/JY2kkJhYLdtaK78wT01HTq0U9kc/wVYbo/mm1EwGqazfT2kjtwW11ZYJmdRRR6kmt3AAPICgH z7EKp5/jfyPQ8ZNef1mop/T0A+Nlp8J/SVAfjoBXfqAaVCq3/GXkRmkWKfW/SZCqufMUTcmZqhVA 1J2UtQAE098VVIPNnkaeVFgk164ldkiihXX7di1GCxlUOpjlzb4dh1qD1xV6R5Mg4WVw5stUsXeU 8odXujdyHavKMme5Cr8VKAjcdO+KshxV2KvJ/wDnIrQLzWfLWmQ2rxo0V7zYylgKGJxtxVsxdVq4 4ADK9+5ydNpZZiRGtu945oH5e+YrMyK9hp2rC5Efp28812GRmLLG6x2zwtVjUAsD7ZijtWBAIjOi aGw5/Nu/IHiMeKFj3/qZAnk3zPG0MR8laazKvpxxu2ssDs1fhM1PE5P+URdcGT/S/tT+QNXx4/8A Tfsai8k+bopZC/k7TZImqViddU+AKQTxdXV6KfEnH+UR/qeT/S/tR+R/p4/9N+xuPyT5qWWreStN aVCHJ/3LghSxZV4iTjxoOPT6a4/yh/teT/S/tX8j/Tx/6b9ixvJPmv0XT/COniRldi7jU6LRql1X koDAkA/s9Ph8X+UR/Myf6X9qfyB/n4/9N+xseRvNgmEn+DdP/vSTETq5BBiK+nQyE0/3ZXrXvTbH +UP9ryf6X9qPyP8ATx/6b9im/kTza4m9PylYAu7SLIx1V3USE8BUvRuJ3XkDuO4qMf5RH8zJ/pf2 r+QP8/H/AKb9iKTyT5sDs3+CNP4uasg/TKig4mgAlC/aWu4OH8//ALXk/wBL+1fyP9PH/pv2MGu/ yr8z20vC6MEEjDkEkMqmhPUco60ymfbGOJoxmPgP1tkeyskhYlE/E/qfaGbZ1jsVdirsVdirsVdi rsVdirsVWy/3bfLFUtnsLG4mhnntopprc8oJZEVnjbxRiKqflgMQeYZxySAIBNFEYWDWKpN5t8k2 3meOw9a6Nq1izSROkFrM/JgtKG5im4gcd+NK98VY1/yovQvUFLwCLiysv6O0syHlWhMhtSa0b6ds Vbj/ACN0RFh5XaO0anly03S+LOTUvx+rbbUFPbxxVkP/ACqz8uPT9P8Aw3p/GrGvoJy+I1PxUr8v DtiqO0jyR5Q0e5N1pej2lncMOJlhiVWpUHqB4jFU7xV2KuxVg35t/wDHFs/+Yn/mW2aXtz+7j/W/ Q7fsb+8PueZwXzxuhZEkVSvMEcS6IahGdOL0+RznxqJ8IiTcAbro7o6WHEZgVI9UaNeXmjGzQ8Fo V9a6oxpTkf3ta/IjJfmP6P2y/Wv5fz+yP6lg1e2KFXsEdiSTI0txy3FB0kpt16dfbbB4wr6R85fr T4J/nfYP1NxavZpXlpsUvIUbnLc12/1ZVxjmiP4QfjL9anDI/wARHwj+po6tZl+X6LgFGDD95ddA AONfW6d/H3x8aP8AMHzl/wAUvgy/nH5R/UqNrVkXDfomDYEcfVu6E1BBP76u1Ml48b+iPzl/xSPA l/PPyj/xKkdWtyEAsUHAEGktxvVQB/uzahq30+GR8UfzR8z+tl4J/nfYP1Kj61ZOPi0uINyUkia6 oVUU4nlK22SOeJ/gHzl+tiMEh/EflH9SAuriOZlMcKwhRSis7V/4MtlEpA8hTdCJHM2+h8754h2K uxV2KuxV2KuxV2KuxV2KuNKb9MVa+D2xV3we2Ku/d+2Ktj2xV2KuxV2KuxV2KuxV2KqF39R4L9c9 LhX4fW40r7csrycFeqvizhxfw38EL/zrn/Ln/wAksq/c/wBH7Gz97/S+13/Ouf8ALn/ySx/c/wBH 7F/e/wBL7Xf865/y5/8AJLH9z/R+xf3v9L7Xf865/wAuf/JLH9z/AEfsX97/AEvtd/zrn/Ln/wAk sf3P9H7F/e/0vtd/zrn/AC5/8ksf3P8AR+xf3v8AS+13/Ouf8uf/ACSx/c/0fsX97/S+13/Ouf8A Ln/ySx/c/wBH7F/e/wBL7Xf865/y5/8AJLH9z/R+xf3v9L7X/9k= uuid:ed7c2957-4f3e-9e48-836e-195f31263bf0 xmp.did:c0f683fe-9eb6-47d2-a128-55ee6126230a uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:7bed989a-3a21-1c4d-bfbb-8d21100be145 xmp.did:c1961211-5580-47b9-8362-4f0141b8fad7 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:ab17be08-b65f-453f-ae7f-4fe23b51a1d3 2019-02-13T16:27:05-03:00 Adobe Illustrator CC 23.0 (Macintosh) / saved xmp.iid:c0f683fe-9eb6-47d2-a128-55ee6126230a 2019-09-23T10:55:06-03:00 Adobe Illustrator CC 23.0 (Macintosh) / EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/postgreSQL.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/best-tool.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/optimize.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/labeling.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/point-in-time.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/historical.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/postgreSQL.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/best-tool.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/optimize.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/labeling.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/point-in-time.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/historical.png 0 0 Print False True 1 215.900000 279.400000 Millimeters Chivo-Bold Chivo Bold Open Type Version 1.007 False Chivo-Bold.ttf Chivo-Light Chivo Light Open Type Version 1.007 False Chivo-Light.ttf Chivo-Regular Chivo Regular Open Type Version 1.007 False Chivo-Regular.ttf Chivo-BoldItalic Chivo Bold Italic Open Type Version 1.007 False Chivo-BoldItalic.ttf Chivo-Italic Chivo Italic Open Type Version 1.007 False Chivo-Italic.ttf Chivo-Black Chivo Black Open Type Version 1.007 False Chivo-Black.ttf Cyan Magenta Yellow Black Grupo de muestras por defecto 0 Blanco CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Negro CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 Rojo CMYK CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 Amarillo CMYK CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 Verde CMYK CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 Cian CMYK CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 Azul CMYK CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 Magenta CMYK CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 P Charcoal CMYK PROCESS 100.000000 CMYK 65.792322 56.157774 58.059049 62.648964 P Citron CMYK PROCESS 100.000000 CMYK 13.846035 14.843976 94.692910 0.973526 P Cardinal CMYK PROCESS 100.000000 CMYK 24.188600 100.000000 95.858699 21.084915 P Charcoal CMYK 2 PROCESS 100.000000 CMYK 65.493244 58.352023 54.680699 61.406881 P Citron CMYK 3 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=22 M=93 Y=100 K=16 PROCESS 100.000000 CMYK 21.960784 92.549020 100.000000 16.078432 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 Grises 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brillantes 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Grupo de colores 1 1 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=9 M=11 Y=62 K=0 CMYK PROCESS 8.984375 11.328125 61.718750 0.000000 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 C=85 M=88 Y=0 K=0 CMYK PROCESS 84.765625 87.890625 0.390625 0.390625 C=61 M=83 Y=1 K=0 CMYK PROCESS 61.328125 82.812500 1.171875 0.000000 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 C=66 M=57 Y=54 K=59 CMYK PROCESS 66.406250 56.640625 53.906250 59.375000 C=40 M=32 Y=32 K=11 CMYK PROCESS 39.843750 31.640625 31.640625 10.546875 C=18 M=13 Y=14 K=0 CMYK PROCESS 17.578125 12.500000 13.671875 0.000000 Grupo de colores 2 1 C=8 M=96 Y=91 K=2 CMYK PROCESS 8.203125 96.484375 91.015625 1.562500 P Charcoal CMYK PROCESS 100.000000 CMYK 65.792322 56.157774 58.059049 62.648964 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 5 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 7 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC/ImageI]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 27 0 obj <>stream HWmo_^,aKNg4A܇^q#Do줾_ߙy\JEKg<0gycqTm eq]8S78+JkǮlL1n[Nfʼ 0eƚjRX4;cs!#-K&S5l;,ǵT7&}b ~\=УY_y5Wf\<$I*v2OƴKİlGzYo~gb9c-jOv1g+ښA ?w?rzkw8%¢OZ6ZGvfe|M[W M=E yfؚ>͊^!59Q2x %X?tgMs]|E|f{̊=7""{Ӳ%۟'ls. I-[fqbml FT@ ڟ+*q2/ L_nofRrNOKC1ҚSghLh{r> )Aň8It%rL&mHQ R}v .=$3m$_hab8'pOĿ;uW?(wJN/g7py+V'_a x/5zz4ugYꪞ/?iolŮ H1g( e[0)HO}4 aa>j܇lMu3%G+ ABӎ%`o~>ygWEZ<-˖C$gBY_snA(ol{6ETZ^慺٠(CtM>o{>ûhKiS[ gmA;_iBmUK6xHxͶf[f7 Q;o4վ;:!E"MÒX(+cO4&Bámp g=aIF|YaKU[FͿV~  n4?"ĬD$+Lb+Q<;2Q^i2ߣWt Rc&P4 L;zM<JjF4xv)"3 }4T$T:KC+x~~5S| #_ǒ67i:b"U&*ϊH+,Z6B)!(K}1z<ZD\iGL?IA㨆%ڸw޻ Z-hB䓈Jrٟe{~\4})[-,i1#jdZ.Lnj^ޓtukrHQ/c@ 8zϖLFAo`ϭ';5U?YL9٤vn"*;Փ6{>|Lyh%<`OɌ- }>ycr#3i<>- <:RX􋒅y}ubh_ՅtMDQj9 5/SsAREHqޗ^_H[tn>*|*^A*6NEKnC3I-Yq4kj).BS/|T>NUy_EM:<_ԕ>)Pd2PWpH`/>h ʪy|m Pۘ:ӸqV؏VɌћ q %GAU% l+R‵|fzG$u/ trjīFq_3*W)K^&4/Ұ=\Jk>V*rdƏT3.R9֌5eyG-IO!ŔR莅84?l9mEJvAk+Ǯ{=F{0(iC8RH;P )SAw5P `u"YqJęc[=}oHw `bz~o[h {,zPk9%9{e$]aUMaks'8)̧UpB{3uYV"͸,kN2^뛎.9NNͲ,hjk;WbոU+E'9N';.1ivbg3L+N!n- \h F.愈j$ ٣-LuɳD4fhOkY[Wl;*66,H`Xl2 r/+kMm4Cv2ý\^K @&C{_k9,և(]b=X**P_)Wˎ,GWԒV;6+^=qNVUwXd[b]Q"e燳Usk&=w4U\c ;_u7 \hw/IWSd+B/ҙ׎H"gKӳ0x%\t-qe]fVd̟E" YX<:8EhIkY%!?OybԂ/-Da}]rV䕫Xte׹)~QCyRTFmœE`V<kpe*ҋ:lclbMi~GZZd` %WZ}z~Yw!IT Tt\@ӴH\t)f-s])[T?Tھ]r.I>NZW||%1I|%->w/ 6F;T(gMkk SWu;0!os9F]SUIx-L]2s嵲}ۿkɃݼ~]ع8WyxEy]e!ndBy?O [9j0m@t{|>%'ߖHxKT+TR*mޞ :cRZgH!%!8E'^<}zbR1z^*`+5}a7D\z(aØ(Iee2}ڼM y'lYf!,k<;T:=DZȂr'[kmax9Mvl0| sBgTi2хs(WFrbDg 3Ӛh7͌42T t ~>/FCdTXC%)Q*#f:ߡ -+ a(NbܓZBCy{Bj|q(8Lrͣ%9xQ1pKwҏ8g)g@|MI=[(j-@vĶ&#@BQ/Ejk GW4+ǂB(H2Z ٙe '` 6o``iw}%d6vZjQ32bO겵I~GW1\0y`rgaX;KI$@Vyȟo( w{/0ǁi\8<4xw%&xF)j&1Fs[ ZĽg 7I͜DU- %w“3\fّэ /߰ j~&1D @1|0$1d8_FEeSQT>MV5M4DSDSqjʷiU9"H-|˜Y"BJ(H|:3Z82lJԦ7D@*Nv>'Y|9踶6R,vH} ʬ05 7˞y}xs+"\yO1 vIb4e)"}1'ɑ5;G~"#6ApdBQ݉xW5l4 -Lda xZRBu*뀁0w6zQ< DwS)U UYJIb]%k)]_yWF3 ZT|pYU4M`b5.u᭤ݯJ_OTp^1HQA$A'~ǩL8M.u($M&t)Uyg+jtpN4իl[&Pl߹E) 2.D 6/նMPHh<9 Ԡ Q zLo3x0.RʹQ vYNs>=l e2EN/政%F ="oQe*L$G:Eѯƿ#e6ZY^G]֒~S0 %dZǍh.Cz^˻%viB-Z?+ (z.- GH` ]*l7M):\샵FSzzp46`8YslЄ]=&{S"|5D^5DVNZO1rbvybcc 3)S$[+,% %Q=;5ThӣT/*lNck&Xv$7yv" %jPbQw~QXf>\Hx@e J^T1 Ғ6!Eà,%!C@?,JMu4B AR= [YWyX.A}®K΢21_9d=B4!Eo򄃘O3FoWy[v{-teKWbq:eh#q,[x;xӞX\ze_U򗢟W^p4:kXQL&'Fj 5~.1&t m?YALz2 ]gB&B݅gzL韺PۿB!|gkN!g}ߡooNmm}7IݞŭHq+&oխ}X!1`wjDJEwqp~C8#㓱X<kq]Vl(4*v9)ĿmGD-^+^ .uCڒWĘ enA ֪tJsCŐ$GދW~C= ^>jDl>>jRZ]Ȃy9AuIV nZhS!PA T-~MVq3OzFG g`q`&^9n gE Gi_}яۋsbk7 Za $҂NTy!Ɋ$Bw_b]qNjh?;aSݏ@kL k KIh+Ic^5;Hݲ5\{LPiS4>}rԶl\GRi⼉)IUYJv\wZ6AB6)sEGf.qjbriv.)shdkٌ{8 .4A|JdSUH՞̗a{08KqlbLw(lQlQϹV><4*6ϯnLRCt[׾Q_qp38XТY%-' C W4"~kijC+|+f©hvOR<L _Qkws{6Cɹkz2Gn é!dq{!߶r{܎ǰ\8o'h,lNqyVPvŴ`7dk]tEfd,fy q4e7=oGs9?Bh6[N*[MèZA;_+ ۻ6%,ݬ1r4#M-1+46Χ1LjX-7'*j5VQp /A6\ozqGz,pR!~ O_X:>t}>&!$Oߡ?7.d"R*D{ 2_6㳧xyɠKN1ry8Z뽿v?>t~sESD1Eu4~[tA~?;}ӏg&=ɋx1jCUDfk _Q*iZΉLߦm)RYAůP)Rzl%Xw/I5*D;y=} r7sH_M-[UW' TiMzC+0W=-N#Ph;Xη2Ȉ!T_Ƣ‘S,0E Dz<$g=gONH Í՗G3)ks^BfANN"nl$@sn7zrdKbd&/V!aU 9hEoIkƏLS;eȱ ߱swT5yo[UԣFFPZXhZb04 =3H- [L z^nh:!EGBى C*vi.Ncؐ RbZm*^^ (vh귕YTa5;\J) 1Ht+LWODU-tNm$dp `f?(K\hʆ)Xl0 F֡%4/ř5.[e`e5B1UNDUI" #*6Xsw  Ө#;W*꥛qTNSX Z%ADKh/$ouBmoavsDq[# ]5}Mk^.٤ z=4ڃ3ŏRl7:P=/{.Oyⳙ7p#W` |@]%lFQbqqM܄fCv{XWèk-H%iKLWf+3'gdEi8xg8}?:QU}@3zxG;ϓLm3EVYAGA@Rk<%>mxSbhy3GRTGĩhgo>?:?'D6 m$o8b P'8"r2;*%N}|SMٔX)JgE+>aYi P:V`3PГӖ(LM]s'|ln9# ת۸y}E6I}C ?Ր[XT%Q{!$N5GbjIev qI쥹DkAҙvCc1v2t)gJ6z ugn^bS<҃ZePiY')n6]!ha4fSZe#3ꈱo7 }F6uTuH19kJ$`R ۜmJX!I P;Zt?K4DN̚LA tGۼrĘinv)[- A|dut݈%e0S:RYYjXGK1;Ȱ0݊eV1}E{fo 7q&7ݙr<%o5S8^%f=,\Qp]eM=$M#G*\b)a[h4 t/޵ݧlawwUƒ l'ݽs\B+ ZP5O[L,sCV\T"'l‚sm4.4_А5?n-[[Qeר I 瓹?tƄ,]j*R=[jr&F:{0RlS1Mo^ rDxR@-Qt%'DnIQIĮ_a<A/SPtPLeH rysХKA1n=b's* +E6m Q!=Mg Q-T 1=cow؋o%  ttNG(% h`Л"p%hFٓgQҎQ8ףQ񱥽]~_eԓ{$//G8^Mj:^UONj*X\S[VǷ5Ԍ,߭kLjM.Ue-KЧZW>]~wS罾+1ղ쒝.[n2nggծ:fǾ>܋/#W%,bA7EqrjV#wר15K#0ЪIUsW)xL]GXڈXLT/;xHki|,FG%`TTp Wޜ('hC1aYqaeܫE{8NJ< :Yy\%Q7{[e(-7|QÅPpy# /c^ 18shrJqXx`~bЊzyv_/quIl-jZ}XtbTIpMq/{tC=Kz%{m-Y,r6e΍tR $\_D &JO=P[nmv]~ n=3ρ]pX1s@9j =BƚY3Iv&7t'՗m;9Bi9A#{]l8PؿbK3#,7T"l}z>0R ~uutKfbz73e, ̣F<ڑslq*D%V7R>UlHdRȗz&j(U쀺3Ƶ' <>.)Z~ì78Ax'[i@[^A틮{ )~Z `;s`b&V{Կ^65˝v'~_m /J,Ii#IONM(X*ؓJbGa|_X~32/r[ώ{_ltT '/pRޕE!˒V&W7Le[$ 52`Б1R "^Y1f){){N=Iu'(Xmԫ̚{8]\% 9ׂ3^ȇI{pp*7\FŢ Qd;}\]D'\WtNj"2e[]1UM]t9^-e7U~gћth)<^//:ӢA琅G!9"Y鳏faN9WdJc(4#=u#mƱym{=%tS4d嬿I,?葇#%K\^C6o.^"\1 @Y*{騀Vі)cCӛG> |d&65""h[;ŮFQsA8pɑ5NC3FA?A!ب8M sbaԠ5J<' xE8-ßh>UțW'՟Nb9ߥ 5ܠ]&R V5!Y#ťvն=2ܗ sf1S>ׅ)s/Uډ֦ (Rz ^3c@nfhXlZ>BCP%823r{#AVG]M^SM +/=IcQyiʘ{h Vu}͇aO~z7Q5+悺U;$1Ӊ_ޜ620Dv6)ӜNNw?p;LBKN jPd'0CwQ"saӨ ۾ ynqyۑяt;HU!J{׎]G?|޶Շף(&x(B}N )΍?(mH/KZ%Dřq e_cl0^kbԭPp+tL ̔UdM5?O`$P"hԜTr ^;(ͻj*z[ ,b<6T9F[*WuQ %ig\'{+<oT$ܸ6յ? !߁Nth5I7q^ey.'4 D'!l;ϖy'|o{;-!1xH'~RM2w"? +ǁzAk;7y_P4q5jh(ߤH;#8;VVEmgH C_ )̞/Q\?^6qFϯHeY 9,rZZKH~}G4nb[O}~"-4Z~E Gy6ɮrxN{z^/\w9KӟO_ RbS4l$Ϸ))^͔EٴZH%4B,sU$KVv:0 xL%g.H7We U[RwЪ|F>"23Rv^6o,Hyׯ.HS ++#W狁tbc r.y(f=:ekY 2Pr#Uz|lց!: )S$mpyLe{"Ta+AU Yu$"pFJ[6m| Z>-JK"sTR4w-Pd'${SQRf(]C[crLaB]s/w*H&W~ڱj%MW;OjL*]v4!v,+j޺WQ/*|'Fa#)$)}G/5 4zJ[$vuI1jEAVp4I VUX -|ILwYhpݩ-E ^m|\J`!5/VX7X`ϬGq[±ʴl6]7QX ϥ2'j %DzN er/{"VS]#5$N{ZֈCzkAz JiXvy5mmk+_Vgec:[xu0%S3"j{b">Kx^m`̲k6ob$<*te[5L}K\(OEO7mmWxkZ; EIV|8'&+m^Tl='Z| 0lO܋ ]El^H߶cfzFqT~e8n+& l{Dg"]硫DO @͓*4˝.4Cas#<~]U]*aZHҚ 5}oH<]?tJI$*`<ڊ1!XѬ?J1ZWSk; 2Nl=p:&m#(Ca熮e\[JjW{MEKhr'pPJ~)Xco y 0P!6&MjEvXcM Ɂ=KXkҼVdȻiq 2lOrtgt_oj߈jtUoת&:VoA'74ĨߙיTsw*d=x4[/UQrq2%ȓ gU|{d[=0lfb3H&pрhy`.Eܡ/L2l >'RC&NC2: (!a$d}!)st -Rb+6*yr;z-؝Qp.I/4sgC8]){j=P<-kK[^aqoajCv-]/XI"3Z6lܮQӳ+mP|6|Zlqn|LaL`)C~QXmȢ:xգѸJ1" T dRTN~~2 2E~WŒ$eΰV~'>Bિ6jGl[uI-;f^;ۜNg5+5>P]gw)w Y߅흚_%Zj@D|YɧH D?LDƘJ#1LJ`̠2N?ͼ}闙~:ӑnp7te$84*7T-׶lg7#3'=+fܑ|9S!_bg(Nj ck̞ye!?ҿTh%n"CGM c&ڙ4Y0L:}dXqw8J]0u~wD Z0Kb~%YcKWn$EW;$4=,8 B hyh#vUwWV>"3#J8 ze_(9^BTҁTGT5$dC%D3NC$y}"W)a;w=#ϣz=_@Gamhe0,A<(T >l)ZG-oxKje ?S(]"M"?"zʓ+؀/Drcyr2U'l˪?BsT@$PI>ډ^ ;(mMG7alΐ9} '6^PuUHA|9s^T 2{kfv .j⭚tGjp_:yJb.H}Uw \E4n׾/:R@M/߯d4d@* 4`V=U/T!@k) ',@`l.rQA#AgقqT`2VAj3k-["7xh_~i.}텪}`MUWVt`h}Hx,-]D|Ja*E %o,Uhqu` 7D,=^2VYqTN4hIP*' σ@LXUT^jTSQ@MR*;eD5դ4}=9UJݽ"U3 rGЌL2wN @GCRP-M(ͼi=0Gϣ^%6Sm^:+UW3Hb;VMCJk0µq`I 4:a_Tx{ Җ)ЅzĞcp&W1kKkѸI\tUR-z}&\Yt $׶0fem"rfYJƂkl t,oFu(Kx# 2L>%YbN'~L;Yيf\hd{tIvӷyTIOk5ۤ{P3dm86.K}Shh-$6r˲CoGoL($S.80Pׁ* 쀛B:k1uxzPhqIfެ[UZܪRMCK ^P^{'(; Ԑ $G9f)?"1"EP-F!m1z1ƤcmGn]uUDr> endobj 35 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs -4.116 788.17 616.116 -80.306 re f endstream endobj 36 0 obj <>/XObject<>>>/Subtype/Form>>stream q 611.622 707.864 -615.738 92.128 re W n q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS0 gs 0 TL/Fm0 Do Q q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS1 gs 0 TL/Fm1 Do Q Q endstream endobj 37 0 obj <>>>/Subtype/Form>>stream 0 0.91 1 0.55 k /GS0 gs q 1 0 0 1 204.2808 771.1797 cm 0 0 m 13.947 0 25.273 -11.193 25.502 -25.087 c 25.504 -24.944 25.513 -24.804 25.513 -24.661 c 25.513 -10.57 14.09 0.852 0 0.852 c -14.09 0.852 -25.514 -10.57 -25.514 -24.661 c -25.514 -24.804 -25.505 -24.944 -25.503 -25.087 c -25.274 -11.193 -13.947 0 0 0 c f Q endstream endobj 38 0 obj <>/Filter/FlateDecode/Height 46/Intent/RelativeColorimetric/Length 1451/Name/X/SMask 51 0 R/Subtype/Image/Type/XObject/Width 46>>stream HoUv (Ԡb#1F6jbb"Ej$BFmvnV!T1A"[`k/l`ZU3gf-ݙ ɛs:3<=g] >b~ >= 8T! ևR3mY /ƼKǾ9}'@ͷ¬e#֣>],t lcJv?Nvcu;ڭe񙷐S2wdhhK:w< |6ƽMb^/d^g?J8Ta~<7xZwbm5^Wf-E`X jf!7P<XiFd,{r+g=̍gc{wuX}{DGR]CoN[e6V3 lפ+K{+1MEDz^65>qr 6mҮc[[Ԓ{ps]6QI.H_w+DpA)ckw9S{qKRb:(ARx?VE=WBU޳_ 3'W\oz5Ͻ:a$1/u%aSO9^|B?Jޭ^#sgi&Nm5EZ8z293y73u0{CrMM RxGh,N-B_ˣHo\}ɴrk!>nW;-"zd1ne2RLMƔUwD& m2k;u鼓=ui;mcWa~ݦzfryDZ=ΰ"`m(jyn>3>stream Adobed              67    OE!1 "#$%&'()*23456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyzR;!1Aa"Qq #$%&'()*23456789:BCDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz?%TPAPA> -X`m .] [旓%(_^jq9k˽ "/%TPA`+2,rtɓ.XY)WF 97$`-js/1ef1 9 (M<^kIuYYMeUL b:Fۉ@@AX앝%b҉:[é9h$Qf0#fiXV%LjGhn&s9`P˨-̉7^NtfYvrqYRcP91j"D QJhF1DDv~| 8Y"[2%d\И ]%#Jh!A8$)R QSHB4b.[ 6 0lA`^xu2TP,q" ^_ ͇݀b 9J,`.u=Ao\@Is?6T'2FdQ`tPF6 CM=pC.å=TT*шP=PY@*˩UIMT eHPm )]! PlLa".ai.4"24Sa` 'T h0!s NP %G\'@%e]bY%-:%)HWU8;U:`)*$;Gr1 2cnC5 9[\A^B!4R @ -Ā2Dab 0gZS )K8xf5Պ~ayU+/2Kh r D !]bDJM"bCD(z\4͂w%7u4`ٌ`HjDb(qƊ#4T "AER kI !Z)@"5 (S r1 #P j aN U 5M@X'F'҃Tq% oi@E7 Pץe&$xai(ӱ )bAs VYee+ TS B1! Ƌ 8xӅCK efiBC`4C pmDZBx:4q`&G,br.*2+/[dHudaU"b](L2d`F=q洉 ZTv[v^Ji00ZNNT"+-7@6 Ɯ"vDZe!eX@/!إ_1d<0Rdd5F#b04|0&_- 6]a 0v*1S40g|8qe p<0R%`b^ e"&f!bqtE!'"i*r0 AS0Xlc "-EBY;44`CVhz땻P|jJMHESFB)hhǔe<-`C,9Wm^ Bʪl] dܦ#b[7/B)y.0fl.֕;/DžwyhJ  endstream endobj 40 0 obj <>stream H0\AФHT%eMdΐ@6l ?.L /mi4Js{ۇ^RM[zYku endstream endobj 41 0 obj <>stream H ApsjD<{.#BDw :G D .KͶۛݝۙ~<3SG܌!6S)ά_gtN]J(GH膈]@2p}o`u)I2 61#CK6W WnY:}Tj{z?q LXPL NotL]b4JblØbn~r.Uqֽ#͋E)Z-c&utZ7q)/􌬬w0A_|@qAE H ocԜ",x@_$rA.?6'4#DSK >a8 B oTkFJs[\LZt+^L=N@͵F!nTi,z&RJ{_C&ЧP 4ujux^w쯸v7zl{5ھj~B /~Fe9,9Ͽא]p@^rW;|[j=TՅvڜo-Sj)3f3JR endstream endobj 42 0 obj <>stream HlC@ʪԠMrTܦT%i*TP*u`V47NT@?g }?4y{O%Kf0Q3^x#3Q>+x\i$޿MX <;^> =1;ϿknNаNȨ-ʶ:v@_N4S?nw 19B+uDi jhB@w1!Wv}#!c\Ė=׋JIU[c\܊Zd%n[yeUaG.ߴN߃T6xԟwz/ˮv2yNu)yAK{kudI}[+ R՞FDm!.nkPh].2}Nf^͒D絞Thg-?u9qfazv:ε7:wcᜥvϿx@G,J2R4bɚ+m4vTUTjRn`uRs$9J.H,jT3f-jPeݜ}m"5}T ? }  }n{0 ?{qlBr?}x/6|>/Filter/FlateDecode/Height 55/Intent/RelativeColorimetric/Length 3038/Name/X/SMask 56 0 R/Subtype/Image/Type/XObject/Width 54>>stream HWWkDb7(H@J{lŊ-QDF >Ql`QQmbMٗ;/w~7qxsw~ B'9?xa[>u߹x] rsӄ5uqrx~ޚSu:|n {3䦒A\SJ"ȳNc˞sli?DтF#v¹VG_U(ryrt1FHIDfB*" :0֌s'|XqVV~:;|eu鿻7_Vi"BD܏&^X$tյkX[?[z>ڷ KՓiDZ3}|xxg7+K“);GEϽ2{g%ˣ 29+iztͩei TfāipaLdTސp>HOD"G?F#&'wVm߅Fe \9]:i"PS#\͵Ҿj.i[Z ϻ;Pv[$bnFn_82ϵz_)'D 9 2Z;(Ld -YN,}3IOH"+";=L_vww )q DWUMmkjE'>"t>H&PgɩwjJCtI)]/\&OmLLF {3YHo1㳱c~; 'fM C2E*Q!@@CMu~X.p _RCyÅ\Yy2ha7L}@1,16Vzʲl-"~6Ƽp`E+R K6Sj!r}9+w^w58^l]t\ཞpJ#<2ϵ]A&|w͚1Fۍ[oC/0>&3m .3qMc&d%WM3z>k_L?.x(6`=_^xSO b ~ê `7j n#6^I/[FҘsoԽp;}ks֗qX]^m :ZrO6)4lƺ\syH3=j!{\rs܏6Ca>ckGǝ/7|Wm=ጜp70$ê/w|7t >ڛ15z?⼮Hg-gP޺yεϪgQ/̜'_SP \ s gOIkj9"fG--%P_1dȂPaH&d?,MJ$ΙTWuPZĖP֐b(D R++3Pr<.94G YNl_moPaPXTS2wvcc >/Filter/FlateDecode/Height 55/Intent/RelativeColorimetric/Length 817/Name/X/Subtype/Image/Type/XObject/Width 54>>stream H]HQVK(4z K+֧4J*!B,4ԒLzh ^D˲]ÌYH/J Svf~;3tvs猦9,zhh~sg M ,IrB<#bz0&rLumi[Swj(g8 Q- u9Ñ`P:ؠ:B sτX'BY+}*H*ABVႄ&qro% hc"df>FCR( SKq:iSpPM!-P=_!TE0lr1dl)ggo7?L/F\C(ca˥TQ6πx'Աp*]7_?m grэjx~ΕkȦt,-(*~4Vs&fi-leCBPhpz 8+׮iD%i X?&ucDIv b[R*9U4D7.Q/ .U\!v~7K=\~=s'D* ?Kd=ByH2ʑn*}B;-gr Ah2# ?Q!|,\y@P"LjBBPf4>"PۼFk;}"UoxZMe"Bןdo9 WNBog->/Filter/FlateDecode/Height 49/Intent/RelativeColorimetric/Length 351/Name/X/Subtype/Image/Type/XObject/Width 30>>stream H=K@A)B}"'A:1WA R_quAPAZAh#js%g$wLǑ<; ;C_^ !B09Fy SBr 釆5z*'8g"˄Yɼ",W:qD&tB -SP5Hm!>Z#uR6Nw%*xQkdde}u!l_((,8*(ݞj`zt_|֓OĚ˷=Hpgz)daz r.? ? endstream endobj 57 0 obj <>stream          ( & !    322110,*)%$$#""!  =654431/,+++&%A@>98*)))(''yx|zwutsxsrGFEC><;{zvtlkjihpfhgafdcba`^]ZYWV \ U S RJo 7^\Q߬ެݯܯۯڳڰگٳشֵֶնӹҹѽѹнϽξ~tsroljbU endstream endobj 30 0 obj [/Indexed/DeviceCMYK 191 58 0 R] endobj 54 0 obj <>/Filter/FlateDecode/Height 49/Intent/RelativeColorimetric/Length 819/Name/X/Subtype/Image/Type/XObject/Width 56>>stream Hb`iky?|x5Aڬ xhӿc.N®)w_zD1V?h PY%F|AXm@\H^O Iߓ7Dk3߈(uo^9 t4} 7N^]Ϗ'01[OهO@||ʙBRCA@ }I) #JDXߦ3?k#EMc2q^}|[A(b+ @G+-;ɇ><}py ̂f)A://]` 3s9jq%UL˧3hi"Sﱤã᩻?U7O]ϻgO^uhhԋG~u™S'O8yy.6{>w1aч M\hG?F$?F L5-Q @$M(EYx\o+V69̧nXPPЍ]dO3u 1-SߌYp#v p38*vp3qSšҩ- Օ'/| o>dZ2v}q9 `}b>@=1SK5Lj`u `9Ltɐ"@d(JQi>] 0vL/<"XR*TėSPdv1@ endstream endobj 58 0 obj <>stream ֎/ ֎. Ռ0 Ջ0 ԋ2 ъ5 Ѕ8χ8t2 ·9΃:̅<̄<ʅ=~>|?ƂAzBĀD€E}E,g%dkM"xM#AvO&gR'vP' VcT)tQ(tT+_Y+^\,oW/pW/oX0pX0EDCnZ1BoY1AC@>?BSs);ja7;ja7;Qy';P%987O$776gf:gg;43fk<2111em=}fl=yeo=yJwGt,p*p)l(jey?j'idz>hDg'ed>cAc&`A\f=\A\#X@Uf;Tg:T?PIFk/A?:?>p&>=p$>/Filter/FlateDecode/Height 45/Intent/RelativeColorimetric/Length 169/Name/X/Subtype/Image/Type/XObject/Width 44>>stream Hb~ 12᠒G OPTW jvQ0 ?'^q/*bƠ:a8sSl*BRsHjj38 He`HV DD@VPcV&l``q@Qet a. endstream endobj 59 0 obj <>stream ֎. Պ/ Ԇ/ Ӄ/ t2 ^4 u-s-n*l*k)k+j*i)i+d*a(a)['EZ(X'U'O%N&K#J$C"B!|= {> t8 j2h0b.X)M =  endstream endobj 52 0 obj <>/Filter/FlateDecode/Height 54/Intent/RelativeColorimetric/Length 399/Name/X/Subtype/Image/Type/XObject/Width 55>>stream Hb`b_|]!UxA`mHն̨6LsssHL#Q0ZF8CTml MDmmJ詍kϮ]{V+M?\mٖ8ɒM6mRCfyYi>O$R݋%1ڌ Ц] .p«)1NYLmY`]u`1`fX[m e`M6m卛6o)YGI.u6%}\Cќ9sΝ34 &{`M8y2LoƎ_DMt10+AmX+] ^P4}&J$]$廞JuT( endstream endobj 51 0 obj <>/Filter/FlateDecode/Height 46/Intent/RelativeColorimetric/Length 461/Name/X/Subtype/Image/Type/XObject/Width 46>>stream Hb``HNy0jA_Y@E bP< bp BaS=I{11boHkV!T,b2/ S1dgT-,/!)(c؋Tb KW0lZ<Ńb!y $[3e_V Fdo!?Hdl#=7G%EVd \0v=DP0rܹRz*!%ȪRz.!՚Ȫ3 >o\U+#TG2T+P͠{3A7iDWQXTG] VVD]fvr92|#[_?O?"~we̙3+=f4`= X'͜>cV*Ϟ UZ endstream endobj 50 0 obj <> endobj 13 0 obj <> endobj 45 0 obj <> endobj 48 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 296.0596 373.1826 cm 0 0 m -1.853 1.787 l 380.932 384.26 l 382.773 382.446 l h f Q q 1 0 0 1 287.7413 381.418 cm 0 0 m -1.839 1.759 l 380.932 384.219 l 382.758 382.417 l h f Q q 1 0 0 1 279.3946 389.5977 cm 0 0 m -1.798 1.814 l 380.975 384.232 l 382.814 382.459 l h f Q q 1 0 0 1 271.0616 397.8047 cm 0 0 m -1.811 1.801 l 380.96 384.261 l 382.801 382.446 l h f Q q 1 0 0 1 262.7715 406.0386 cm 0 0 m -1.839 1.76 l 380.947 384.248 l 382.771 382.432 l h f Q q 1 0 0 1 254.4112 414.2329 cm 0 0 m -1.812 1.801 l 380.988 384.273 l 382.8 382.458 l h f Q q 1 0 0 1 246.1065 422.4258 cm 0 0 m -1.825 1.801 l 380.96 384.274 l 382.787 382.46 l h f Q q 1 0 0 1 237.774 430.647 cm 0 0 m -1.812 1.787 l 380.96 384.26 l 382.799 382.458 l h f Q q 1 0 0 1 229.4552 438.854 cm 0 0 m -1.825 1.8 l 380.96 384.274 l 382.787 382.46 l h f Q q 1 0 0 1 221.1505 447.061 cm 0 0 m -1.825 1.786 l 380.932 384.26 l 382.773 382.446 l h f Q q 1 0 0 1 212.8179 455.2681 cm 0 0 m -1.811 1.788 l 380.961 384.26 l 382.785 382.473 l h f Q q 1 0 0 1 204.4996 463.4893 cm 0 0 m -1.826 1.786 l 380.946 384.26 l 382.772 382.446 l h f Q q 1 0 0 1 196.2086 471.7231 cm 0 0 m -1.839 1.773 l 380.919 384.233 l 382.758 382.419 l h f Q q 1 0 0 1 187.8624 479.9033 cm 0 0 m -1.798 1.814 l 380.96 384.246 l 382.771 382.46 l h f Q q 1 0 0 1 179.5299 488.1104 cm 0 0 m -1.812 1.8 l 380.946 384.26 l 382.785 382.446 l h f Q q 1 0 0 1 171.2388 496.3457 cm 0 0 m -1.839 1.772 l 380.933 384.232 l 382.758 382.431 l h f Q q 1 0 0 1 162.8927 504.5381 cm 0 0 m -1.798 1.815 l 380.947 384.275 l 382.786 382.46 l h f Q q 1 0 0 1 154.5738 512.7314 cm 0 0 m -1.825 1.802 l 380.946 384.289 l 382.771 382.474 l h f Q q 1 0 0 1 146.2828 520.9668 cm 0 0 m -1.839 1.773 l 380.934 384.26 l 382.772 382.472 l h f Q q 1 0 0 1 137.9366 529.1592 cm 0 0 m -1.797 1.815 l 380.947 384.289 l 382.772 382.474 l h f Q q 1 0 0 1 129.6182 537.3662 cm 0 0 m -1.825 1.788 l 380.933 384.274 l 382.772 382.46 l h f Q q 1 0 0 1 121.3136 545.5874 cm 0 0 m -1.839 1.788 l 380.933 384.26 l 382.731 382.474 l h f Q q 1 0 0 1 112.9669 553.7944 cm 0 0 m -1.784 1.815 l 380.947 384.274 l 382.772 382.46 l h f Q q 1 0 0 1 104.6485 561.9888 cm 0 0 m -1.812 1.814 l 380.947 384.273 l 382.786 382.458 l h f Q q 1 0 0 1 96.316 570.2227 cm 0 0 m -1.784 1.829 l 380.988 384.289 l 382.771 382.46 l h f Q q 1 0 0 1 87.9971 578.4155 cm 0 0 m -1.839 1.816 l 380.947 384.274 l 382.772 382.46 l h f Q q 1 0 0 1 79.6925 586.6099 cm 0 0 m -1.839 1.814 l 380.948 384.287 l 382.758 382.473 l h f Q q 1 0 0 1 71.3463 594.8437 cm 0 0 m -1.798 1.829 l 380.988 384.289 l 382.786 382.46 l h f Q q 1 0 0 1 63.0416 603.0381 cm 0 0 m -1.839 1.814 l 380.947 384.287 l 382.758 382.473 l h f Q q 1 0 0 1 54.7369 611.2451 cm 0 0 m -1.839 1.814 l 380.934 384.274 l 382.759 382.458 l h f Q q 1 0 0 1 46.3902 619.4663 cm 0 0 m -1.797 1.827 l 380.947 384.287 l 382.772 382.486 l h f Q q 1 0 0 1 38.0855 627.6733 cm 0 0 m -1.839 1.814 l 380.934 384.273 l 382.759 382.472 l h f Q q 1 0 0 1 29.7808 635.8945 cm 0 0 m -1.853 1.786 l 380.933 384.26 l 382.73 382.472 l h f Q q 1 0 0 1 21.4346 644.1011 cm 0 0 m -1.839 1.815 l 380.933 384.273 l 382.758 382.473 l h f Q q 1 0 0 1 13.1158 652.2939 cm 0 0 m -1.825 1.815 l 380.946 384.275 l 382.772 382.487 l h f Q q 1 0 0 1 4.8111 660.5293 cm 0 0 m -1.853 1.787 l 380.933 384.26 l 382.744 382.473 l h f Q q 1 0 0 1 -3.5351 668.7222 cm 0 0 m -1.826 1.829 l 380.948 384.274 l 382.787 382.487 l h f Q q 1 0 0 1 -11.8398 676.9434 cm 0 0 m -1.839 1.814 l 380.946 384.273 l 382.773 382.458 l h f Q q 1 0 0 1 -20.1454 685.1646 cm 0 0 m -1.852 1.814 l 380.934 384.246 l 382.746 382.473 l h f Q q 1 0 0 1 -28.4906 693.3716 cm 0 0 m -1.854 1.8 l 380.946 384.273 l 382.758 382.458 l h f Q q 1 0 0 1 -36.8095 701.5645 cm 0 0 m -1.839 1.814 l 380.946 384.26 l 382.773 382.46 l h f Q q 1 0 0 1 -45.142 709.7715 cm 0 0 m -1.798 1.843 l 380.975 384.26 l 382.772 382.473 l h f Q q 1 0 0 1 -53.4462 717.9927 cm 0 0 m -1.839 1.814 l 380.932 384.26 l 382.758 382.46 l h f Q q 1 0 0 1 -61.7519 726.2266 cm 0 0 m -1.866 1.773 l 380.933 384.233 l 382.772 382.46 l h f Q q 1 0 0 1 -70.1117 734.4209 cm 0 0 m -1.839 1.814 l 380.989 384.274 l 382.772 382.458 l h f Q endstream endobj 49 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 300.173 369.164 m 298.32 370.952 l 681.105 753.424 l 682.946 751.61 l h W n q 0 g /GS0 gs -54.9522018 305.9773865 305.9773865 54.9522018 518.1069336 408.3039551 cm BX /Sh0 sh EX Q Q q 291.855 377.399 m 290.016 379.159 l 672.787 761.619 l 674.613 759.817 l h W n q 0 g /GS1 gs -54.945076 305.9376831 305.9376831 54.945076 509.7835083 416.5383301 cm BX /Sh0 sh EX Q Q q 283.508 385.579 m 281.71 387.395 l 664.483 769.812 l 666.322 768.038 l h W n q 0 g /GS2 gs -54.9459763 305.9427185 305.9427185 54.9459763 501.4917603 424.7283325 cm BX /Sh0 sh EX Q Q q 275.175 393.786 m 273.364 395.587 l 656.135 778.047 l 657.976 776.232 l h W n q 0 g /GS3 gs -54.9513283 305.9725037 305.9725037 54.9513283 493.1443481 432.9326477 cm BX /Sh0 sh EX Q Q q 266.885 402.021 m 265.045 403.78 l 647.832 786.268 l 649.656 784.452 l h W n q 0 g /GS4 gs -54.9495506 305.9625854 305.9625854 54.9495506 484.8210449 441.160675 cm BX /Sh0 sh EX Q Q q 258.524 410.214 m 256.713 412.015 l 639.513 794.488 l 641.325 792.673 l h W n q 0 g /GS5 gs -54.9526901 305.980072 305.980072 54.9526901 476.4940796 449.3608398 cm BX /Sh0 sh EX Q Q q 250.22 418.407 m 248.395 420.208 l 631.18 802.682 l 633.006 800.867 l h W n q 0 g /GS6 gs -54.9537926 305.9862366 305.9862366 54.9537926 468.176178 457.5513916 cm BX /Sh0 sh EX Q Q q 241.887 426.628 m 240.076 428.415 l 622.847 810.889 l 624.686 809.087 l h W n q 0 g /GS7 gs -54.9513397 305.9725647 305.9725647 54.9513397 459.8551331 465.7745667 cm BX /Sh0 sh EX Q Q q 233.568 434.835 m 231.743 436.636 l 614.529 819.11 l 616.355 817.295 l h W n q 0 g /GS8 gs -54.9537926 305.9862366 305.9862366 54.9537926 451.5249329 473.9795227 cm BX /Sh0 sh EX Q Q q 225.264 443.042 m 223.439 444.829 l 606.196 827.303 l 608.037 825.488 l h W n q 0 g /GS9 gs -54.952198 305.977356 305.977356 54.952198 443.2111511 482.1849365 cm BX /Sh0 sh EX Q Q q 216.932 451.25 m 215.12 453.037 l 597.892 835.51 l 599.716 833.722 l h W n q 0 g /GS10 gs -54.9513283 305.9725037 305.9725037 54.9513283 434.8939514 490.3946533 cm BX /Sh0 sh EX Q Q q 208.613 459.471 m 206.788 461.257 l 589.559 843.731 l 591.385 841.917 l h W n q 0 g /GS11 gs -54.951767 305.9749451 305.9749451 54.951767 426.559967 498.6130371 cm BX /Sh0 sh EX Q Q q 200.322 467.705 m 198.483 469.478 l 581.241 851.938 l 583.08 850.124 l h W n q 0 g /GS12 gs -54.9479485 305.9536743 305.9536743 54.9479485 418.25177 506.8438416 cm BX /Sh0 sh EX Q Q q 191.976 475.885 m 190.178 477.699 l 572.936 860.131 l 574.748 858.345 l h W n q 0 g /GS13 gs -54.948864 305.9587708 305.9587708 54.948864 409.9393005 515.0300293 cm BX /Sh0 sh EX Q Q q 183.643 484.092 m 181.832 485.892 l 564.589 868.352 l 566.428 866.538 l h W n q 0 g /GS14 gs -54.951767 305.9749451 305.9749451 54.951767 401.6044617 523.2365723 cm BX /Sh0 sh EX Q Q q 175.352 492.327 m 173.513 494.099 l 556.286 876.559 l 558.11 874.759 l h W n q 0 g /GS15 gs -54.9472618 305.9498596 305.9498596 54.9472618 393.2830505 531.4664307 cm BX /Sh0 sh EX Q Q q 167.006 500.52 m 165.208 502.334 l 547.953 884.794 l 549.792 882.98 l h W n q 0 g /GS16 gs -54.954216 305.9885864 305.9885864 54.954216 384.9764709 539.6663818 cm BX /Sh0 sh EX Q Q q 158.688 508.713 m 156.862 510.515 l 539.634 893.001 l 541.459 891.187 l h W n q 0 g /GS17 gs -54.9566689 306.0022583 306.0022583 54.9566689 376.6377258 547.8556519 cm BX /Sh0 sh EX Q Q q 150.397 516.948 m 148.557 518.722 l 531.33 901.208 l 533.169 899.421 l h W n q 0 g /GS18 gs -54.9521637 305.9771729 305.9771729 54.9521637 368.3379517 556.0894165 cm BX /Sh0 sh EX Q Q q 142.05 525.141 m 140.253 526.956 l 522.997 909.43 l 524.822 907.615 l h W n q 0 g /GS19 gs -54.956665 306.0022278 306.0022278 54.956665 360.0151367 564.286438 cm BX /Sh0 sh EX Q Q q 133.732 533.348 m 131.906 535.136 l 514.665 917.623 l 516.503 915.808 l h W n q 0 g /GS20 gs -54.9546356 305.9909058 305.9909058 54.9546356 351.6796265 572.4904175 cm BX /Sh0 sh EX Q Q q 125.427 541.569 m 123.587 543.357 l 506.36 925.83 l 508.158 924.043 l h W n q 0 g /GS21 gs -54.9521637 305.9771729 305.9771729 54.9521637 343.3495789 580.7070923 cm BX /Sh0 sh EX Q Q q 117.081 549.776 m 115.296 551.591 l 498.027 934.05 l 499.852 932.236 l h W n q 0 g /GS22 gs -54.9542046 305.9885254 305.9885254 54.9542046 335.0509338 588.9225464 cm BX /Sh0 sh EX Q Q q 108.762 557.97 m 106.95 559.785 l 489.709 942.243 l 491.548 940.429 l h W n q 0 g /GS23 gs -54.9539566 305.9871216 305.9871216 54.9539566 326.7257385 597.1157227 cm BX /Sh0 sh EX Q Q q 100.429 566.204 m 98.646 568.033 l 481.418 950.493 l 483.201 948.664 l h W n q 0 g /GS24 gs -54.9554024 305.9951782 305.9951782 54.9554024 318.4009705 605.3508911 cm BX /Sh0 sh EX Q Q q 92.111 574.397 m 90.272 576.213 l 473.057 958.671 l 474.882 956.857 l h W n q 0 g /GS25 gs -54.9542046 305.9885254 305.9885254 54.9542046 310.0544739 613.5387573 cm BX /Sh0 sh EX Q Q q 83.806 582.591 m 81.967 584.406 l 464.753 966.878 l 466.564 965.064 l h W n q 0 g /GS26 gs -54.9564056 306.0007629 306.0007629 54.9564056 301.7440491 621.7321167 cm BX /Sh0 sh EX Q Q q 75.46 590.825 m 73.662 592.654 l 456.448 975.114 l 458.246 973.285 l h W n q 0 g /GS27 gs -54.9554024 305.9951782 305.9951782 54.9554024 293.431427 629.9719238 cm BX /Sh0 sh EX Q Q q 67.155 599.02 m 65.316 600.834 l 448.102 983.307 l 449.913 981.492 l h W n q 0 g /GS28 gs -54.9564095 306.0007935 306.0007935 54.9564095 285.092865 638.1601563 cm BX /Sh0 sh EX Q Q q 58.85 607.227 m 57.011 609.041 l 439.784 991.501 l 441.609 989.685 l h W n q 0 g /GS29 gs -54.9546204 305.9908447 305.9908447 54.9546204 276.7872009 646.3670654 cm BX /Sh0 sh EX Q Q q 50.504 615.448 m 48.706 617.275 l 431.451 999.735 l 433.276 997.934 l h W n q 0 g /GS30 gs -54.9564095 306.0007935 306.0007935 54.9564095 268.4710999 654.5935669 cm BX /Sh0 sh EX Q Q q 42.199 623.655 m 40.36 625.469 l 423.132 1007.928 l 424.958 1006.127 l h W n q 0 g /GS31 gs -54.9543724 305.9894409 305.9894409 54.9543724 260.1372375 662.7954102 cm BX /Sh0 sh EX Q Q q 33.894 631.876 m 32.041 633.662 l 414.827 1016.136 l 416.625 1014.348 l h W n q 0 g /GS32 gs -54.9521904 305.9773254 305.9773254 54.9521904 251.8097382 671.0125122 cm BX /Sh0 sh EX Q Q q 25.548 640.083 m 23.709 641.897 l 406.481 1024.356 l 408.306 1022.555 l h W n q 0 g /GS33 gs -54.9543762 305.9894714 305.9894714 54.9543762 243.4860535 679.2235107 cm BX /Sh0 sh EX Q Q q 17.23 648.276 m 15.404 650.09 l 398.175 1032.55 l 400.002 1030.762 l h W n q 0 g /GS34 gs -54.9542274 305.9886475 305.9886475 54.9542274 235.1823273 687.4190674 cm BX /Sh0 sh EX Q Q q 8.924 656.511 m 7.071 658.297 l 389.857 1040.771 l 391.669 1038.983 l h W n q 0 g /GS35 gs -54.9521904 305.9773254 305.9773254 54.9521904 226.8469086 695.6488647 cm BX /Sh0 sh EX Q Q q 0.578 664.704 m -1.247 666.533 l 381.526 1048.978 l 383.365 1047.19 l h W n q 0 g /GS36 gs -54.9541893 305.9884338 305.9884338 54.9541893 218.5392609 703.8486328 cm BX /Sh0 sh EX Q Q q -7.726 672.925 m -9.566 674.74 l 373.22 1057.198 l 375.046 1055.383 l h W n q 0 g /GS37 gs -54.9539719 305.9872131 305.9872131 54.9539719 210.2174683 712.0667114 cm BX /Sh0 sh EX Q Q q -16.032 681.146 m -17.884 682.96 l 364.901 1065.392 l 366.713 1063.619 l h W n q 0 g /GS38 gs -54.9496994 305.9634399 305.9634399 54.9496994 201.8938599 720.284668 cm BX /Sh0 sh EX Q Q q -24.377 689.353 m -26.231 691.153 l 356.569 1073.626 l 358.381 1071.812 l h W n q 0 g /GS39 gs -54.9539833 305.9872742 305.9872742 54.9539833 193.5514526 728.4921265 cm BX /Sh0 sh EX Q Q q -32.696 697.546 m -34.535 699.36 l 348.251 1081.806 l 350.077 1080.006 l h W n q 0 g /GS40 gs -54.951767 305.9749451 305.9749451 54.951767 185.2481232 736.6877441 cm BX /Sh0 sh EX Q Q q -41.029 705.753 m -42.827 707.596 l 339.946 1090.013 l 341.744 1088.226 l h W n q 0 g /GS41 gs -54.9508934 305.9700623 305.9700623 54.9508934 176.9389038 744.8989258 cm BX /Sh0 sh EX Q Q q -49.333 713.974 m -51.172 715.789 l 331.599 1098.234 l 333.425 1096.434 l h W n q 0 g /GS42 gs -54.9522018 305.9773865 305.9773865 54.9522018 168.6042175 753.1146851 cm BX /Sh0 sh EX Q Q q -57.639 722.208 m -59.505 723.981 l 323.295 1106.441 l 325.134 1104.668 l h W n q 0 g /GS43 gs -54.9474869 305.9511108 305.9511108 54.9474869 160.2887421 761.3468018 cm BX /Sh0 sh EX Q Q q -65.998 730.402 m -67.837 732.217 l 314.99 1114.677 l 316.774 1112.861 l h W n q 0 g /GS44 gs -54.9529152 305.9813538 305.9813538 54.9529152 151.9455261 769.5439453 cm BX /Sh0 sh EX Q Q endstream endobj 61 0 obj <> endobj 108 0 obj <> endobj 62 0 obj [/DeviceN[/Black]/DeviceCMYK 110 0 R 111 0 R] endobj 109 0 obj <> endobj 112 0 obj <> endobj 113 0 obj <> endobj 110 0 obj <>stream {1.000000 2 1 roll 1.000000 2 1 roll 1.000000 2 1 roll 0 index 1.000000 cvr exch sub 2 1 roll 5 -1 roll 1.000000 cvr exch sub 5 1 roll 4 -1 roll 1.000000 cvr exch sub 4 1 roll 3 -1 roll 1.000000 cvr exch sub 3 1 roll 2 -1 roll 1.000000 cvr exch sub 2 1 roll pop } endstream endobj 111 0 obj <> endobj 114 0 obj <> endobj 63 0 obj <> endobj 64 0 obj <> endobj 65 0 obj <> endobj 66 0 obj <> endobj 67 0 obj <> endobj 68 0 obj <> endobj 69 0 obj <> endobj 70 0 obj <> endobj 71 0 obj <> endobj 72 0 obj <> endobj 73 0 obj <> endobj 74 0 obj <> endobj 75 0 obj <> endobj 76 0 obj <> endobj 77 0 obj <> endobj 78 0 obj <> endobj 79 0 obj <> endobj 80 0 obj <> endobj 81 0 obj <> endobj 82 0 obj <> endobj 83 0 obj <> endobj 84 0 obj <> endobj 85 0 obj <> endobj 86 0 obj <> endobj 87 0 obj <> endobj 88 0 obj <> endobj 89 0 obj <> endobj 90 0 obj <> endobj 91 0 obj <> endobj 92 0 obj <> endobj 93 0 obj <> endobj 94 0 obj <> endobj 95 0 obj <> endobj 96 0 obj <> endobj 97 0 obj <> endobj 98 0 obj <> endobj 99 0 obj <> endobj 100 0 obj <> endobj 101 0 obj <> endobj 102 0 obj <> endobj 103 0 obj <> endobj 104 0 obj <> endobj 105 0 obj <> endobj 106 0 obj <> endobj 107 0 obj <> endobj 159 0 obj <> endobj 160 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.952198 305.977356 305.977356 54.952198 443.2111511 482.1849365 cm BX /Sh0 sh EX Q endstream endobj 161 0 obj <> endobj 162 0 obj <> endobj 163 0 obj <> endobj 164 0 obj <> endobj 165 0 obj <> endobj 158 0 obj <> endobj 166 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9537926 305.9862366 305.9862366 54.9537926 451.5249329 473.9795227 cm BX /Sh0 sh EX Q endstream endobj 167 0 obj <> endobj 157 0 obj <> endobj 168 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9513397 305.9725647 305.9725647 54.9513397 459.8551331 465.7745667 cm BX /Sh0 sh EX Q endstream endobj 169 0 obj <> endobj 156 0 obj <> endobj 170 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9537926 305.9862366 305.9862366 54.9537926 468.176178 457.5513916 cm BX /Sh0 sh EX Q endstream endobj 171 0 obj <> endobj 155 0 obj <> endobj 172 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9526901 305.980072 305.980072 54.9526901 476.4940796 449.3608398 cm BX /Sh0 sh EX Q endstream endobj 173 0 obj <> endobj 154 0 obj <> endobj 174 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9529152 305.9813538 305.9813538 54.9529152 151.9455261 769.5439453 cm BX /Sh0 sh EX Q endstream endobj 175 0 obj <> endobj 153 0 obj <> endobj 176 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9474869 305.9511108 305.9511108 54.9474869 160.2887421 761.3468018 cm BX /Sh0 sh EX Q endstream endobj 177 0 obj <> endobj 152 0 obj <> endobj 178 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9522018 305.9773865 305.9773865 54.9522018 168.6042175 753.1146851 cm BX /Sh0 sh EX Q endstream endobj 179 0 obj <> endobj 151 0 obj <> endobj 180 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9508934 305.9700623 305.9700623 54.9508934 176.9389038 744.8989258 cm BX /Sh0 sh EX Q endstream endobj 181 0 obj <> endobj 150 0 obj <> endobj 182 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.951767 305.9749451 305.9749451 54.951767 185.2481232 736.6877441 cm BX /Sh0 sh EX Q endstream endobj 183 0 obj <> endobj 149 0 obj <> endobj 184 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9495506 305.9625854 305.9625854 54.9495506 484.8210449 441.160675 cm BX /Sh0 sh EX Q endstream endobj 185 0 obj <> endobj 148 0 obj <> endobj 186 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9539833 305.9872742 305.9872742 54.9539833 193.5514526 728.4921265 cm BX /Sh0 sh EX Q endstream endobj 187 0 obj <> endobj 147 0 obj <> endobj 188 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9496994 305.9634399 305.9634399 54.9496994 201.8938599 720.284668 cm BX /Sh0 sh EX Q endstream endobj 189 0 obj <> endobj 146 0 obj <> endobj 190 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9539719 305.9872131 305.9872131 54.9539719 210.2174683 712.0667114 cm BX /Sh0 sh EX Q endstream endobj 191 0 obj <> endobj 145 0 obj <> endobj 192 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9541893 305.9884338 305.9884338 54.9541893 218.5392609 703.8486328 cm BX /Sh0 sh EX Q endstream endobj 193 0 obj <> endobj 144 0 obj <> endobj 194 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9521904 305.9773254 305.9773254 54.9521904 226.8469086 695.6488647 cm BX /Sh0 sh EX Q endstream endobj 195 0 obj <> endobj 143 0 obj <> endobj 196 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9542274 305.9886475 305.9886475 54.9542274 235.1823273 687.4190674 cm BX /Sh0 sh EX Q endstream endobj 197 0 obj <> endobj 142 0 obj <> endobj 198 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9543762 305.9894714 305.9894714 54.9543762 243.4860535 679.2235107 cm BX /Sh0 sh EX Q endstream endobj 199 0 obj <> endobj 141 0 obj <> endobj 200 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9521904 305.9773254 305.9773254 54.9521904 251.8097382 671.0125122 cm BX /Sh0 sh EX Q endstream endobj 201 0 obj <> endobj 140 0 obj <> endobj 202 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9543724 305.9894409 305.9894409 54.9543724 260.1372375 662.7954102 cm BX /Sh0 sh EX Q endstream endobj 203 0 obj <> endobj 139 0 obj <> endobj 204 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9564095 306.0007935 306.0007935 54.9564095 268.4710999 654.5935669 cm BX /Sh0 sh EX Q endstream endobj 205 0 obj <> endobj 138 0 obj <> endobj 206 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9513283 305.9725037 305.9725037 54.9513283 493.1443481 432.9326477 cm BX /Sh0 sh EX Q endstream endobj 207 0 obj <> endobj 137 0 obj <> endobj 208 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9546204 305.9908447 305.9908447 54.9546204 276.7872009 646.3670654 cm BX /Sh0 sh EX Q endstream endobj 209 0 obj <> endobj 136 0 obj <> endobj 210 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9564095 306.0007935 306.0007935 54.9564095 285.092865 638.1601563 cm BX /Sh0 sh EX Q endstream endobj 211 0 obj <> endobj 135 0 obj <> endobj 212 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9554024 305.9951782 305.9951782 54.9554024 293.431427 629.9719238 cm BX /Sh0 sh EX Q endstream endobj 213 0 obj <> endobj 134 0 obj <> endobj 214 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9564056 306.0007629 306.0007629 54.9564056 301.7440491 621.7321167 cm BX /Sh0 sh EX Q endstream endobj 215 0 obj <> endobj 133 0 obj <> endobj 216 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9542046 305.9885254 305.9885254 54.9542046 310.0544739 613.5387573 cm BX /Sh0 sh EX Q endstream endobj 217 0 obj <> endobj 132 0 obj <> endobj 218 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9554024 305.9951782 305.9951782 54.9554024 318.4009705 605.3508911 cm BX /Sh0 sh EX Q endstream endobj 219 0 obj <> endobj 131 0 obj <> endobj 220 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9539566 305.9871216 305.9871216 54.9539566 326.7257385 597.1157227 cm BX /Sh0 sh EX Q endstream endobj 221 0 obj <> endobj 130 0 obj <> endobj 222 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9542046 305.9885254 305.9885254 54.9542046 335.0509338 588.9225464 cm BX /Sh0 sh EX Q endstream endobj 223 0 obj <> endobj 129 0 obj <> endobj 224 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9521637 305.9771729 305.9771729 54.9521637 343.3495789 580.7070923 cm BX /Sh0 sh EX Q endstream endobj 225 0 obj <> endobj 128 0 obj <> endobj 226 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9546356 305.9909058 305.9909058 54.9546356 351.6796265 572.4904175 cm BX /Sh0 sh EX Q endstream endobj 227 0 obj <> endobj 127 0 obj <> endobj 228 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9459763 305.9427185 305.9427185 54.9459763 501.4917603 424.7283325 cm BX /Sh0 sh EX Q endstream endobj 229 0 obj <> endobj 126 0 obj <> endobj 230 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.956665 306.0022278 306.0022278 54.956665 360.0151367 564.286438 cm BX /Sh0 sh EX Q endstream endobj 231 0 obj <> endobj 125 0 obj <> endobj 232 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9521637 305.9771729 305.9771729 54.9521637 368.3379517 556.0894165 cm BX /Sh0 sh EX Q endstream endobj 233 0 obj <> endobj 124 0 obj <> endobj 234 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9566689 306.0022583 306.0022583 54.9566689 376.6377258 547.8556519 cm BX /Sh0 sh EX Q endstream endobj 235 0 obj <> endobj 123 0 obj <> endobj 236 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.954216 305.9885864 305.9885864 54.954216 384.9764709 539.6663818 cm BX /Sh0 sh EX Q endstream endobj 237 0 obj <> endobj 122 0 obj <> endobj 238 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9472618 305.9498596 305.9498596 54.9472618 393.2830505 531.4664307 cm BX /Sh0 sh EX Q endstream endobj 239 0 obj <> endobj 121 0 obj <> endobj 240 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.951767 305.9749451 305.9749451 54.951767 401.6044617 523.2365723 cm BX /Sh0 sh EX Q endstream endobj 241 0 obj <> endobj 120 0 obj <> endobj 242 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.948864 305.9587708 305.9587708 54.948864 409.9393005 515.0300293 cm BX /Sh0 sh EX Q endstream endobj 243 0 obj <> endobj 119 0 obj <> endobj 244 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9479485 305.9536743 305.9536743 54.9479485 418.25177 506.8438416 cm BX /Sh0 sh EX Q endstream endobj 245 0 obj <> endobj 118 0 obj <> endobj 246 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.951767 305.9749451 305.9749451 54.951767 426.559967 498.6130371 cm BX /Sh0 sh EX Q endstream endobj 247 0 obj <> endobj 117 0 obj <> endobj 248 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9513283 305.9725037 305.9725037 54.9513283 434.8939514 490.3946533 cm BX /Sh0 sh EX Q endstream endobj 249 0 obj <> endobj 116 0 obj <> endobj 250 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.945076 305.9376831 305.9376831 54.945076 509.7835083 416.5383301 cm BX /Sh0 sh EX Q endstream endobj 251 0 obj <> endobj 115 0 obj <> endobj 252 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -54.9522018 305.9773865 305.9773865 54.9522018 518.1069336 408.3039551 cm BX /Sh0 sh EX Q endstream endobj 253 0 obj <> endobj 60 0 obj <> endobj 46 0 obj <> endobj 47 0 obj <> endobj 44 0 obj <> endobj 23 0 obj <> endobj 10 0 obj [/DeviceN[/Magenta/Yellow/Black]/DeviceCMYK 255 0 R 256 0 R] endobj 254 0 obj <> endobj 257 0 obj <> endobj 255 0 obj <>stream {1.000000 4 1 roll 2 index 1.000000 cvr exch sub 4 1 roll 1 index 1.000000 cvr exch sub 4 1 roll 0 index 1.000000 cvr exch sub 4 1 roll 7 -1 roll 1.000000 cvr exch sub 7 1 roll 6 -1 roll 1.000000 cvr exch sub 6 1 roll 5 -1 roll 1.000000 cvr exch sub 5 1 roll 4 -1 roll 1.000000 cvr exch sub 4 1 roll pop pop pop } endstream endobj 256 0 obj <> endobj 258 0 obj <> endobj 16 0 obj <> endobj 32 0 obj <> endobj 33 0 obj <> endobj 18 0 obj <> endobj 17 0 obj <> endobj 34 0 obj <> endobj 267 0 obj <> endobj 268 0 obj <>stream HVyxTW7KJҐμ$7IR0a ˰y7LbV[cUĺ-XJvV~%U+Bܙүy=s;w]wƒMS柝yD9{Mb.UiKWϦ9Si랮f'xG'PfȞxܽox]ڶnO~vz`Ob[l莇x{ܕ>vo:Z7gZwڳ6` ecd`Xlbki78s JGi^e#/e.?ipӫ+?pRj8בƟ # «%NWx'97/0@/3'QžT PF4a2Z0s˰ WZ؈c#:!jh ޅ]{>|AcnWM| Gp?x 8Gqj\cq%lVt;ЇW؍8$N܍p0͡YTLch:B͠IaZDQ0Փ$H4Y<:L*'&\;qO8LZ^atΓ^Of\s2ZOt_ӵǴ'GQ-jOԋf1[r[mi>WUj|";~^K3ulFZI57?G;BۨVi얋*1NYoavR۪qCCc*/b]Amt0t`@N<0prau\QS5Yͩi%Z6Fi4E[Ӯֺ=nw_$n[]#+;)3 JGWt 3nwqg8H:wx7CzP5^wx/&&oF5E-nO!Vfg{9L0E`Gu ,)Cb9( ܇5x Ə?z']x3lSX2ǽ"2)qhCr XfzCs{G{vǡ[;>gx9 SHE,!ڏhet^t`]"6&Dب{DhgPP)):<u $"yZ>5z2&d4[.L4ӲD*{:!xkx%d7Ǣ1$BGc6WO-m˲tI2$N J)=κ8{ Gce1KN`DGʵ1$Fyg=PHB:^VER$@U W_e k ٺ::]A.SB&Rn^!#nR%)^H?(sL\-'8Q7VRG춌fN‘;<ϾBq"4*/xAW1Bg'/x1mY.kF_*43 lZ~oPz̔EdG-(L>(, /QYңVxUPkJ2!ەEa[$m!8hAYbmVt}AYjn^/엙)RaI,J IR%gQTm(Uf^]xֳzuv,F_ȻoL% VXbn??rYFHDd_6BI;U[4Lg%0S%̔Sɱfʥdr+%Ǚ\%Ǜ<%'ƅK6DkA?JY9ܑUF)GYe &0K0>%OIS`|J2>%OɉOƧi92 laέΤgZm4e0 &&Bq,ꈗ=+#JO"FN7bzߩ|"o6|Kjm{}m_a@Nb%40R&ehҖu[ڊ:uJ}:4uM4oa&aεC`iѤ%sy9_yK§=C"xsq* վLW? > z9aX$X~}\Tesq#H ՌIZ>>}=G"XoIJ$kUUfHa8*"J$*nM%[y<.Yda K6D7%SJ TVŊQL)Bq%^^Dև69>Ӧzșz١#HW.Y_]h1omVLTۻ7X2H"xFzK,Eq6rd&+3R~n=O <1jl:fT op8SH_mT_pkHhŌ2f#'T:K\u+AxUITQ m\2na tTGɺpcpYve8?nWx"SBq+#1ܥHMfg+iNg\Ȟ)$o!ͬB=%:Yf oxQItxO 'ړ"I`8c'C$q"ҮaoKv:+"w]^v:'"t1\O٪_6e lhs^1!q^^缆C^-9uҌ藰N =Mp]-I˄DbB_:m^_]ْ?4!u{&$MHkU*?VU5sqwiZ断[lVM̲3Q%K8y/af7z7퇣vϣ5w= ߉[̅7ӌpE *QaBgn7cn vkVOy[t34 ]\q]v׾>kv/Mx7ʭF>3LUq QAI:$c>O[ h͎fn0ɣ;c3X*>4CK1_/}%.Ѫsjb)jYfnc \ӂ+_OIU<;gR)RRl=]zO2=y@'4z`gn6sB7[]m1aLfNM RCE]b0)G崿Kcұr% FnUiJS{zxg"AALv;"J!sUL Ɯ9Уw*X%X|q=0f !&Cr"pLD֎44ܙꎜk[=ϼi;87pt8:ÿL ^m88[wj.BRÿ(rSj3ש8CP.̵H EXWBdQnWyp,] x7R8*9_>7d(LC_}!4ZyՑm^8Y?g^^N<Gyr0ZS ̓P)C]C/|$)B}z\68M sdvnagdf ;=>$=kD@pZz<Ý'$X J͹X&uvچ.XI ET_' "2<9gxB!BPW49[Ma=m"z4072^z#jis$_{P1dNL0q+VX?~d Mʅ7+ld?|Қa\P5O,~_yxz?١0ѨXaSqx 6L0HڻG3$e,aP!V8I5h`!דMP$ _ yfSF6?1GUD[hC/@ G=3=5x} }mȇuD(ᡇZ=mckkxs;z,Pkk+nZǎ}jsG}TTF"յ~y+H$]Vi! ICnLpt0UNښ'!?Fw>jKj1{fea#HusqwQ-ITBu!O콁Uc+F%Ed2Cįĝ;A4(._@H&L oQ,wEϴT3jӨQA^cphV]q 1{}[90zlsyxߏ&jgv^ww~N\^ԊHNeoJUJ) *QQ[B-BڪT"?x DT&PBEi|f]{;v̝9̙[SD+d9uwGTp?hF' e0FH 4-Fd 09o&֍;M!In\6Jߐ{e&Ҷ{EBp[[שWODju;C:BaI%Or}'.9dZq03a.Uf00%a(+7YO` An݆^,P۵ nkx>.9 /MRE> ~\8}f ^t.]Z#.}W9?LHųK֮\noWy)",/ |HU"3s50A52AulϮH^hqg !` ^M*Wf~7Cc~\qZGi?hMdeԕժk3]voS!r-?[c(Iq.fKmk-r!J hXa"-.)!Wa*Y,N[wF(ڋW"61ⲝV nUBZ,3Zj~Qoj\~lj[i'촚gc['J-ǙF4|Jpid< .q7DҾǦ qH>JQՎQ)M g9Fw82C/,HC`˯T/hHtR뀽eb V:&|1%[vUx;N-3,GÄ[ЇvЁoEg"t9cl(J7nT*hk;.2 q!fy+2!L̠.+'KX ynl!w!'xW鱵2g(MJBʋNjYcFU5?ہȻK5YW[ w#H c^ϤXc'[*+^oc-1xR6khw2??}CtRv$*@kt>a:Ҷ; #*V M{d_vY+ZT&0ֿ !PI$ 'XSrـQ HQٖ(4:kڧ'*l xq_2򧨞y6n@>'CT(`~:w2z/ZͼT\ VGN~͔^<+ڍwicGAV%@m{*! Q!C吓IE,5|H%!W:tv25y.Tm7]m_rz_*?*%J;l=oP _~kiq>r6LitYjn{ r#EayQr{}QjD1qSΦi|~6)d@/}Qz620)YszY"MOsÃ'ɕYd.'mB!mA{h[q$/iF}h+gMhSFJJkp6<751UUTNN=  &sSGB1ubfhjl$8SuXT2=4rd;=S!_hnhtlfh/87)&eJA0M$'>G=c[QOVއA:9Dz12Oe c1R ad#r^!bvFxv*¼#oO`5<7՜hͧ~C@R (A_߳FRXP׽ !yw_`s좍l42H֖+u>q.XdrY8 |ӎؖ˰?)_azΩQbxd[wFĔ~smN+ZbL9_6ZXg endstream endobj 266 0 obj <> endobj 269 0 obj <>stream HVyxTW7KJҐμ$74P ,l2l:(}$)h UVvk7jb[KUl.ZmS,RRV 3!_ _?=s~y.x8_j4mz'ԯh^%ꂽ܀ 1[|_m6;1C?'ʸ2jI{Mўq4;nup8,ƈz |Y""z>owO}*_ l_Wӣgl6WGVq?1Zj9bm+8m-nveZԉqBzlwNKl'RN[?;lسKjug1о!P6Tyèahč0Iq i^|3yL/L|2f㫘 o |]u ,w Cwc9jp/lO?xI7~%61?^KkFP!w4YjަE1G{٘@֭ʞҎjESj~~v}XZBlELWMln^ZSBNv*elԽ^ K"lD}a;dJawfN!ǥy` tG^hVKx NR ٮ-Kd򻓝gB*}y8M:)dqTj ;8ٺޠMd$(L(, /VYңf+yYPk*r!ەea[m!8hAYaV'2Έ(=]@PVتzAyxM"S^ YPT $r&MDFцҜ_e5عg=WG jb$ T] h%2s6h YnDTp\p!a++k(3U18Lc[u (k )YqV3P8kf\J֛)Pr)Tr)RritaCLt"HPG)kG;(e/l0!=~ Ƨ)c|JOFƧdS)9)4M1'WAV"̹ùT2LUM p `@d:Ew }HjVNg\TMp#SL13tG7avqڻr_X(3|Ι/5c1{^/6k{uX.I.M$>Ҿ4j*h%H*mT*jjM_>Ta57CU~3wfq?׃ṰX}2ZoTt> kk5#/^1G "^>t=$X l33aAJs̶UTq,}hVEHi VAM68Kbf"5,*,RsY[w3bX!%W%1mT( QtY[*﭅W*L"E/9BR`f&bIl}d3U) G-JyjRAE.֦&l\Z0C\>pZ'ݱ1R\~҂Ñb_"|BPb wdԛP[̶4t[H?4o) CÕ#'4I<'^I4MkfhMyZ,I`8iq#!0/: "З_~:("tHEW~Up(%]Y8zhs̆2yܼaqy$8aC ~ vʄې/ؐ/\wZIK6$eY&!ِ;hUy$߰!ې2u BSpjfOU(o?77M's喫ZV;Tδ07o7 ]K.vW~q/Www7ݽ]ws.T7o!1g*?qE12&^nCsnuכJ殃}yqpgbDpY(Y7X#3Yʲ\|*Bױv SU%hYi4Pu0_~9̠z=!Sގ-񉵥x׭wW&׼PT,DvsbSbS,~^,C tN`O^'Δ3L4A#!ÄPQE@n2=m-^]o.pȧnr%vXؽ}rfS/7_ܵgCGgw|a{ߚTv!sx9f~:42N\.r7T$Fn29=NgoO̥̥ RQRN|95䚝VBb i<Vu{dլڠ AbC]ՔXrjw9YϾ:qU= v2!oEŲa.(J6n[+;LqEvjG 1#t"TeEURzz~;htZLkxQxXq3P}?iƳ3S{G[xnc-hG[HȚ gps zAL7x~wf'R)9)+s.`raDUEadxEYG#Pd"WzPkB9sw|ٶ[e5ưHk NV5ׅu|CMi*ruO@YP[D7ȡ]0Uw-?< w~.Y4}ZA"!7Lq05%Ij^?@OGOliveӗ2ZVP`[.ۻ'kc/eRƹZv4g)ʞXx*xa5z6Z;ОXWW/ 﫛Gz]>o]CWojB~prX؝I,Ӽ3Éu&g߶S(5}=zF#UT'8()"q[+ѕnn.MO(R1+lFESfRN |ϖ̞Α̤Qqc^Hp͊g%BY!wJʵTf"Ht?%͌O ;Wx6jp닚& $?W[l].I=h-w)AI|Z)\Qo%ۊD["%F"rT#)ܤ )@"2I]8mQ+nӏOQ8Mڬzg(5c;s݌ʠs|8+7^[5z^P6+,'dk ZeB~yz*0og x\mzNJBb<մY|b5[2N^hIS;` h7'^Z:uy񄚼\o-@b>p/HHzg|Gt<ѳ _-&cçLC/{_Hg)88/JJפO'OIzr-ų OT$\.*hOp(D.ug?:W_-?F [K$ Ggr_E:@/5Ai9#оv*X8`Hp׻5-ww!BU.\n9MFLx9Ο1> G;3r@Lp1QD t!AN1w\$$6ݦR h;}cs3ۻI>+SZN ,"r(CspF s($" hf\, i21XMұAo,6DwwQic6L2C ,CalEpo$$]'~չ^w{p}m-~HjJ]sn"2596TS㘈 {aowo~bN? Ն55n_Mm#ɃP+Կ2h'6yih9Qe20>tCL-eOxlzh[3p_8 tT8&SB7 @ɭR<񖮧4v3<5cPL[O@̇(FVWOƒ5+nս4bOwXj5aH8uM1~{nC-@Y)(p )GJQqQ Qi;`LJ~5]p]e2z4j#ٝ#~Jvv vN ]b,3w30~)dJHE`DB UljXhD:'28yw X K&> cK/^:>81>L}_gBF.Åil 4 @ji Fwd]hHj*.Dg4G-{"BC`= ,,m??dD&Iu`A}7He4hv!<yfٶ%yc=O,{XJb'-0prk;#3L~Åj?tw,8/}x 5lIdA_3m,٫JGL9p 0\]6w9UX -w/2pktmfHL͊n32.ZF#)o*a榣9O=#֑4nMCApP (7 \S_Tp@I^89k_SDݲ ֪*MP O>=I+̠G/)aN <|d` 1/S 6 j6i?h壕uEM;gTCYOsN?ǟɿɟ_6c;}ʑ_Q:iu3Hw~W.Gڗ|ܸQck<Ş # @X!+Q#JKP< a=Ƃ>K~GPe|^ wa/3P[1&㧅ƆTvxq{R5#Uq.G~v᫿-rʏBm5\uTd82%;kF1] @EʁZ*kJuz:cǒS?<֗jZtr*Id ~Ţ"bӥZ6RBBnd2S"̞\=>4([  ӎ&ieXPuy̭WSk,_ƫ=(ܽU².OQyQqE EVPD֦ļ65uLKf:mbӉNh:$i2ciNGcN&icmvwj~s{O"/*w=Uw?666Vy7`WuU{Z3%kW{s1*k&kmWz&*`roRuZX-/Hڡ0-ؑUbzbUj)b\EP),igA|ŪO{޳/-yɶ9σ3{N􁢗8O].^3'K2l,0Adâ0ڢ*x;,qؗ8 Y|CZarVCP$ݚy'qϸo%8g<*ۜ]|h{hEu‹كy@"-J)h23jkAΓ~X J6R[ˁ.HXժ@q4<-tN( >;-7\w[|ucИ~zF/5krxC#^h&^9Y€Hr? 6u 'QY4JX$zQ$:S3a9ӣ֑A~,#'W(h, ;Uv{Bp^QrrR⎤)675bR/ɖaw*=׹k]_ilOXikwvׄ7 5D2t[zf2_M_ʼ4&!GDz0&K>7pya /W*#W I'GK~Ѱ~|38=k^q=WrGs([#l_|eRgh/[ )ْso}SoR.|ʡFgڛB9_R@AlgCN&J/[XffX LC03C"n ^-5h6][S]rEj^jnfB8kgO(U #PkyҐM{ǣ[遞Û6>u0ǖ.KfKJ=0g[',~>E7~pdU[g}yڽL]fb97R YE{u,r9KJ) 'mbL1#C;~}=~?M/dOQ8Nh.{E|屫8]Qhx#bd3?A9GTˀ:'~HBO1*̾/MG}m'wW"mNyri}@){yRMkk7Piϫe 9gdIS)>P[M9ՙ(_.O.>.d&pJ/u^l/Ff jX7(č8g=3Ib]ubocb2M*%E[wQ!} 9ůEEBѭ ys"ﺫIIMޚ/n8ۆŘ q'dx-.ȣ.jdzT%M:jM!f=dy ^=QCAx]wSv[(ၭ k^z_+.zl4K-AɳG,T{KB=T2d{{ԯqW bx+2% uzޠL%Zרܣ hQ_0?(#g%8 q9FCfc)؟r>8,=Wn߳M+`+{L Vmz ,ق=_ ]h:QtY׶Er0{ͻ-dLc G6PP W'0ɢP* ٦pm.z.QG> ߆'>bMx4x:1ox:N15ڢ dj`gtG쪫]̄+G6Nڃͥ7ʅ&PP'8!ƣhp %nHq?BR^˙OODN@^>Eދj8' aq Sjx'ҾH/PŁ6#J c4/H҉pr~T=ɣGAv endstream endobj 265 0 obj <> endobj 270 0 obj <>stream HVyxTW7KJҐμ$7(B: ۰ ΃ސBRQ[XkUܱV(jj7 uVh:;BY|w9;d{ύp dI]nJv~X_ LmvSecg9S~Χ"ʀ V@c |yеwp\M[ڒc/7dowN?9q=ǩ۽e}ggc>ppj.MiiĔDZIEЕaגEc7p^sp8?t)o10(V 7իˁr9Oƿ&dkTU, 8S QT(Hj hxLDj|,2ka#ugiލ;~܊ 1;Y|_-|Ї#x?#xg8G3p9|#q fFl&t[ы]wn|{ |p؏8~<LN44B(Lh4JFUQSx6|K@&UAI.JD7T@TDŤDowO} _W l_GL&GfcTysZ8rqZCi3{|JQ#F ; ߑC~/_bn+[[8bȋt0@6P~,D1H,wa,wrOY<4Yj٦ЛPg-7}cl,tȸ#3q s&3G/]v70D"v%Kcҽ|UBNeewʄsڌu+aIH/lL)ΠL.d\:W5Qa8h+ ֲ S !q>jt!i%9dlJ߬, ѤB6+TO-m˲tI2$ J);Ά$G e1KND{ڵ.$FE"Pht HtA.Mq=Juyu6?(] ?lܼ5Bg%SRG!]3 (vĉuB}Aږ2#P;"!w(kQ 80E4e$U]r*A^c$#9EWx][/CRWTb{c5-*ۓ,1PY^^#dI-㝇wAYʟ)˦Dpد, "e YI 23"vGz0z܌-MĖu/Wf+4J+ҰdHTr'j"+h'*y6*~]zsz SAXd.?O__+0 TĬ>fV&-"!K"nB.$lvxB);]4UL՜g%2%k̴Sɑfڥdv+<%G|%G%ǙƥK6xI+zH5 S6){r:?a|u`|Jz>Ƨg|J60>%cMOI3m4m-\[;-%ST:ޔ 2 '0+THN3D|S ]o*-U d _$SL;(_֫-svjqJbOjIS;6y;m6MvbE3eӁ~ !P+iNᧂ?20HH|ߌF!!TϵݴM!){콎;7]ƙCyJLwxz+x?[I7** EC u>qcƘUҜ{=t45Vb #\#`*kd+EH . O6$ۘF 523FE;"w,FF3ݘfXaK6Y0-SK`,,sbF(*iOu1*VyژEiFQ25J"4# (hQ\m<۬k;ePmn$Wߪ5 lQ$HJsne1#34RHMptOn=1 ľh`bBR/bCɔ6{BeiY3sI:(WRdQ#\hC ӸLI iy^v'*a:qWRJ_ym q֕ZS W{`V{8}{\,ȑę8@C`8&D9d !DG'+ēhiM%ZIq 8IenS2.Be\ȸq:'"%2.BPc/ʫ%J˫,.q8_^|7fOfBzu*fB"aB" HckJ2!ѯo&$7LHwmo“5·MHMHTQ;V+Jdj-!Si{V5kw:MV]S9qWe ];;KIoXG+m%,(eUc[ՙr,?uC1FF^:'Eġ'v=n]nuZ<><|uq%nuU0[PCp!B hjI|Pz;@*hc[cOf=d_:kљW?NjW wޭoh1,Φ-ͱuajm_ib.??Z<0/l=Wp,SV{>_>qS߽49B`X3 ;W-|0ŝ׸ł]Ƃy|M vC0I)d: D]-N]oD롴uÝlِojx\H-,_w*ţ'?8;5Λ2xNbB,Mb@Lq 1XJ L-!vJ :Z"n;k@~ͨ+++":0:0:k;^Z [qŶkX¹ћ;)hv'9( 2y&kGEEEXׄwZIA>?W }bTxNRQ@C, h~VXXycMCbC "Ac[l^7JYvTo!hh-8>ra͂>5edt>Ż4>[ #A|`ӶkK ٯڮ|;-[:!-?,>nMYlmՖX-tbԬ_h@Yw6bAyY(ZO!r.' [du#ȪtXwsbW7&wZbrf~z˻JĻ&O|~ Fɹ)GvXPUT]5 Kӽ17cOxtKKg |~&m#-4)V.ţ;e8 l-<\;[V "?T9WKY;2Jej nJJje׵{Vئg|쬩^ aG|NzHD[NƜ6O (jferG=ia+Y,n?14:khwM&hԆqF * o vMMB|.w$RTkX)HA5#5j%9,Ο/k84X__h1@.IvA bG'UU@C_ۜ%ٮHd8ؽZTRoiwB`~I]2{,bwz0?618K6Mg4AK{k*Q\!e~yj+OEVH{Tfڻ/]6\h>sõ]ƃ 2^ɿ56*ܙnciڲ}mv[uHK «nۅ.lL%*!>$B#VAhb (11Dtߙ&~qO~{}̜;g=Nӳ#&F܉VK\ETyboaU=ae}c:bϤO*o Yl}͝{C WByB ki|w㚷qeɺd^YcY%Ödt7% eTR1e(ح"TE|''0+$uש7lU?ZXCJ[%gi"~{G9ML/?iԒO~17,ylQN{'y:G@RU2 >בFʚG209!3`O }Z1GeZMOzs抢6NS񿇂ws6ˑD}`0_)ſc ^:xhh5Fه O|Y8FeM~7Lإ]xE*T9;L  r\{T'D u=$Rr |B3Pie5u!6=-5'v 遬E.*rO\90(Sq=C,ڈh9S> S#(d U=>_T4 QE[ xإVn8<$A-pF/q'=nOU@ɣb]qiMFF6h#|NZ&IR}<A%C,g/b}9yZ-RcfFIgJ*q|{@O?Ǵۼ,$}/>;B<99eN]TxK&l$rNކ{l#^4Žb^e\}ά ;ƫ?KޛST0njl`3v[R 8lqFb(ծ@ϨD_,izDE"\BE~"3rc77nQ $z-XV$:=85r-C[ @dӎlz=Yz״rg [`h0m+L[ʹ-7Hjk!_Yr9;}~֠-[А372Ty]"o0^ݸee~Qack}*Í z|&gj)쀟"!nA 09\2XABi+:BQ{W~ԅh\Xڌh"Ç<. ֫ˣvܡh%6 QF ~ =5eK`l}\P^NA!"iĠ{#d_qfY(kFS+Y;8J5G\bKhQV.$[t{VI91MgUs%Fxg{ggS7#K'1Q=;*f[":8k/GP] E˷ endstream endobj 263 0 obj [271 0 R] endobj 264 0 obj <>stream H\ˊ0>Ex7 "hBsa:6v1Jj#(|xzgٵWВ؅nˆuٯMy4uʒ&x6u7^ho#ݫ|4@jf*4ziv ۲ݩ3~^v/sEC #ǎS+IF^b> endobj 272 0 obj <> endobj 273 0 obj <> endobj 274 0 obj <>stream Hl% `^A endstream endobj 275 0 obj <>stream HW[l>gvgw{m0)=xm] ,;^X )t_mnfӇTm塴QX5D%TTR*/QɺfטZu-s=kf?qg^d Nѕ+8< XN<6)5??#C&(2 T$fW$+:ɵv%BҰ+QOؕ+$`[ˈ ["# iٿBXV e@f5?yķ~ GD|$#>#كH&^G܀HڶU4mlj;z6Ռ-)-܈ 0!VU#>aP˥ xE#7̃A[lQ|qg_k2f$?a܊HZn3kFr?Qqg@ߊDRd|rw}?zywQd(q^bT2{SFmkb-GR2TBPRQЌ`BY K %{:WH_׹(EZB+N|̣yh[ʴjE_/p2r3Uwc;%V-qK뙚^{ `'^jf'0E!p87v}+}s.P0:L<%B_"BGȦpl2$M%#%9Wh^E /B)}EEi>Fr | %]k9@|Uqxs/zAԊH+@_>5¥rupG)K$$+XY#@"@"|ܧ)Hcep%Dn}1տRaNztokd-g[ZŤ\cѮ(ߩ^_xagcZyƫ gv7]°fLb'ctSI3ju uYɡ>P>ϫ]~v㳩O^I {;ֲ6!C9lώDpcS 3ǰ֋ε?hc1kv`"DJD,3ƆlPW7Mm m7/x&LƼvMޛlӛnnT?XɟU1̻rB~ Ye{X(ďXAy N'd,NSydkkoNMy)<-'G-B0=yyrZW(6|P! :R:,LEQ5o.X.NΗĎc'%˥`B0ƂI6"`L3BIL&эI&VB['Mlg?Mɝyy~+ efF=pYgaS,kc9Ft:bǨ a|/u3JC4q$ZlPlfEfZCUXUab}|O,9 "^1Spmb:tBDmlbLV+'Ȱ@u5/$HL@955gH!)%L䅶l?ش֬Ϧ[7n.>~{1z\ovxrbJQeIUT2~oKQh'JƒϮ\L޽F7.tY>ϙ&D5=0+ la dlޯdN^eX?A^ Kk4UU|twj*J e{IĐ0hUxT;*\ÊGhL,4OhbL0t;OdԔK_Jh$97o9;]z =TC+Ylǟ{^nz|h՝c#τgg,1OCN%Ʃ/B&/*RtT53b L݈C$@2i6*6+ e*QXMD?{?Xʹ.on&ƌPw09 ~ͨ \9,W4!sp`0 T+Fb@ERPvJ>14A󡈫~ pjilZbдpW#4XFuC}ޝ3s^+qҽ޺=F8{mr(= ;7n ư#H1"E}LNc(nWrKgC@XUHKL'v6>^e0Oi=g!+l6558448E3@<8Nߛsb+WM}bf5]'ٮb鍿I|iXKj6Zo8>:;mH,;_I,V})dBh)b &( kFA8jSU40H* p*\m{$jdlKTi:3F )& 8Iq*`t΄g誁nm6@lc gYAإ?m95֒=o' } BSs|[tT%R4p:?.JS65#R(Rޙ@~@I4nD@,1mWڼΕ#>!uΔgѵs.F L1 HD ;R hŽ05 r:g enI 5/pśt6h ~D[Ao4IޡNmwsB2S!ok[D_}sPzf{*:6״ġ U1pՅ` JkxA\t _X=-JAMF C 6njj\u!#plE蘆jUs%H޽Fo~XJ3~ Ͻc]1r'{ 9RW:]htwm~ \q" tvZE}/35 %IhW`CMP_GDw.Z5uv[ǸC2WP"*D5 PDJ)?M U_B.BBak?WkL\>3wayYXy%<݅0`&d XK,JEmYBJ":JcJ-+[QEJU"K\!7?(ը:Q7s/eMUGsf̙3Μmpv5 է%Վfy;E#Y1qYGw/2oc)1q#])ixY%lVDʽbiN{MfPJЗIf}՚kɶp)a$Ees(-|+1qЕZ6p-BYkj/F۰lnC`fx0}a/e;^Np0hbDnJ+=̒g;?o .XL_% ءۡjP(0G-ZIqkAAv"~K螣#܀E-y/V:V&9,(HB>_l >tW#M?r2mgɤ܂|<:NQR@~AaQ9JZvyܢ)>^r4rn wȶoyXD΁З0ڞ01 QQ)9VʑѹeiJ(A|1!D>:1sj8lA j@Kwl?cM_ w}7DǩWTrqPFS ("]E|8B;Y7gXC3U(/Mt!}gW0feχ~3kPj IF [+eۋ~ŸR;K8cE?Sjȡ|%k;eB?DeKTE_PtN@UbPt`?ij ZW)ا#CI.ITSO5bЁ@ ӭ'.~a}M 7 %:A43Ť|܌2r]閤= ũ$n~Eǐ)D4D^OKēYK uYe 4!3.3gV]洝5貂6]6@ell10yzb$hܵ32dk?uNFAk&8'g+''cxqTv*w|[WhmԠoh|p-0l;Pރ*4IitF|JE{!fOBF (RE3#i eI'41z^1uB+uP;RiHUC9yclЈ\_kbAuLIh6\Amn2c}Km3;L&Je6!e7'YLU1"p1(ŹNPr,9<ˊiP~fE9=҇[;3/YesK,sjZ1Tjjh endstream endobj 261 0 obj [276 0 R] endobj 262 0 obj <>stream H\݊0}\EMVZ/ul2v5J>x&3n^]+}׃ifmixhAFN9>gF-ft\\/L}I~4.rqߴ$ݩ;}c'53)ԚB/\vwr09e$-0#Iҍx,)IR_HV~4r^Y !j)4-AƖBR82ڔU“32Pl)ޔ9hg KTågAAf9:3/ <^#g%jcu,f{s⡵]1;uL8 ~ endstream endobj 276 0 obj <> endobj 277 0 obj <> endobj 278 0 obj <> endobj 279 0 obj <>stream Hx\$:X|5 endstream endobj 280 0 obj <>stream HW_lS?^8qp̉,!!ISj|0^ '1B)mغ ځ&mljVM+qM6&mR aoi/P'm6 Ms{~9sk_kbWL3sNxxfWo2!c=;Wmx/7@:xt]X1׊<b=i-/z;PX et`Ë*qg?`>-_g~̕4 #9寲~*idO[9cOV@-W۪v#"+ 1UVsǫmesZY??!;fem!r+u*-;vμ(+ճbQDيr|qf:|Ri^^z/fUUz>H*Pڎ5LhضEcf. UzB|1-oJAs 9Ƕ ۖ9N*+3_fT@fVI*!ᗘ-Og͐z*b%Qr?SږPi sVT~Cՙ%y +3N+^O:CMfqN A(θjTl&žXFo &t;"[ʋ/*U/YL4m\ucii%r?$qxtq+ I5hƒj?QqANX8&Rbn>byT(^(Cwv (QaU3T+c%7"R^ʇ0rheM"[ zd}ty tf,5v=P)aaиVSHdP%?N]#)NJ#[h5JB|mJջrRj#1+%%+ CڷJ$xbVSW%Wӻ"EQP)T9;pA_\7{4_7~ggij f 5(7:_! MVd:՜б,)3oqBO-5&Q֜]1:aDTV"QQR= ѝ PJ}޿l;BjQܲCa|XB8 1;pG8J!0CnjeT}@_.zXޘㄎEE'碓dxl8E6 8d@8CH!0w"tY/B_q"tW]w"xyEtFuF+K$\p.c]p{7=H+ OpŃD pj\7=Hwe5PsJ/VIe|56C`(+Q:2 }[E_+ӿv FkؿuDz:TkZ0(l𥫳@]ؕ5MA # *?wB~x0v?u5wŠk3~m惪ڔ^.2*}rN![CtQӭPRḬK7u93m;/cuwYۋV3e݅b`1"PҖRhH*TJ*U6Q)$JHM)>REIRRJU[4"j9cBK-9gf}<J8|7}پ-k?G?W̌L̜>\n^K@{sCOL<3_0Փ:c_!A[wMm#{# gxvO7B݁!RpBK uPkBlOyq7 !Sv1O wrHZJrV˭wv|!uws:Q(AH! _p4*(_3() %clܴ/ʸTeg~ A9p'*22lFc*Xm,l*O,6UDtUUBIX3{U ԛdC5f5ﴠj|`rðeetođ*yOu=ʹYy/k@ͼ'A]iOm 9! +;uJ} Vn0(gu__~W<i[g #ԸIIFq4`fmyc|Ƹ/F(@:k-4K B5VN2)6l?WQLz۾V ON'S|& uɏ[ c )~G6Y=Qk+y {gZNm +ywk!թn2'*յ@iѷoO،,k`)PU"me5P"y|u+!e;$iSJסܙ9LSjlȡ!?֛lsOP jղQtߠeIV0Y _)FSFtK]=Xq1cw!pp˲nW˥YOP~\8f:`H>*Ӏ9L%A0 uM:| ϵmQ3v G7K UJ+rӮ>Y^Khm޻&AqE KUK lƷf5kL{ 鎶T I袵V-L D*2VTPr"I'=H jf"~q67 CH`+oFm8(I<|aG џ~T0 ACU" حIZPD:i%tCD.aI >|C#`ѣZ0 7_4Q4F!t-A)xH(GWcVBUDox@SE(cK^TDh I>ƍK#} ['jii =7|o z/1wpjϝmp ȥjG?[oZjܧO(1׌pH\9?燍po{ P5UW# GGl!w8_i֜S !gF-G8N^[$كLt0nwb +19үdbԋ82cH~T+E.m|Z"8`?C>`HKs_urtT+7*>v:vR7س,vR$c?Y}vGDcvOTgma/ATᓕhe[goqbq9pjτa3gi(-6w36kȫ]l8wXqok6fl/c /1̳0<ԣs/=Q™y.؆O`EvpOٲrؖyBK(,mY]]eۅזlA9iNr>[]\"&C?ֺY]KPR$zbZۯOFf]ɹ;&]!=^ya; MlEւZ2 ǃ MzA BtLa AIh_1%?5a]c>>dY{01J]Ӝiڏpe.1FnF#ȕIjC]=<3!#R n'yuybKW<*cV}A2,eVq+ twCM`v_')!Z7TMRɍlJTriޛ+qMѝ) %B RlEs/d5j*/ %DžZި>_ q( endstream endobj 259 0 obj [281 0 R] endobj 260 0 obj <>stream H\͊0Oe(ƴ5-Pc .q^;% ~bN-|ޘcnw3%Mtc>瑘ppzh>V5J(H}R\[vmʸ-\tQĝv[S9$=>+wPaC Ő$tP}wQ!NtP)t!2d.!ÞJdP8DDe ^f.88+w\Aa7nZ94=gyFf_+R endstream endobj 281 0 obj <> endobj 282 0 obj <> endobj 283 0 obj <> endobj 284 0 obj <>stream H<.\B @aJ endstream endobj 285 0 obj <>stream HWoY:MIjP# (tlʒ]E$۱;*GsN(RЗ~h4-~0T(Pc_ vIZ>EWo|7kW/Fcſ]zp|'^\9{γXwL3cG-Bk c{ R\؍WϹKV,cK= űvRq+K_}CvrU'^?b^Mfb$4'>Vlsţc^_YJr1)f)fȉ5ƙagSJ+)bI{_ FSSue3&cѲ)Tq+*]\R}'y?1LkE ABB;j[U)EeqDRE|*#JS;վD#9|vsdbرw<{\ N8sKLɑsC,~8ő])OTi1E'.J+ y!AT@j rZ 1ZzbLl*3mMxDaeQÖ8ƣѦba/I1KkF1 lS!{tNfI$SB$ChzOP"ݒE@|YVŊQ1[*B 0A"DE*')GT#̴ŕKWUK?Mޓu5S,1j'.;B(NmYV8/<$=-<$ܧ8fuu YmԖT$4Ҙa8.ެ儶aI㜹N M<ڷQ*iĬ9֑d-Hd5UONO{g=p4jSr]ZXk)8#3'Y#mTC@'^oswr,qBssttI'3M: 3 H%X"eǮ,Њc]9v:E.B]t"t 1>XONO^v W(NopV9W]H9^\^wzΌ]H3Bb* M-pG7\Hw\Hw1JxυDx߅D}9o7\H1J #vȫ~f*<==r?]|Y5V: < b]{b&~s[[x9&_kxWQv tx8<ho#3~m3Ma^Xm@`{uvFPG"_veV-?0?g>Z'7;ٷ^*^8}rO?ME8&پq}õe=E!m!1L kǭo?YXUc7^6[ x}|2O,τ߿3 g4H_c}}ieDxc`" SGN 2jtl#Tfx_՝L&s?`@ftAl*Y[[%lraؔ7L]IwŶq\љ.%&E=k^WAґe[hZqHj;:p)h40cERvQO\OjpZwfIQВ˙̹\]fAG!?<@ȁC58fn/)NPP,Qpf ˝{0!&ubSrvH @q!V8|H8$$ȏ}6SZ\93F1|y7OΓK廥<=h ˸E7rR.z'GggA@46=8s9%3jzGgȌґ@ԂDH1!88zf$ڗ}ZZ|6zQOW .m%. lTcw.S3zᐿ2IB$ACh-*: 8( K#+1A0`b^ENS%y8\+Ɏ N(3#ӽC9ߟ` ¸LlDT쎄}z~ O^w'6ViXLQb^N)=5>n;ӃGh3o ,%ÎpހEk(pPH# HxaU!88Jf0=C,[)G$}b>`i[p7QA rF9td/򢠁$N`[y2Kh:XӀ"JH+yLK'CU#M&h%9*ʾ<ӿ~x` ﻇ_cf(VE8AX@<;m-%N"bj`Fc*QF `Nif{` ب@_. zl:Mt #ydu,9v݌L94оpj6 caR) %E`/Pn*KD,4"UbiMP"%s(k4"dt[-2LlPM*S7._ظtxfv讞 .圼X/ylX2Oȇ`J)_X--?<,;Q U СfتN 1Cq !:!̒쯑@AL FI_>u Id*hudʟJn9t?3@O < F^\>/ is.'bQ֥ѸB=3}翱'ޔ,Dq;@o4Z_ tmΑ#U8چy:!caY/=t9B e4ӣJs+UHᜢ蓠ptMic"zo{vCY?LSYܕy4jAC'0SV՘JkRɁv~QImu(.77Xmx'q,$}K Xcw<ʿToADťa&"%qQ9*O?P#(_ZfVFA'Xm`"(+銾Y~Z:ϟ+_XZx 61Sϡ1~PԖn}k?7/ʓ??s*)~ I* D@r E*DBMǼC##u$L9=c911S/}d'p/js&F^ֱ5h ِ(oQ0J'{€ϞS[Z,Z-NGn۬&&PSmjqmtڝ_{*{;{\rkuގU׳DݾViYٟڂFs z̐R)=: \:0P@p0h5b+O&>Qk MT5$5t 1>(+k>{ugӼc /ò/`0 _Fޤ]i7u2U]eb LԴUGe:re47y5}&b0vڌz=8l$1(/!]>Ty2hANPnFTS٤$N5(XÍ.~ܤ L~3ODD 2P5%AX5W&VQw,:p~:ړ)Ȕ6ܫ٫OQ=#53 >%?N˯WÉ[()D7_Rȵ<6apYYO7Poɗ{E-*Ĝz󧌶^'RGLˑq8eO]ثSOȖ'?=;`IE2"y9NcDgX/;|*shK 1gp6>B4 =@Ym"2(1db%EnP[|URJtlƔ[uMj6ȂevM?n lQʝݝŖv.Hz>7NY$-ö6m+iP)6i 7-.ZM[ߴ-/5Ӷq1ZUQYz~1:VOG#~_LI8<>:;5MG74[Z{JAԘ7S1ShRw?aØéh.iD|UTJ5-=~F1ViƆ1BOu(&.5 Ɵe$~x3FO; 7Ђ6{PnrtrLNGq3Kbbz(}a dž\3F.xt7:{B͉pb?[vi7rkUScEayu-xq9gzʐ+^XW |L+Y,/%\Sp`5B endstream endobj 11 0 obj <> endobj 14 0 obj <> endobj 8 0 obj <>stream HWَ|(M?L6 (0,[0R9c)zGDVab<"#okKt5D͇?~x='σ=Oe>mGx¼^AVxg..ZgJtPU#t]^kٵ ṋAv-4]krq]lsZ=ؕʜr9xCr\3va7,޲U8k kFKxTq}N1g\KwkrF\/72lyͥ4/sMTK w$Ex^\M $%F\oJB:JsTJTLK쮕#Ԃ[x&PvAo2t7qyЂsN\3q/*j{؛bkM(,(:l82>q<B:N2 f{YLUA hVR>ZFPUJha4Hj}3(FE$4B1Bg\``Qs`αBjjA(%e(G428!:bH" Z,UShI@;91nEyPsY<2Z^&Fs U3X괦bNgA%%Iq)ca8JCStY؉xn~J8tk$\trWI%Z-q,mLP/ }(}i*'iE 4Ƚ#$hsB(3D=J;:LIZԆ$(VדZ^ov (rIX`ճ+4ߓ5Qd.u(N3z{!g(QQ2xv*1e|AhCy àpk!bB|`f#f [Tx!\C&& x汮Sj$FŴ/馏=$ð4)S^9\eד,]}V-ms;Jل w ]aG tF2ːWy%FX;v{ԭ<>bzHp#n8:6Li@>hX5]T+0k:BWX-ޮ"* l}+Zn B6Z؆)-?*GG {*k%+פ8A3BD9-jQ'ڍbE00Yψ4eBsWG6bH8͆"4QХ)ai0+U'>\j@h, 35^JN.!#Pm2H!hLIqqAԻxVrk85N4zQ|̈́F7/> E'0Ul# ;+ )o@|S5ײM X\}.ą,\J&#r$.K k[ b1hcM Py~/d fWی7nş W.>CKxqiɯ9˘nսCi#_L$c֙|}}K3ݐwS8M+s3IOKyi*՝kwӐŴ1&W7aw1\={3EZq]c+΅0^l]n2SE<0m >M<E=Fg|<{WТ A.UW2m 4aw8 lj2g!"d^@Kwgz=ΰ/.g quJ |͸ܺkln tް#ڢQ_ ~p6|B (05][)@x*I !aP16Z_=NUVy<|Fcaƽ{G' a]}ӤԌ ,/_7'؍_-/jOu<˜'߮$1V4\QgDؼw$(Mvi݄yK[T7!ej6:z,PKgQփcS*.k)՟4TɕψD{Du 5|aL&xϐpSjm9G uX1`b-y-yƈlx&OU&EɳAdwuu]9Ufp/o@vQzlai K78=kj**VkWo' \G&\gZR+^0DjA`B^WCا~ӭ<<雡pݹ *u3=m^8RF2 KĴ<A/$B~(uei?5ctnq\MYB|8cyU$v2|[P$dO(C6ȻFXjv.~ufZc$^KC0Ofɏ~8UM03OV +Ԁ zAutETc\Rx20eys0+"p<¸f`C&v@VO|;G2Cruin*Pm>`eAYFӫÓ-j=VD)En1RD eC[ӧ>l}W͹umD6 OGtN@qjCi`1*, @nꥑk1Rxdr6eô"ydCA +;du[%qdh5|G]w}Qt>ݑޑzFN﹫;u8tgoy2u~ߨ+QGGa/u]⎪B! b?gۘ*v@iV''DUDXYɉ9on w1g=ƹ"+Rk lJ'OT \Ag=?r :cϫL7L6A&9Ev%A$KC.#R 5J3BK?b=goh?S@[%m,_mXe2-[ GSd xw$ˊCX[dUf 2J5 ]rz|uZ60e:RqTtf_m`+U6z8'K}(O11SM6phR?1cxkyVxKg]9#xl :yi xF~O9 wy˳Lېsj;S>[1m/;Yc^Tx".gsD04._0"υhy+kA &[gPȲ9X?k׺Nl(eRC3_iί\+Ě)rb5c5) EҼFq&ofV nMr2VRC z )#1UCDm0)v3ZgOO `Zqh?EsJB%jm*'?r>}%grQ\im$Tiw~/Xc1Ҳ}\xGNj޲\ qqh{.2yɡ|ApB[<ÿ9cfU8nl,h kؠV;yE='EQ |f{a=,husvʷi"ǢyVi~˹Sh{͡~"(WKϮs'J玧Fua(q[$?dO,w2\qrɽ, mĎKo?{|eZt4Jiii! :6S䶤>ł5j Qa6GF"g8y9Ps1`9;PdS\{^/T샄}dOd$qLW֓p$k=1f04u $Zv|)T=Ȩuy5M=Qĸ+lϙEs,n>"΋:MI h+ik[ΣShD9t1UcԏK>">^hAZ0Rb+^tNP2X ާ2TNZ=]%J WL|]ɝjUS{*c?:A}? u$pޝBU2 Q#6r?o:b)[یˊWfljeq.B0m%dg6/Zl]*⧌ ŷU"(>pl^~Qf]lî H3/Km."ݿ i !ٚYX.ѲX`x `)B 畱$xS^Og#~ϫ9h0hj ϗxi-ڶ]+ҞZV ^oZ1j voZԪi|Ը<gHrI MbZňMKp pVnĪ<PFrs>w?%eZPٲ2^B{l"ʞTKvQ0C)Jͬs;F7z-~:G>SNr! bQ0"O4$WGv&ll K1v8\v/F\Ƶ5k^ck~0|Y^ )SԞ?H< (OAԣLGOcj0QlQZ[]ClYlҐF ~w3L]J2La]G`à\fo|XZ֏Gf Ҙ)e2'jwx`r#Z\pïAT> # f{KqE>C N?<|r|J=oJX1uwkikܢ()77ʆOӑ`#P:f+v0GC{`J8n t`8)074J6D.<(akvRCmkm!455:`m! {kLIk#Ӆ;V%oL(``)&&f=^ǴQzQo?^l$q.]m$eF0oz1uS8ύq*Mz%{* ʹ3Rnc`con97oQ0׮0f tgݣ7K]!K?r &3M_6vq]eKLǨD*k%UʅqW5[,Y@'G@Ahds!q> '^FW6Fp㯳A縆?q?0OZHs_ǃdLyS5z{->uKA?$$ DA #K<3G_,b[:ʦ0ԓ `Atb7{ u6NwEܰo;^6Uky=4hng@FAny Q;K]`٦C7uYZm<ϯ8֡ͺw3 Cxcx-c*]Сbo_vQCxxwazW$g}@+y[ݡP!y_Nd|]-S/w>1 1 Odm`WrGBxYt­ =ޮyN8Ig_1l88`!x ULc_kU@Å(N&V"ůs`r `cO߁!+0RvZNDae7\Wh{%(?DTϙ@#f s0R! +0xF#^":at*R`;m4G'F&A'?m>,$$dHɕD(QReL|MdЧ.koEJ݋˳{5z,9QC4TAK"<4zRbo)g}f.L䝷UB<׿\AX_N+^e.LTcXc=lwc7?G?]rh W&C4 ÙY}OYV(2e$b.~|~&PGT(b"87) J,v#_GE>aSlEL[LiaBD EeF%AtTXaMP+g@TlNI[ DF_E7& 'kډQ0< &_%,8@cQv\;fP.Ă#}. 2_ɓJfʸPvJg")&m*KBE͓իݽ$KK qK.LpDyKh+?,dQPk h]}3tpfBul9R9Blad^4G`rҒ=8CSP=eMByM&2JG%AQ2 ̿,aF F={+4H)lȅ(W N)rBSIRM5 Ao9@%)-r=#A#y w1h%IB xa!eC²QoLp8WK7)|uIQc$vQVՇ d&I;}fh2!-Jr>'fwnop\Q[AisTV}\+F>)}I|4m1sZ8iQ؊-2;%;?./"|~b8o s0JgmغagRR܈tݵLJ:{*s)xS NZt "ž$Ty+V'nNދ"']+6;$11{ r2R.i :l Fg*N?81u)>ABGsFM4\Z:Oz#I`:6Ez-6|]0 Tn?r]*hQY;kOjVVgjZѪ ժ'ߔ*I*%UT~D>"U=r جdٓTI#p.}djП!.ٕm53~2l翫R@~!IΓwS.K40XvIؠ-W[HE䱱SbGopFh& u<`*XQwigNzYZ RK붅*"9*5#̪ge:Xh_ro"9Yg1`9]UYd+4u߶NtN~=7 9kgS9]@갫M(E u*UU`m$3Oq3ߋ B42}\Bgu`~Ifx+ᖵC5FڎPjQ0e}*̊0iJvuYI*3)pg q[tDkXOEVeBT#$FKX4ռD\pU+M4d~&Xڳan*>/X&;U'8 |N+K'l>Ƞ3(F#(Yd4l}vFW{4Y\@EaFw4hfլI6'o$#Կ~af/ MhmVys Ȏ(Y CdekYOo BI`*=U\~Ml B oe,>Foìcg0K=c[Fn| \+ p CDPБO4|a۬6:Ż(ۜd&.X%0@(n>K/@m^r2ɣrw<xǐΡ#2>cRצUg9gtC$oRfov -䥉lƅ1 `ӮkR:$050~Pg3ԊoUWAos" f xR˅B3xYb`B†^lI)5u\%ndD|W~}@FSE{1 j1fxglhxF?D L6=@?KbrÑ eEI&vJJ݁"1?y Yו !J\7Ĩ4vzʈxJ\^gv=ZN8QN j\[q Ϙjz /@9J رՂN@4Qeq0# +82j/swOnvd*24<ѫ|5!Ng_6W5h: `/Պ_ _M>ѩڞo25NIk 8dF uf FdYuяNnn^@폼8?) EsK~: ,RM(UA0/0T(r̊34FZ84+6"kjGƵ_$۟$ in|nscs{ y)JJ@ps$j[YS y^%|)NlW :xzJ`7RXD k{F yӿ1XZPkLx^94$&ŋ:4%Itph&@Cn=[ήGL٭]!7bAMq,.CH߰ r "ams_9¹YxZeXtaɭ~PcnvWsy_dɴ`dy:k#?XwM{zaDnH7c*Q}O38q>@f:rTO3,@ Gr`vrc]hT׸qƍ'[<"qw+ܳ~}w}շZ|WIi[Uqk+QoD5;΍l" ~;1&c5ZH1d85q9Vo5`zep}]{E&еvhfI@ڎQHNN~կWVQ!RV' l'[~!O1*d/Sί:GF5WV-JB&#^uA!p`rpU)6j{Zehc 6{Qqxl bW; *}mxxL'g x5Nc6ΗFN#xra6.-`?HlN?dղ+deCչ6x7O9DDB.([8b2]:l7x{ɪKn*/T jo,wf=f?~O`"~wr`_ ZHsi[/#m"àXiҼd}ۖy٤H&t) ԰df,h7S2p*o~ִ >ҨQ3hJ,+H)kHh/:CVwvk*rr*q/JݼH{1{f Z5xk4UVtX=-cPsPXKƿeKd؎vzmG P8zaev“Ȃx2ee쉜km[=F}nBtcQugnLfʍ`dELsLP~Ɲwiْ<(=CX:P:‹`5 Sb]͓ G/ެhF870W?B1HUavy6MbVr4l|'9JG|A כhmH KjvRTAE׍*(ȱu .۔ (Z57/t{?k]7ąXoͺSjFWl V^>s%eyf|"ERam0ؿѶE¤UTDc+&0΂(tUO󵆄%Zw#)}X'eAߙnRh}D;k9G ^v֘xIk#k"e0螻/as=X]}ñ8S붽}Nϛσy=ԥ灈W}xBy~yi9z~(ќXvV!Jtagzx4# &D/ p&ґ6!3(v  |1b]c>jg;ZgWӦhX1"i+h!;&3/Ye"E6Y tedN뢚J1%t"Z8Օt=н;`NtF4n#Xm⹲o'er^<~R|YYxo2*ﺗN#YǂV/8 aIZ5,җ=[t)TxnNܿEi,[hdA|M/YH! ߌ7 %p;gy՟?3n?2| ."x|2'eqHY_>ۧʷ_~釛n??s>z~?)?10.0<=sh8492%2]dʻȔԧ<~فCϡ|4RP*NPDu VJ Po[;jeJHf:7b9ޭtWP rv#wk+HSIܲtY%NrVU5R!qЃr4Oo,v[%P! ^E52Zrku%`"F]}[3}^ J\z,J-٣hy3gnyRPVx66 אD|X7 f]r  AþF-l}@2,6h %$MعECK#ԳЅv R uhi"OjL%^ŇQb:ͲwOGJLv=*J3i6/~0Lڬ8 _X2cTIEjrL=,fj;qT`KR־Ki #{ьd Mr}@)c.ԶA̢ZC8TFS?"Yz59]QPxPrg+`5w]䠥Q`a9D-ƩgabVMdO,<|WbJ E`2yj Vm#A<^BuDvƑXYբլzX8YD׫l/j\pN*hSÚ'Kf%fȭ22L#J !]lt^Bg!WB=yKu']Vf߳Ehdufދج‡1v |DU .$j,r2ztԚyJQbw3˞*u* Adf*74Y}*# ìqdzCCh @ս1< JefHVQc #yA>T3In`9/ƄxNEHs/hDpM5ϓX7_02c[Q\&O+PF?բHU<2Whdy;aPE[مy@Msq -@3-ƝqvH;b5 6^@E ˔m@^|} )'gzϭY9v`!)U2MaziZ%CZ Z *_d?F1)Br74$> f2]^xJ\ŵg5s_16Q;JhOTF#m ,$v()&ϙʍB+A mV\yV D'Qo$AG՜q xl~TLx/Tvs0r BZ.A%MSBF@xl yP\TL!ؼFFtX Pe )jE%K0+Sew*$~X:ccxA,W$ٚ2eԽrЉ'Q[ VAݑcVe*kjTsF]j@6,LVSf5Fg b"  Z'ICS^ЃNF0|q&D}[ &]Rmq֖Mc|NԪ`L!~Òalpyo"^OK)+BbCWDvncLB_dg%-S EYaT-()2RXɩ61&sxUv~1/ XJUXld``6srHHq6U%bs$ЭIMͩA[r %(jmeƷc~`!7Aa^$_̪P',vD@2NZM㙡hcW @}2 ÷Q5]f"i*&ӦڭW!sآ!g**4Wm[Etĉ;YE!Q6DT\K) bŁ0!P?7U(<$y·!Uu77cs\%#6U˩\[\ETׂrQ,(#Xm'*j> |9| #85:t yA4X]J(sp:t.l <AbsP)sAрn4dw?Ex/Ia( C2<vҔע*Ь2M6sbʊU4:tN\$.vVFͲ U Ξ%|ʣY8-9uNRY5S:Y(@776L^v6h ١>>n(YxPOFf֘#nĈo$X$bxpJf[;fjZD$ޙP]-dΘDSY}HOVC5e6du]]fHP0.l3V(ʮ#!ԤpT06>F?@E^"f$wdKe[fJ/ձ#VET(tȪ4!10|UVPxoʠW"1-ݧUYf vMR[̜ͩئ8oٸrìoWs+f9W~~>W~~:r302]:w3`sսÇ/Ot7#w3]&y/q5lycBAA``(YgNyڿE WOIi=bzK$V'F3 O{O<fPuVTx0Q#09q+gzfFbOs;@ c ԓC( )̾BmZX^nX~=ZQ\l|&_e 渚1(܏\bH,K[3z]-蝌:Ll Y,is /MkF4>-:.HB"h-$B '!` endstream endobj 9 0 obj <> endobj 24 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs 215.555 -1.409 -221.808 804.015 re f endstream endobj 25 0 obj <>/XObject<>>>/Subtype/Form>>stream q 215.57 -7.328 -217.08 800.82 re W n q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS0 gs 0 TL/Fm0 Do Q q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS1 gs 0 TL/Fm1 Do Q Q endstream endobj 26 0 obj <>>>/Subtype/Form>>stream 0 0.91 1 0.55 k /GS0 gs q 1 0 0 1 261.2104 763.1797 cm 0 0 m 13.947 0 25.273 -11.193 25.502 -25.087 c 25.504 -24.944 25.513 -24.804 25.513 -24.661 c 25.513 -10.57 14.09 0.852 0 0.852 c -14.091 0.852 -25.514 -10.57 -25.514 -24.661 c -25.514 -24.804 -25.505 -24.944 -25.503 -25.087 c -25.274 -11.193 -13.948 0 0 0 c f Q endstream endobj 290 0 obj <> endobj 287 0 obj <> endobj 288 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 87.3447 -147.7705 cm 0 0 m -2.826 2.745 l 580.704 589.983 l 583.51 587.197 l h f Q q 1 0 0 1 74.6635 -135.126 cm 0 0 m -2.804 2.701 l 580.704 589.92 l 583.488 587.154 l h f Q q 1 0 0 1 61.9394 -122.5664 cm 0 0 m -2.741 2.786 l 580.769 589.94 l 583.573 587.217 l h f Q q 1 0 0 1 49.2368 -109.9658 cm 0 0 m -2.76 2.765 l 580.747 589.983 l 583.553 587.197 l h f Q q 1 0 0 1 36.5986 -97.3242 cm 0 0 m -2.804 2.702 l 580.726 589.964 l 583.508 587.176 l h f Q q 1 0 0 1 23.854 -84.7432 cm 0 0 m -2.762 2.765 l 580.79 590.004 l 583.552 587.217 l h f Q q 1 0 0 1 11.1938 -72.1631 cm 0 0 m -2.782 2.764 l 580.747 590.005 l 583.531 587.219 l h f Q q 1 0 0 1 -1.5083 -59.541 cm 0 0 m -2.761 2.743 l 580.747 589.983 l 583.55 587.217 l h f Q q 1 0 0 1 -14.1895 -46.9404 cm 0 0 m -2.783 2.765 l 580.747 590.005 l 583.531 587.219 l h f Q q 1 0 0 1 -26.8497 -34.3389 cm 0 0 m -2.783 2.742 l 580.705 589.983 l 583.51 587.197 l h f Q q 1 0 0 1 -39.5518 -21.7383 cm 0 0 m -2.761 2.745 l 580.748 589.983 l 583.529 587.238 l h f Q q 1 0 0 1 -52.2329 -9.1162 cm 0 0 m -2.783 2.743 l 580.726 589.984 l 583.51 587.198 l h f Q q 1 0 0 1 -64.8716 3.5264 cm 0 0 m -2.804 2.723 l 580.684 589.942 l 583.487 587.156 l h f Q q 1 0 0 1 -77.5952 16.0859 cm 0 0 m -2.74 2.786 l 580.748 589.962 l 583.508 587.219 l h f Q q 1 0 0 1 -90.2974 28.6865 cm 0 0 m -2.762 2.765 l 580.726 589.983 l 583.529 587.197 l h f Q q 1 0 0 1 -102.9361 41.3311 cm 0 0 m -2.804 2.721 l 580.705 589.94 l 583.487 587.175 l h f Q q 1 0 0 1 -115.6597 53.9102 cm 0 0 m -2.74 2.786 l 580.726 590.005 l 583.53 587.219 l h f Q q 1 0 0 1 -128.3409 66.4893 cm 0 0 m -2.783 2.767 l 580.726 590.027 l 583.508 587.241 l h f Q q 1 0 0 1 -140.98 79.1338 cm 0 0 m -2.803 2.723 l 580.706 589.983 l 583.51 587.238 l h f Q q 1 0 0 1 -153.7032 91.7129 cm 0 0 m -2.74 2.786 l 580.727 590.026 l 583.509 587.24 l h f Q q 1 0 0 1 -166.3843 104.3135 cm 0 0 m -2.783 2.745 l 580.705 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -179.0445 116.9355 cm 0 0 m -2.804 2.745 l 580.706 589.984 l 583.447 587.241 l h f Q q 1 0 0 1 -191.7676 129.5361 cm 0 0 m -2.719 2.787 l 580.727 590.005 l 583.509 587.22 l h f Q q 1 0 0 1 -204.4488 142.1182 cm 0 0 m -2.762 2.786 l 580.727 590.003 l 583.531 587.217 l h f Q q 1 0 0 1 -217.1514 154.7598 cm 0 0 m -2.719 2.808 l 580.79 590.027 l 583.509 587.219 l h f Q q 1 0 0 1 -229.8321 167.3389 cm 0 0 m -2.804 2.788 l 580.727 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -242.4922 179.9199 cm 0 0 m -2.804 2.786 l 580.728 590.025 l 583.488 587.239 l h f Q q 1 0 0 1 -255.2159 192.5625 cm 0 0 m -2.74 2.808 l 580.79 590.027 l 583.53 587.219 l h f Q q 1 0 0 1 -267.8755 205.1436 cm 0 0 m -2.804 2.786 l 580.727 590.025 l 583.487 587.239 l h f Q q 1 0 0 1 -280.5357 217.7441 cm 0 0 m -2.804 2.786 l 580.707 590.005 l 583.488 587.217 l h f Q q 1 0 0 1 -293.2588 230.3672 cm 0 0 m -2.741 2.806 l 580.727 590.024 l 583.509 587.26 l h f Q q 1 0 0 1 -305.919 242.9678 cm 0 0 m -2.804 2.786 l 580.706 590.003 l 583.488 587.239 l h f Q q 1 0 0 1 -318.5791 255.5908 cm 0 0 m -2.825 2.742 l 580.705 589.983 l 583.445 587.238 l h f Q q 1 0 0 1 -331.3023 268.1914 cm 0 0 m -2.804 2.786 l 580.706 590.003 l 583.488 587.238 l h f Q q 1 0 0 1 -343.9834 280.7705 cm 0 0 m -2.783 2.786 l 580.726 590.005 l 583.51 587.26 l h f Q q 1 0 0 1 -356.6436 293.415 cm 0 0 m -2.825 2.742 l 580.705 589.983 l 583.467 587.238 l h f Q q 1 0 0 1 -369.3672 305.9941 cm 0 0 m -2.783 2.808 l 580.728 590.005 l 583.531 587.26 l h f Q q 1 0 0 1 -382.0269 318.6162 cm 0 0 m -2.804 2.786 l 580.726 590.003 l 583.51 587.217 l h f Q q 1 0 0 1 -394.688 331.2393 cm 0 0 m -2.823 2.785 l 580.706 589.961 l 583.469 587.238 l h f Q q 1 0 0 1 -407.4102 343.8398 cm 0 0 m -2.825 2.764 l 580.726 590.003 l 583.488 587.217 l h f Q q 1 0 0 1 -420.0913 356.4189 cm 0 0 m -2.804 2.786 l 580.726 589.983 l 583.51 587.219 l h f Q q 1 0 0 1 -432.7935 369.0195 cm 0 0 m -2.741 2.829 l 580.769 589.983 l 583.51 587.239 l h f Q q 1 0 0 1 -445.4532 381.6426 cm 0 0 m -2.804 2.785 l 580.704 589.983 l 583.488 587.219 l h f Q q 1 0 0 1 -458.1148 394.2842 cm 0 0 m -2.845 2.723 l 580.707 589.942 l 583.51 587.219 l h f Q q 1 0 0 1 -470.8584 406.8652 cm 0 0 m -2.804 2.786 l 580.791 590.005 l 583.51 587.217 l h f Q endstream endobj 289 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 93.615 -153.94 m 90.79 -151.195 l 674.319 436.043 l 677.125 433.257 l h W n q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 426.2053528 -94.2086105 cm BX /Sh0 sh EX Q Q q 80.934 -141.296 m 78.13 -138.595 l 661.638 448.625 l 664.422 445.858 l h W n q 0 g /GS1 gs -84.491539 470.4542847 470.4542847 84.491539 413.5168762 -81.5657272 cm BX /Sh0 sh EX Q Q q 68.21 -128.736 m 65.469 -125.95 l 648.979 461.204 l 651.783 458.48 l h W n q 0 g /GS2 gs -84.4929352 470.4620667 470.4620667 84.4929352 400.8767395 -68.991127 cm BX /Sh0 sh EX Q Q q 55.507 -116.136 m 52.747 -113.371 l 636.254 473.848 l 639.06 471.062 l h W n q 0 g /GS3 gs -84.501152 470.5078125 470.5078125 84.501152 388.1517029 -56.3943787 cm BX /Sh0 sh EX Q Q q 42.869 -103.494 m 40.065 -100.792 l 623.595 486.47 l 626.377 483.682 l h W n q 0 g /GS4 gs -84.4984055 470.4925232 470.4925232 84.4984055 375.4633484 -43.761219 cm BX /Sh0 sh EX Q Q q 30.124 -90.912 m 27.363 -88.148 l 610.914 499.091 l 613.677 496.305 l h W n q 0 g /GS5 gs -84.5032425 470.5194702 470.5194702 84.5032425 362.7695312 -31.1709633 cm BX /Sh0 sh EX Q Q q 17.465 -78.333 m 14.682 -75.569 l 598.212 511.672 l 600.996 508.886 l h W n q 0 g /GS6 gs -84.5049362 470.5288696 470.5288696 84.5049362 350.0894775 -18.5953636 cm BX /Sh0 sh EX Q Q q 4.762 -65.711 m 2.001 -62.968 l 585.509 524.272 l 588.313 521.506 l h W n q 0 g /GS7 gs -84.5011673 470.5079041 470.5079041 84.5011673 337.4046326 -5.9697433 cm BX /Sh0 sh EX Q Q q -7.919 -53.11 m -10.702 -50.346 l 572.828 536.895 l 575.612 534.109 l h W n q 0 g /GS8 gs -84.5049362 470.5288696 470.5288696 84.5049362 324.7058411 6.6279364 cm BX /Sh0 sh EX Q Q q -20.579 -40.509 m -23.361 -37.767 l 560.125 549.474 l 562.932 546.688 l h W n q 0 g /GS9 gs -84.5024719 470.5151367 470.5151367 84.5024719 312.0320435 19.2263508 cm BX /Sh0 sh EX Q Q q -33.281 -27.908 m -36.043 -25.163 l 547.466 562.075 l 550.248 559.33 l h W n q 0 g /GS10 gs -84.501152 470.5078125 470.5078125 84.501152 299.3530884 31.8313026 cm BX /Sh0 sh EX Q Q q -45.962 -15.286 m -48.745 -12.543 l 534.764 574.698 l 537.548 571.912 l h W n q 0 g /GS11 gs -84.5018082 470.5114746 470.5114746 84.5018082 286.6484985 44.4496346 cm BX /Sh0 sh EX Q Q q -58.601 -2.644 m -61.405 0.079 l 522.082 587.298 l 524.886 584.513 l h W n q 0 g /GS12 gs -84.4959335 470.4787598 470.4787598 84.4959335 273.9831848 57.0870438 cm BX /Sh0 sh EX Q Q q -71.324 9.916 m -74.065 12.702 l 509.423 599.878 l 512.184 597.135 l h W n q 0 g /GS13 gs -84.4973679 470.4867249 470.4867249 84.4973679 261.3114929 69.6558304 cm BX /Sh0 sh EX Q Q q -84.027 22.517 m -86.788 25.281 l 496.699 612.5 l 499.503 609.714 l h W n q 0 g /GS14 gs -84.5018082 470.5114746 470.5114746 84.5018082 248.6056061 82.2559738 cm BX /Sh0 sh EX Q Q q -96.666 35.161 m -99.469 37.882 l 484.04 625.101 l 486.822 622.336 l h W n q 0 g /GS15 gs -84.4948959 470.4729614 470.4729614 84.4948959 235.9201508 94.8919449 cm BX /Sh0 sh EX Q Q q -109.389 47.74 m -112.129 50.526 l 471.337 637.745 l 474.141 634.959 l h W n q 0 g /GS16 gs -84.5055847 470.5324707 470.5324707 84.5055847 223.257431 107.4818573 cm BX /Sh0 sh EX Q Q q -122.07 60.319 m -124.853 63.086 l 458.656 650.346 l 461.438 647.56 l h W n q 0 g /GS17 gs -84.509346 470.5534363 470.5534363 84.509346 210.5456238 120.0555038 cm BX /Sh0 sh EX Q Q q -134.709 72.964 m -137.513 75.687 l 445.997 662.947 l 448.8 660.202 l h W n q 0 g /GS18 gs -84.5024261 470.5148926 470.5148926 84.5024261 197.893158 132.6974335 cm BX /Sh0 sh EX Q Q q -147.433 85.543 m -150.173 88.329 l 433.294 675.569 l 436.076 672.783 l h W n q 0 g /GS19 gs -84.5093384 470.5533752 470.5533752 84.5093384 185.205658 145.2828979 cm BX /Sh0 sh EX Q Q q -160.114 98.144 m -162.896 100.889 l 420.592 688.148 l 423.395 685.362 l h W n q 0 g /GS20 gs -84.5062256 470.5360413 470.5360413 84.5062256 172.4987335 157.8791046 cm BX /Sh0 sh EX Q Q q -172.773 110.766 m -175.577 113.511 l 407.932 700.75 l 410.673 698.006 l h W n q 0 g /GS21 gs -84.5024261 470.5148926 470.5148926 84.5024261 159.8001556 170.4947662 cm BX /Sh0 sh EX Q Q q -185.497 123.366 m -188.216 126.153 l 395.229 713.372 l 398.012 710.586 l h W n q 0 g /GS22 gs -84.5055618 470.5323486 470.5323486 84.5055618 147.1494904 183.108551 cm BX /Sh0 sh EX Q Q q -198.178 135.948 m -200.94 138.734 l 382.549 725.951 l 385.353 723.165 l h W n q 0 g /GS23 gs -84.5051804 470.5302124 470.5302124 84.5051804 134.4582977 195.6880798 cm BX /Sh0 sh EX Q Q q -210.88 148.59 m -213.6 151.397 l 369.909 738.617 l 372.628 735.809 l h W n q 0 g /GS24 gs -84.5074081 470.5426636 470.5426636 84.5074081 121.7677917 208.3321686 cm BX /Sh0 sh EX Q Q q -223.562 161.169 m -226.365 163.957 l 357.165 751.174 l 359.947 748.388 l h W n q 0 g /GS25 gs -84.5055618 470.5323486 470.5323486 84.5055618 109.0441513 220.9036865 cm BX /Sh0 sh EX Q Q q -236.222 173.751 m -239.025 176.536 l 344.506 763.775 l 347.266 760.989 l h W n q 0 g /GS26 gs -84.508934 470.5511475 470.5511475 84.508934 96.3754807 233.4835052 cm BX /Sh0 sh EX Q Q q -261.605 198.974 m -264.409 201.76 l 319.122 788.999 l 321.882 786.212 l h W n q 0 g /GS27 gs -84.5089417 470.551178 470.551178 84.5089417 70.9919586 258.7067871 cm BX /Sh0 sh EX Q Q q -274.265 211.575 m -277.069 214.36 l 306.441 801.58 l 309.223 798.792 l h W n q 0 g /GS28 gs -84.5061874 470.5358582 470.5358582 84.5061874 58.3305054 271.3074036 cm BX /Sh0 sh EX Q Q q -286.988 224.197 m -289.729 227.003 l 293.739 814.222 l 296.52 811.458 l h W n q 0 g /GS29 gs -84.5089493 470.551239 470.551239 84.5089493 45.653244 283.9381104 cm BX /Sh0 sh EX Q Q q -299.648 236.798 m -302.452 239.584 l 281.058 826.801 l 283.84 824.037 l h W n q 0 g /GS30 gs -84.5058136 470.5337524 470.5337524 84.5058136 32.948822 296.5310669 cm BX /Sh0 sh EX Q Q q -312.309 249.421 m -315.133 252.163 l 268.396 839.404 l 271.137 836.659 l h W n q 0 g /GS31 gs -84.5024643 470.5151062 470.5151062 84.5024643 20.2541351 309.1474304 cm BX /Sh0 sh EX Q Q q -325.032 262.021 m -327.835 264.808 l 255.674 852.024 l 258.456 849.26 l h W n q 0 g /GS32 gs -84.5058212 470.5338135 470.5338135 84.5058212 7.5652938 321.754364 cm BX /Sh0 sh EX Q Q q -337.713 274.601 m -340.496 277.387 l 243.013 864.605 l 245.797 861.861 l h W n q 0 g /GS33 gs -84.5055923 470.5325317 470.5325317 84.5055923 -5.0931392 334.3375854 cm BX /Sh0 sh EX Q Q q -350.373 287.245 m -353.198 289.987 l 230.332 877.228 l 233.094 874.483 l h W n q 0 g /GS34 gs -84.5024643 470.5151062 470.5151062 84.5024643 -17.799942 346.9734497 cm BX /Sh0 sh EX Q Q q -363.096 299.824 m -365.879 302.632 l 217.631 889.829 l 220.435 887.084 l h W n q 0 g /GS35 gs -84.5055313 470.532196 470.532196 84.5055313 -30.4643059 359.5630798 cm BX /Sh0 sh EX Q Q q -375.756 312.446 m -378.561 315.232 l 204.97 902.449 l 207.754 899.663 l h W n q 0 g /GS36 gs -84.5052032 470.530365 470.530365 84.5052032 -43.1503372 372.1809998 cm BX /Sh0 sh EX Q Q q -388.418 325.069 m -391.241 327.854 l 192.289 915.031 l 195.051 912.308 l h W n q 0 g /GS37 gs -84.498642 470.4938354 470.4938354 84.498642 -55.8390808 384.7986145 cm BX /Sh0 sh EX Q Q q -401.14 337.67 m -403.965 340.434 l 179.586 927.673 l 182.349 924.887 l h W n q 0 g /GS38 gs -84.5052109 470.530426 470.530426 84.5052109 -68.5565186 397.400177 cm BX /Sh0 sh EX Q Q q -413.82 350.249 m -416.624 353.035 l 166.905 940.232 l 169.689 937.468 l h W n q 0 g /GS39 gs -84.5018234 470.5115356 470.5115356 84.5018234 -81.2143402 409.98349 cm BX /Sh0 sh EX Q Q q -426.523 362.85 m -429.264 365.68 l 154.246 952.833 l 156.987 950.088 l h W n q 0 g /GS40 gs -84.5004883 470.5041199 470.5041199 84.5004883 -93.8811188 422.5906982 cm BX /Sh0 sh EX Q Q q -439.183 375.473 m -441.986 378.258 l 141.521 965.456 l 144.306 962.691 l h W n q 0 g /GS41 gs -84.5024872 470.5152283 470.5152283 84.5024872 -106.5868073 435.2049561 cm BX /Sh0 sh EX Q Q q -451.844 388.114 m -454.689 390.837 l 128.862 978.057 l 131.666 975.333 l h W n q 0 g /GS42 gs -84.4952469 470.4749146 470.4749146 84.4952469 -119.2631989 447.8443909 cm BX /Sh0 sh EX Q Q q -464.588 400.695 m -467.392 403.481 l 116.203 990.701 l 118.922 987.913 l h W n q 0 g /GS43 gs -84.5035934 470.5214233 470.5214233 84.5035934 -131.9818115 460.4300537 cm BX /Sh0 sh EX Q Q endstream endobj 292 0 obj <> endobj 293 0 obj <> endobj 294 0 obj <> endobj 295 0 obj <> endobj 296 0 obj <> endobj 297 0 obj <> endobj 298 0 obj <> endobj 299 0 obj <> endobj 300 0 obj <> endobj 301 0 obj <> endobj 302 0 obj <> endobj 303 0 obj <> endobj 304 0 obj <> endobj 305 0 obj <> endobj 306 0 obj <> endobj 307 0 obj <> endobj 308 0 obj <> endobj 309 0 obj <> endobj 310 0 obj <> endobj 311 0 obj <> endobj 312 0 obj <> endobj 313 0 obj <> endobj 314 0 obj <> endobj 315 0 obj <> endobj 316 0 obj <> endobj 317 0 obj <> endobj 318 0 obj <> endobj 319 0 obj <> endobj 320 0 obj <> endobj 321 0 obj <> endobj 322 0 obj <> endobj 323 0 obj <> endobj 324 0 obj <> endobj 325 0 obj <> endobj 326 0 obj <> endobj 327 0 obj <> endobj 328 0 obj <> endobj 329 0 obj <> endobj 330 0 obj <> endobj 331 0 obj <> endobj 332 0 obj <> endobj 333 0 obj <> endobj 334 0 obj <> endobj 335 0 obj <> endobj 336 0 obj <> endobj 380 0 obj <> endobj 381 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024719 470.5151367 470.5151367 84.5024719 312.0320435 19.2263508 cm BX /Sh0 sh EX Q endstream endobj 382 0 obj <> endobj 379 0 obj <> endobj 383 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5049362 470.5288696 470.5288696 84.5049362 324.7058411 6.6279364 cm BX /Sh0 sh EX Q endstream endobj 384 0 obj <> endobj 378 0 obj <> endobj 385 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5011673 470.5079041 470.5079041 84.5011673 337.4046326 -5.9697433 cm BX /Sh0 sh EX Q endstream endobj 386 0 obj <> endobj 377 0 obj <> endobj 387 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5049362 470.5288696 470.5288696 84.5049362 350.0894775 -18.5953636 cm BX /Sh0 sh EX Q endstream endobj 388 0 obj <> endobj 376 0 obj <> endobj 389 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5032425 470.5194702 470.5194702 84.5032425 362.7695312 -31.1709633 cm BX /Sh0 sh EX Q endstream endobj 390 0 obj <> endobj 375 0 obj <> endobj 391 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5035934 470.5214233 470.5214233 84.5035934 -131.9818115 460.4300537 cm BX /Sh0 sh EX Q endstream endobj 392 0 obj <> endobj 374 0 obj <> endobj 393 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4952469 470.4749146 470.4749146 84.4952469 -119.2631989 447.8443909 cm BX /Sh0 sh EX Q endstream endobj 394 0 obj <> endobj 373 0 obj <> endobj 395 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 -106.5868073 435.2049561 cm BX /Sh0 sh EX Q endstream endobj 396 0 obj <> endobj 372 0 obj <> endobj 397 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5004883 470.5041199 470.5041199 84.5004883 -93.8811188 422.5906982 cm BX /Sh0 sh EX Q endstream endobj 398 0 obj <> endobj 371 0 obj <> endobj 399 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4984055 470.4925232 470.4925232 84.4984055 375.4633484 -43.761219 cm BX /Sh0 sh EX Q endstream endobj 400 0 obj <> endobj 370 0 obj <> endobj 401 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018234 470.5115356 470.5115356 84.5018234 -81.2143402 409.98349 cm BX /Sh0 sh EX Q endstream endobj 402 0 obj <> endobj 369 0 obj <> endobj 403 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5052109 470.530426 470.530426 84.5052109 -68.5565186 397.400177 cm BX /Sh0 sh EX Q endstream endobj 404 0 obj <> endobj 368 0 obj <> endobj 405 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.498642 470.4938354 470.4938354 84.498642 -55.8390808 384.7986145 cm BX /Sh0 sh EX Q endstream endobj 406 0 obj <> endobj 367 0 obj <> endobj 407 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5052032 470.530365 470.530365 84.5052032 -43.1503372 372.1809998 cm BX /Sh0 sh EX Q endstream endobj 408 0 obj <> endobj 366 0 obj <> endobj 409 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055313 470.532196 470.532196 84.5055313 -30.4643059 359.5630798 cm BX /Sh0 sh EX Q endstream endobj 410 0 obj <> endobj 365 0 obj <> endobj 411 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024643 470.5151062 470.5151062 84.5024643 -17.799942 346.9734497 cm BX /Sh0 sh EX Q endstream endobj 412 0 obj <> endobj 364 0 obj <> endobj 413 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055923 470.5325317 470.5325317 84.5055923 -5.0931392 334.3375854 cm BX /Sh0 sh EX Q endstream endobj 414 0 obj <> endobj 363 0 obj <> endobj 415 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5058212 470.5338135 470.5338135 84.5058212 7.5652938 321.754364 cm BX /Sh0 sh EX Q endstream endobj 416 0 obj <> endobj 362 0 obj <> endobj 417 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024643 470.5151062 470.5151062 84.5024643 20.2541351 309.1474304 cm BX /Sh0 sh EX Q endstream endobj 418 0 obj <> endobj 361 0 obj <> endobj 419 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5058136 470.5337524 470.5337524 84.5058136 32.948822 296.5310669 cm BX /Sh0 sh EX Q endstream endobj 420 0 obj <> endobj 360 0 obj <> endobj 421 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.501152 470.5078125 470.5078125 84.501152 388.1517029 -56.3943787 cm BX /Sh0 sh EX Q endstream endobj 422 0 obj <> endobj 359 0 obj <> endobj 423 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5089493 470.551239 470.551239 84.5089493 45.653244 283.9381104 cm BX /Sh0 sh EX Q endstream endobj 424 0 obj <> endobj 358 0 obj <> endobj 425 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5061874 470.5358582 470.5358582 84.5061874 58.3305054 271.3074036 cm BX /Sh0 sh EX Q endstream endobj 426 0 obj <> endobj 357 0 obj <> endobj 427 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5089417 470.551178 470.551178 84.5089417 70.9919586 258.7067871 cm BX /Sh0 sh EX Q endstream endobj 428 0 obj <> endobj 356 0 obj <> endobj 429 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.508934 470.5511475 470.5511475 84.508934 96.3754807 233.4835052 cm BX /Sh0 sh EX Q endstream endobj 430 0 obj <> endobj 355 0 obj <> endobj 431 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055618 470.5323486 470.5323486 84.5055618 109.0441513 220.9036865 cm BX /Sh0 sh EX Q endstream endobj 432 0 obj <> endobj 354 0 obj <> endobj 433 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5074081 470.5426636 470.5426636 84.5074081 121.7677917 208.3321686 cm BX /Sh0 sh EX Q endstream endobj 434 0 obj <> endobj 353 0 obj <> endobj 435 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5051804 470.5302124 470.5302124 84.5051804 134.4582977 195.6880798 cm BX /Sh0 sh EX Q endstream endobj 436 0 obj <> endobj 352 0 obj <> endobj 437 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055618 470.5323486 470.5323486 84.5055618 147.1494904 183.108551 cm BX /Sh0 sh EX Q endstream endobj 438 0 obj <> endobj 351 0 obj <> endobj 439 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024261 470.5148926 470.5148926 84.5024261 159.8001556 170.4947662 cm BX /Sh0 sh EX Q endstream endobj 440 0 obj <> endobj 350 0 obj <> endobj 441 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5062256 470.5360413 470.5360413 84.5062256 172.4987335 157.8791046 cm BX /Sh0 sh EX Q endstream endobj 442 0 obj <> endobj 349 0 obj <> endobj 443 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4929352 470.4620667 470.4620667 84.4929352 400.8767395 -68.991127 cm BX /Sh0 sh EX Q endstream endobj 444 0 obj <> endobj 348 0 obj <> endobj 445 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5093384 470.5533752 470.5533752 84.5093384 185.205658 145.2828979 cm BX /Sh0 sh EX Q endstream endobj 446 0 obj <> endobj 347 0 obj <> endobj 447 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024261 470.5148926 470.5148926 84.5024261 197.893158 132.6974335 cm BX /Sh0 sh EX Q endstream endobj 448 0 obj <> endobj 346 0 obj <> endobj 449 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.509346 470.5534363 470.5534363 84.509346 210.5456238 120.0555038 cm BX /Sh0 sh EX Q endstream endobj 450 0 obj <> endobj 345 0 obj <> endobj 451 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055847 470.5324707 470.5324707 84.5055847 223.257431 107.4818573 cm BX /Sh0 sh EX Q endstream endobj 452 0 obj <> endobj 344 0 obj <> endobj 453 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4948959 470.4729614 470.4729614 84.4948959 235.9201508 94.8919449 cm BX /Sh0 sh EX Q endstream endobj 454 0 obj <> endobj 343 0 obj <> endobj 455 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018082 470.5114746 470.5114746 84.5018082 248.6056061 82.2559738 cm BX /Sh0 sh EX Q endstream endobj 456 0 obj <> endobj 342 0 obj <> endobj 457 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4973679 470.4867249 470.4867249 84.4973679 261.3114929 69.6558304 cm BX /Sh0 sh EX Q endstream endobj 458 0 obj <> endobj 341 0 obj <> endobj 459 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4959335 470.4787598 470.4787598 84.4959335 273.9831848 57.0870438 cm BX /Sh0 sh EX Q endstream endobj 460 0 obj <> endobj 340 0 obj <> endobj 461 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018082 470.5114746 470.5114746 84.5018082 286.6484985 44.4496346 cm BX /Sh0 sh EX Q endstream endobj 462 0 obj <> endobj 339 0 obj <> endobj 463 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.501152 470.5078125 470.5078125 84.501152 299.3530884 31.8313026 cm BX /Sh0 sh EX Q endstream endobj 464 0 obj <> endobj 338 0 obj <> endobj 465 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.491539 470.4542847 470.4542847 84.491539 413.5168762 -81.5657272 cm BX /Sh0 sh EX Q endstream endobj 466 0 obj <> endobj 337 0 obj <> endobj 467 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 426.2053528 -94.2086105 cm BX /Sh0 sh EX Q endstream endobj 468 0 obj <> endobj 291 0 obj <> endobj 286 0 obj <> endobj 22 0 obj <> endobj 469 0 obj <> endobj 470 0 obj <> endobj 471 0 obj <> endobj 15 0 obj <> endobj 19 0 obj <> endobj 20 0 obj <> endobj 21 0 obj <> endobj 476 0 obj <> endobj 477 0 obj <>stream HVyxTW7KJҐμL3o liXt&6,-}Cb@EqX"nuTw"T[EݴXRwVE(ܙү_?{{y9w&ne퓦 wo'{!Ff;:o//{ /vv~rPU7t%; j[بyk7Rg{~۷mґp`3v'ߛv"6'{Ξ-۶gckpjSh/\l|IZ)Eײ%K88qø?tQ8caPQ'nիˁ7s9?&T+OT~I) xYD)8x If\٘X%XFHb2KԊ"q3v>>x<;u|`~Opf%QJ,̅،MA~=N܅8x=|f *Q4ifj-(AG^TE!HA 4~mO&UAI.J!T@TDŤd*|UZ_/[}]_2ly3;pVS-k^Qi-m~k~+E#D[~Gd~)sM8_=j}e'F_ϪGՃ`qFh|~'+f?,P#לZVUhZm֠MӚjz٫uǕHr{m";=s7O/dYVeޅ< y.dʬ繰;;lPaφx:ptq<0g n܄"{@5މk.0 jq L܆![ߋ`> 1_L|3%U\E&#$[^,QwЎq=~ ٤Mx=-]^jv .{;S1mJxS~RT.#VQ 8{#ssz/Q"p:hnCJ*Re5,U훙 Ng|.8Z)#P:Sti$6.t,R3Eid]$p8IݓzJ鞚c=l)]Ob3uXH">4 ֻݸ2U*U"ET/a㪼k {ߖ|Ll8R?JI`f[F8^}vI~@Gnl޽:S:Os[5I_v\b2U=:+ \ phǢ#EOy3: vS9F>S -C 93V]{(WRtEuB؃5!^ϥg3$t/_/pT3YSa*fփ;x25N >쿌 d'ˑa94= #!4D#z`[d16 fF:I'cl;A6LM"di ;ICdiLȌ l/bOH~+">/!m /{v}.{ 52(iK jɱO˞Ҍg J#X'+5( BϯwLAI~ $3%%)h{A%ik|ݠ$AIX/]TLJ ɽ,RVXe%fM̴gqY\UDlm05?_?3?/Y/2LZ$X1/R֐,3q >p!,&=}ZV\sYtn Z񱈿.yt .cwF0U 6VJ'C0E0UQ`A&Ի\e&s/[\vMt=ln C^]w`t"htۼᬸѦNEgnMR!~pg&c7k(f+΢0 U9]I̘ \9M`N kri.2<EX--eUPAf"Z2Pg޲` |&aDPظ/~pCÇ`Gk1*G{ʸ`|2!G+rLVe'RvkD۶l9פ7DϝǷ /`luXZک XZ .I&ʇbbǐ\6S'E:dn y! q76ͮ [Ee@U$@cGۺHlLh'[ĺ7j'_YYU&;VxV36ɛl 0{b08<@3D\oXq8,">z5|ȑ5FAOd%bEz(؈] 7l ZA|YI>8]1"e0IKmY#ZG ,N9m h|]3bRh(W5Nof v_'Оf}-f.bbV݊~bn j YЗD|-nV=ֿTihfF[g)41" ̬sq99U8[V+X'e {w*; e[ e7=XWl]+W.Kߍ9Q7DcjJf[~VBi}L/AӔ*\Pky !GNi]au?`6m@=fǻ wF~1y2{7`N/k2u ';@-AEV1<μ@3/cCr,+q>㬁v'Cf=?^wַ?̏K)4(,vDQȢI< װawayUK}սDEߝֱ̊|,ͯ]|)UWYAqwtGg|"XzD| z^ߝ(Ăsϝcf0wq?g Gyn7BbZѮtg !a14X ì^> >2&CEZiǤenôߘ#m׿~HGG%v M3ЭB_" fЉx<} ZX?Ds`px&BWNfr2rQ>07Rvy1J6<84J*6FUd;Ƕ̅j%nmfc~P4i4 M\G/h6հB )(cL,D5d1%W0M]˔|\K9!FTqZsg҂׋,0 `gѿRH65LUb6?_:K:w +Xu\Oc|fs[ `>vgTEmhR=Yu,fr{oZ6P1uKz%ry2DZӥS]Q~)Ho(FN`t endstream endobj 475 0 obj <> endobj 478 0 obj <>stream HVyxTW7KJ$yI7!l)Pt&6,æo$ %*ZUֽVEi[KhV~~%Ӻ׭ 3!_ _?{޽w;/LCnv7w!5]"ӖM#3z==y'PU8nwLjͼ;_ O {w sDDp0qxI>m߹+ssmJ=r@{I-; FY.<+-_Yq(qF(ݥqŠq'nzx9WÁ2NTNSh:N5d'Hÿ ~c5qs8aWLi<$qeI MhLE;.\,",2q lıx9h މ]^|Egs2nm܉08aQZ\۰ b>v>$>}:؏4Ji_h˩fQ DM#/ Z MSxN|KH&UAI.J8t"o Ix]U *|U:_[}ݍ2ly28Hk^^Gimm4vk1v+E/D7[vkGv]b9jG5jUj7H?ޗIZ|6u`>Oߤh}]?WԳTCtZsj%ZVZ6Ckזj봫ff6Orky3so2#^ʲytJlS̖Frpe.y`H QЀaf&fg{y13%W0_l܆ +q@u ,w)D E`|q?zW!'=6؄'c{ExS,CqS-TMKPg:U}}'ٞ8fiV9YсK0X"r%+#ҽz]Leeژs cJX!sIvO@jhT: 5Sa(Kw8敎Fkɘ(ouX,xl歑mJߦN{ Yټ#P=v[-%-ːƺ-+ 8+In#8,Iv@:M])ƠP属@R h2$"RmF2fG*+fX^KȎ1 ڈt2/rq#I BZ2բPz-u̺o!xGc_`>]1n[F\%/*Ry/9;F3g"e߂~KfPQ^3ia  !CKu~0*^yxlHG veII[Z@5jnc0 XdunS~evL46*- Ie_,Wr0U&O9h,hIί25g=WW jb$ T]$)h$ 14h51YjEXq\pAa{ˉk0Snѯ8L[? )YqV23PL95S.%̔[IL)9L+9L(94]m!Z%]-cգ9iTٟS֛o"gS1>% ƧdS)lf|J-Ӏfmڡl*zVS2,X(.E#>P'tm4T-\Tq#SL13t>G7avqzƶu{mm&qqھŎƎ84qi|5KڕcGGY7li*F4!e@0&JH ~LN?݄DksCfː<}{}SbaN&8on0NR. uVRdțrU{ž8JJKTLʊrcY Q\"TTj){GWšǓX|-%1WFE̢(UQ<4~녃=}x=5)=b2 ]ag Dd\h9(4L z]`dS3f 6+t dNyfȃbMAĚ,5Y>F#B#ȲrT vL%qi`K;!줴KG]v )u-ʫLivNWI\=ǨAqa,#4Aic T1||啔֠BAF *T>m|/+)A /b)xѠBAKvv3G3sMRi{.ڕ,ܹc6ͪr4^-SkXQccVʾzquyw?_eorYβ`Z1;O FdU rD"_†[YLcChnCN;xh{\!S55R*߮p*P1$YR쬀㤪Z+lX-p$SөK=rVgKb(]WLN~F~7t֥uQ ]#3hQѶ߽SFm>nNzCv { œQBX~ƬVUTаW`큨>r9^ܨNVW];bѥΖ쥹d$5Ov]o?ޕ>8ߕ,X>92ĪO6{_C^ب:54.q^:2E)QUU" НX/N:{"4+rIDR؜A#0nLI~E5b\+[ "RpuH+ iV(fz) s#.M3]rUqg&xna@p3>شPrEZ'cs]7i w:Fj;;wx[}{;*Bfcf9dMsV~,LFXjUV%/QװF\vO8)X^6ƠD%%"zy^':̙FXU9a< ˽]_ {5<$)' hm Y5|2@ ) __{?Xؕ%qjzn*gUn* yjR^Y>rSγIoq>?Q|}CF4ڭ^<^E EǼ|'1N\bls7yUol+Ծg=g꿅v=M7U:%ȢL;Sdܿ0A O7 :z'tD;;hVߠ-C^VHSَZ*U^zt-"m?hhʽv>0z4% r-׃G TϾM%O.8?),}@+1Fd#aQ;{jٟQw~O^S#n ϧQIޣI}R/+4BYPE> >i8IOE/6'QM@ R#GY}̅օ<m'nogp^}G=I 6{9|2pl8Lh/Sj~v~cKFT;y=B)_y ӿhUDtQQP,F?$z&4 vfvfSɝB@/!BL} nP!&3gΞoHHב%ޯU`g~(P%oxoCM4>1*_[s~FmOC#L/)xb,b E.K!! /ys̆*kubԕaJɱ뺫da;eѶn'LVJrvX^ % LX&kES\G-i*9Y$Y")ah > endobj 479 0 obj <>stream HV{xTWG'IC.{v fym{w$ %P+ڵ*b*J۳ZmVj~ԷZ-svCH?K~wsfo6+[~÷M~Pـ{ervSecOYS~w1**6mNt]L6A~ /z \$>~^Do_Io˶;_hM+}_}1^nSk=pmJgN#$ZR #WF]K/Y9q8pJ(ݡqà cxOZ12 RV.?q/P95TkTe k<\gp0%@/2'JQƑ Јhr<,B,rFЍWvBNlu؉ø)|ނ "n÷p; ^a<,9QJ Ћ~lva1 Wqqp~fL*14i.6AaZ@Q05$4S4$~m穁L$&\p<@$"PRNS{ 7x9P>p'Ph$6axXi>-NꠅQSNV.8Ӂs8&dpSƴP7]KhtaQG!ǽbu'E%:aomNi>W|nx윖dÝ5ށ}8o~XJ:Fki#m[=~[)j8!~gr;vo%K̭xev|{zQ=,73҆OS:pJ;'O8^0~J2BjFm֦ujff#/iyʌx>˲24; ǘ- .,|Y<\#?1 KuxJ=˗̥Z/5y*lϓa+v®dóAMy6鰟'ҙGyB|8̜-q-Їr x7. bϊXS#:2yYRS65ބ:{ ]G{Nǡ[;9 2g2)$V##(Yr.,GVť֐'LtW’̾ J2{R3EGcٸz ÑdD#qt4XĽWOŅ҅fXH]wB(}< &0D(]zjSOmn[K X!w[VP:Lq6$82W8.#$FqXt%Үu!4*b=ZfG2,R"-,nr+nX^Kq ڰt2/rq#ںIIBAg jQ8yĉuB}Aۖ2;曃yEGB~H ע0 pamHHd]T %WHt\]uYoAmKf`Q^ JִJteɆB":?!Kzn9< RLY6%3d$l-d '-(xaKO1ftY<"w{2{^aQ^O%%B4z;9.VI\ GC,VcW{ ~³ӫW b$9|R]i KdgkUi\"+,+4BfwP(e+yS@q0@PViRefڡdv*9L5n%u383x3]$Ӹw9Æ,jERV(攁QeNYgBz OI/S4OƧd#Sr"S)ibvM&-EkkdꙪW'2Afa3`D CM7Rl]T S[M1=T^m1m^wll|) \p3`d;K64YWH+)}Mbr4ӤMմJCiI{2ꔇ糹54,w;~U t#>q#iA7us=CW{xD󤢥7Q= 9!Wf!++Y5 b0^Qh"LMzS+ o7ūJ"[*m0m`A1?3Ylu Zxxo?p.,%ap p3E0 ƻ:TA%>2E *KTwZۺ 8AMA EVЙJ9͛+lzѮj &vzU֕LXۇvX2\MUu4 8VM7MuBz:4igH7u " ؆NKj% N s69TY43]BE/pDTB;*ė8 7\>'[Ngiz١zٟq(OFJIøBcpV#5.>POG>|gߙA(Y 8GXda@QND67H#":_=фСe˙0fdNY_c3mD$^&GL$IX4cjTSd͔(~JobOb~2F3wd1ն`']N7D) i,ޓuC76|ia.6wUw<{xxDgo<=~鵹-J}=Ymūǎ]uo ǭym83#9@JTZ$(Hfd7:,4d7H!P\=󙚠P4I*-$HCw\%ISk7XlZf#ڄS]X‡H#m|Yk1F~~Խ|mcS+=B}o'N/(mwk\ +e\I3{5$8D6*LؒBe.hiQLimm ;m#⓫P䥴yk|1;;͌حSwg{M)C8GnSZCg#XW;fgQ%m"Oom0y+8|~lǰԱN)}Ts%˯Ī)>1'Ȭ`|S,T.)C28B5ņ;7^tɐs ٢3Y)S~F^W9;)rE,s]E1Yc(LJ5)֒#l{ztKSX+m2_SLխU`__} M(YR.Q=) Ymhg ieC7p8\s{?vL(amkkW.O /0Ihq{M'y$rAX/*tu^8w秠Gx? USáVXhq@`U:Y=ַ?٣i! QB[hHjCV6', mq˷rr"F >m8@QAPp{8;s>`kkxWr??nIʦ5c[s S*v4 0KY0 M&ֱ NALul%@G2}ى9tY:Hך=HI-t+-5#T, 1 ~㌀FBGlv-0\Ia_Id.ў zG R3K35Ck/my8YS?DEr=\lrV4v 3l\rLfg]MK8k>κև&ଥ8kCzT#>j X [8skXu n% rCǯ.Se祍n襝qJ/+fZ^I *&amlQ^v:5 @qW,vO.x^}?q3WnW3g)+ŝZIqb%{p Pq2Dt750#<|ԉӷL}iSܫbӂ .>" *N%qky1GMs"ϪqΗڜ1~|9/y/J#b kW=@Bf ^c3 eϿnKe1C*p,bd$UA꘏Qi' ~bd5Hj!Spts*0)}<\wĝ}1eXCjɿgı2|>stream H\j@}L.1BDEB]e5yn,)TeYgt8~ۚqugho%qkPoGnf|+BI_Fo ΋UލgZ{*V_e~}H/"Y&:B/ $|mN}c5d1L;v4OMKW}2y(|i[2Ș"(U -eFLrJ@1(eچbCw+gBw+gBw+`B@UQEaU˄1j&f@ 6)@p:ܦ.i :28!S$r̢!?ࡐ x(pf  tPP­)x(S{t*;b GKxPEC9%ΥW)/۸Jڛ#ތ׋wݽ IX 0@@A endstream endobj 480 0 obj <> endobj 481 0 obj <> endobj 482 0 obj <> endobj 483 0 obj <>stream HtDžـIALmBB3@\ endstream endobj 484 0 obj <>stream HW[l>g.vqbJ&esbCI Bp* )h)60Ե G4nkeY1ˊ Yg)gQ033%/6sX<\IȃaP`R#a.hYVb"}Dž [%) yCy(EAKP¯3t(=PDڶbg]WU+1rp#hv1pm+"0idK/f=,hC[MwZmm[hIʉb6.:t 2&ڌ}XG0jQ\t6ܔ0@ feHZ\lGMGZ}/E@6GI- AwKwHqt:; A3 '9r`:<6S0euyz\Wg,d'KNBe2J)ukԉCQSt ˉV8|-\`%$)N/&nƴ~HS7EP!3ʍ#((7鎊Ww|(5ӝ&_՝f_y=gC9Kz/H\ Qʋ2Fm(/y:! P!>JPF >QV u0 pt< ]c"p\Ny1ű#aCҐ6訴'gB#fYuRgc#g|q'_o$O9IڃB; 1=q".Np ۡ&$a 67r\3*LxE@gv0NiO74-*$6Mqiو-2I Kx{ fɄM#}ؼ/1ike6AO.O6663!<Qd566-h|4µ=Z]RvĈ",x-z̪ZhWC%\4AXF0ZQ3&&U//k^wkxwĨƯO\/$4fqZl0̂L6a% VxB~E*"]숕7<_ԺT(hB$`ᆌg^<.KkB-F-jCZsBVTi툅y-HA@=p 1 uv;(vy[̦]Z~t)@_D]~zs& oBEty.:<<D&Sh63 `9JA0 _@_N~!:_κ~!s_Cw6 $=L;J"FkKDη\q.]]pG+oz˰OpՃHp'\wE"P,ix} [J哕zk录Y\ZHFx,/8?i%t U$gB$2ԻgP ˜r{:EoWD3wt?қw"lzOS(` DU$`h_d?{7m t.d(l@x8@FF. <;9ٟJt4: SN&tH*K5*Md7剢S%-a76H2~_OOwh$96"MBǖN̝=;۱坷o޸ʭ7O]sߌWklY{g{hb~Nbǯy48i^vM'iJ6M-a-hٕ jAa? *$Z-BJXnT)X!q88 !gts;ԇ`8E!q""fXG$Eo\"84o~Sy߿ȱGp ԍmp_1=2V9`_XU+s9rT~JD]{g(~,fyA+r4$ [eMugd2x㙀;AxNUw9fm@ǯgexi!K:KN &@{II㐧CrC?!P;{o=|m, /ӦGyh%9W`hvk 9K ܆9d˨If?P`o+ZzvuUFχOwkv*}rRT'hDNP!/ *D QUf4!e)&G$4f$*R0cI\\FO.LN&V ^U /ɡBk7~rWoW[]ʖ7>T K]Xx ^p~H;%cM$%sdА'`3/sOo+򅍳h yz -PjRidAw URUҕOzˀ뇀^a3a2̨~b۸ɰfdbX& +2/p Z"GL4ӦH[WlM (8,G ;@HG>ϯ(b[OggVUiKZRMFGݺZcP*NVxLղ֙ް2`wVO9ldYV*1C1.%ݲֽY%U4?6:0޳3mukw+y榍@v69#a)6툹u6нԙ- 7V2}4̼җY)Lݾ軸}fBr\@@pA{9~\gIV9bo_>GJ0ߕ[{b3:2#5&Ze#qRy%גh3i{㒞N"ydbTFKw>]TLul};z$/Q_PYLܭ;[[$]L3I`ҫ0ә`ǭѵRZGKߌG=dYhs{uF.@q?{e}cxjnbZ_; 3߬{/VHf(R:EXP0 {8s<ASq/YyQyqPyUk]Wߡ9_gdzQa9 $_ x)6t{ ;jfu^ue3YCU7 ޝ)[qA%[]H.&ݥ0+y'>+ZDt<5Qb,ˊ~+feoW9j'#YKOՌӰfăC>AƩXW-u'M6l+nSW(7).۸R.cI j;*^DI$ZM$ij WF_ڨM}HFu"A,HL.&>iIvQV{dGePO~SwwS~ {;Н̇;=rCVoyx'^_w."b n<_wHj_qI[.[^|ER~#c}垴ccMX7G2iB{"tE[[xcWLcljT='$dBإcVQVnws oQrCT~Y)Lnt!\~;Eu䏨_)`4UZ}ĎS)-r{a*0g_Y2Q3hgP.>t Nž`{DANB  c]ߥzf-@Mt <+RB^ W0}s~R1: J-/JE,rzuOV~xmr}kh;l:9T/`ͰX1K _Fwa(mr,r*D}UF0Km a=o㢍]w!&s\"Fc;xKXŖ4nJ^3ga~S%x6ЩMf+Յ4Ryu%D6D*7@6hdm :/*%vKqTO"Em0-Bع-xuj}ЬVzYu4YyZ TDѓk$"}CQ3&sJa-@@u#5M6P{5:FUv촽u6p*h?؛OFf{IpD șдwf~"0 h9X&KQ}Hxbjz~"|)ԶbFFbt4vܤoTt\dL3rs{vQ%Nm/ endstream endobj 12 0 obj <> endobj 6 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 486 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000073335 00000 n 0000000000 00000 f 0000073392 00000 n 0000290125 00000 n 0000073864 00000 n 0000203631 00000 n 0000221222 00000 n 0000153491 00000 n 0000203385 00000 n 0000290002 00000 n 0000112356 00000 n 0000203508 00000 n 0000261551 00000 n 0000154351 00000 n 0000155194 00000 n 0000154757 00000 n 0000261686 00000 n 0000262089 00000 n 0000262503 00000 n 0000260994 00000 n 0000153347 00000 n 0000221287 00000 n 0000221532 00000 n 0000221908 00000 n 0000074419 00000 n 0000093934 00000 n 0000110264 00000 n 0000108332 00000 n 0000106884 00000 n 0000154488 00000 n 0000154623 00000 n 0000155768 00000 n 0000094000 00000 n 0000094238 00000 n 0000094612 00000 n 0000095114 00000 n 0000096825 00000 n 0000100401 00000 n 0000100826 00000 n 0000101631 00000 n 0000102523 00000 n 0000153284 00000 n 0000112469 00000 n 0000153037 00000 n 0000153161 00000 n 0000112532 00000 n 0000116904 00000 n 0000112293 00000 n 0000111586 00000 n 0000110941 00000 n 0000110312 00000 n 0000108381 00000 n 0000106933 00000 n 0000105821 00000 n 0000107530 00000 n 0000109446 00000 n 0000110727 00000 n 0000152974 00000 n 0000126007 00000 n 0000126215 00000 n 0000127096 00000 n 0000127212 00000 n 0000127328 00000 n 0000127444 00000 n 0000127560 00000 n 0000127676 00000 n 0000127792 00000 n 0000127908 00000 n 0000128024 00000 n 0000128140 00000 n 0000128256 00000 n 0000128372 00000 n 0000128488 00000 n 0000128604 00000 n 0000128720 00000 n 0000128836 00000 n 0000128952 00000 n 0000129068 00000 n 0000129184 00000 n 0000129300 00000 n 0000129416 00000 n 0000129532 00000 n 0000129648 00000 n 0000129764 00000 n 0000129880 00000 n 0000129996 00000 n 0000130112 00000 n 0000130228 00000 n 0000130344 00000 n 0000130460 00000 n 0000130576 00000 n 0000130692 00000 n 0000130808 00000 n 0000130924 00000 n 0000131040 00000 n 0000131156 00000 n 0000131272 00000 n 0000131388 00000 n 0000131505 00000 n 0000131622 00000 n 0000131739 00000 n 0000131856 00000 n 0000131973 00000 n 0000132090 00000 n 0000132207 00000 n 0000126070 00000 n 0000126277 00000 n 0000126570 00000 n 0000126958 00000 n 0000126398 00000 n 0000126481 00000 n 0000127013 00000 n 0000152524 00000 n 0000152076 00000 n 0000151626 00000 n 0000151179 00000 n 0000150731 00000 n 0000150283 00000 n 0000149835 00000 n 0000149385 00000 n 0000148937 00000 n 0000148487 00000 n 0000148037 00000 n 0000147590 00000 n 0000147140 00000 n 0000146690 00000 n 0000146240 00000 n 0000145790 00000 n 0000145340 00000 n 0000144890 00000 n 0000144440 00000 n 0000143990 00000 n 0000143541 00000 n 0000143092 00000 n 0000142642 00000 n 0000142192 00000 n 0000141742 00000 n 0000141292 00000 n 0000140842 00000 n 0000140392 00000 n 0000139942 00000 n 0000139492 00000 n 0000139042 00000 n 0000138592 00000 n 0000138143 00000 n 0000137693 00000 n 0000137244 00000 n 0000136796 00000 n 0000136346 00000 n 0000135896 00000 n 0000135446 00000 n 0000134996 00000 n 0000134548 00000 n 0000134099 00000 n 0000133649 00000 n 0000133199 00000 n 0000132324 00000 n 0000132379 00000 n 0000132692 00000 n 0000132770 00000 n 0000132919 00000 n 0000133040 00000 n 0000133119 00000 n 0000133254 00000 n 0000133571 00000 n 0000133704 00000 n 0000134021 00000 n 0000134154 00000 n 0000134470 00000 n 0000134603 00000 n 0000134918 00000 n 0000135051 00000 n 0000135368 00000 n 0000135501 00000 n 0000135818 00000 n 0000135951 00000 n 0000136268 00000 n 0000136401 00000 n 0000136718 00000 n 0000136851 00000 n 0000137166 00000 n 0000137299 00000 n 0000137615 00000 n 0000137748 00000 n 0000138065 00000 n 0000138198 00000 n 0000138514 00000 n 0000138647 00000 n 0000138964 00000 n 0000139097 00000 n 0000139414 00000 n 0000139547 00000 n 0000139864 00000 n 0000139997 00000 n 0000140314 00000 n 0000140447 00000 n 0000140764 00000 n 0000140897 00000 n 0000141214 00000 n 0000141347 00000 n 0000141664 00000 n 0000141797 00000 n 0000142114 00000 n 0000142247 00000 n 0000142564 00000 n 0000142697 00000 n 0000143014 00000 n 0000143147 00000 n 0000143463 00000 n 0000143596 00000 n 0000143912 00000 n 0000144045 00000 n 0000144362 00000 n 0000144495 00000 n 0000144812 00000 n 0000144945 00000 n 0000145262 00000 n 0000145395 00000 n 0000145712 00000 n 0000145845 00000 n 0000146162 00000 n 0000146295 00000 n 0000146612 00000 n 0000146745 00000 n 0000147062 00000 n 0000147195 00000 n 0000147512 00000 n 0000147645 00000 n 0000147959 00000 n 0000148092 00000 n 0000148409 00000 n 0000148542 00000 n 0000148859 00000 n 0000148992 00000 n 0000149307 00000 n 0000149440 00000 n 0000149757 00000 n 0000149890 00000 n 0000150205 00000 n 0000150338 00000 n 0000150653 00000 n 0000150786 00000 n 0000151101 00000 n 0000151234 00000 n 0000151548 00000 n 0000151681 00000 n 0000151998 00000 n 0000152131 00000 n 0000152446 00000 n 0000152579 00000 n 0000152896 00000 n 0000153568 00000 n 0000153759 00000 n 0000154213 00000 n 0000153665 00000 n 0000154268 00000 n 0000196019 00000 n 0000196046 00000 n 0000188766 00000 n 0000188793 00000 n 0000180398 00000 n 0000180425 00000 n 0000173790 00000 n 0000163311 00000 n 0000156160 00000 n 0000156418 00000 n 0000163564 00000 n 0000174043 00000 n 0000180919 00000 n 0000181363 00000 n 0000181433 00000 n 0000181703 00000 n 0000181815 00000 n 0000189216 00000 n 0000189566 00000 n 0000189636 00000 n 0000189908 00000 n 0000190016 00000 n 0000196488 00000 n 0000196861 00000 n 0000196931 00000 n 0000197198 00000 n 0000197301 00000 n 0000260930 00000 n 0000222476 00000 n 0000222540 00000 n 0000226956 00000 n 0000222412 00000 n 0000260866 00000 n 0000235905 00000 n 0000235969 00000 n 0000236086 00000 n 0000236203 00000 n 0000236320 00000 n 0000236437 00000 n 0000236554 00000 n 0000236671 00000 n 0000236788 00000 n 0000236905 00000 n 0000237022 00000 n 0000237139 00000 n 0000237256 00000 n 0000237373 00000 n 0000237490 00000 n 0000237607 00000 n 0000237724 00000 n 0000237841 00000 n 0000237958 00000 n 0000238075 00000 n 0000238192 00000 n 0000238309 00000 n 0000238426 00000 n 0000238543 00000 n 0000238660 00000 n 0000238777 00000 n 0000238894 00000 n 0000239011 00000 n 0000239128 00000 n 0000239245 00000 n 0000239362 00000 n 0000239479 00000 n 0000239596 00000 n 0000239713 00000 n 0000239830 00000 n 0000239947 00000 n 0000240064 00000 n 0000240181 00000 n 0000240298 00000 n 0000240415 00000 n 0000240532 00000 n 0000240649 00000 n 0000240766 00000 n 0000240883 00000 n 0000241000 00000 n 0000260416 00000 n 0000259968 00000 n 0000259521 00000 n 0000259072 00000 n 0000258623 00000 n 0000258174 00000 n 0000257725 00000 n 0000257276 00000 n 0000256827 00000 n 0000256379 00000 n 0000255930 00000 n 0000255481 00000 n 0000255032 00000 n 0000254582 00000 n 0000254132 00000 n 0000253683 00000 n 0000253233 00000 n 0000252783 00000 n 0000252333 00000 n 0000251886 00000 n 0000251439 00000 n 0000250990 00000 n 0000250544 00000 n 0000250096 00000 n 0000249648 00000 n 0000249199 00000 n 0000248752 00000 n 0000248303 00000 n 0000247854 00000 n 0000247406 00000 n 0000246958 00000 n 0000246510 00000 n 0000246063 00000 n 0000245615 00000 n 0000245166 00000 n 0000244716 00000 n 0000244265 00000 n 0000243814 00000 n 0000243363 00000 n 0000242913 00000 n 0000242463 00000 n 0000242014 00000 n 0000241566 00000 n 0000241117 00000 n 0000241172 00000 n 0000241488 00000 n 0000241621 00000 n 0000241936 00000 n 0000242069 00000 n 0000242385 00000 n 0000242518 00000 n 0000242835 00000 n 0000242968 00000 n 0000243285 00000 n 0000243418 00000 n 0000243736 00000 n 0000243869 00000 n 0000244187 00000 n 0000244320 00000 n 0000244638 00000 n 0000244771 00000 n 0000245088 00000 n 0000245221 00000 n 0000245537 00000 n 0000245670 00000 n 0000245985 00000 n 0000246118 00000 n 0000246432 00000 n 0000246565 00000 n 0000246880 00000 n 0000247013 00000 n 0000247328 00000 n 0000247461 00000 n 0000247776 00000 n 0000247909 00000 n 0000248225 00000 n 0000248358 00000 n 0000248674 00000 n 0000248807 00000 n 0000249121 00000 n 0000249254 00000 n 0000249570 00000 n 0000249703 00000 n 0000250018 00000 n 0000250151 00000 n 0000250466 00000 n 0000250599 00000 n 0000250912 00000 n 0000251045 00000 n 0000251361 00000 n 0000251494 00000 n 0000251808 00000 n 0000251941 00000 n 0000252255 00000 n 0000252388 00000 n 0000252705 00000 n 0000252838 00000 n 0000253155 00000 n 0000253288 00000 n 0000253605 00000 n 0000253738 00000 n 0000254054 00000 n 0000254187 00000 n 0000254504 00000 n 0000254637 00000 n 0000254954 00000 n 0000255087 00000 n 0000255403 00000 n 0000255536 00000 n 0000255852 00000 n 0000255985 00000 n 0000256301 00000 n 0000256434 00000 n 0000256749 00000 n 0000256882 00000 n 0000257198 00000 n 0000257331 00000 n 0000257647 00000 n 0000257780 00000 n 0000258096 00000 n 0000258229 00000 n 0000258545 00000 n 0000258678 00000 n 0000258994 00000 n 0000259127 00000 n 0000259443 00000 n 0000259576 00000 n 0000259890 00000 n 0000260023 00000 n 0000260338 00000 n 0000260471 00000 n 0000260788 00000 n 0000261142 00000 n 0000261263 00000 n 0000261410 00000 n 0000281584 00000 n 0000281611 00000 n 0000273877 00000 n 0000268418 00000 n 0000262860 00000 n 0000263116 00000 n 0000268674 00000 n 0000274140 00000 n 0000282113 00000 n 0000282568 00000 n 0000282638 00000 n 0000282908 00000 n 0000283020 00000 n 0000944533 00000 n trailer <]>> startxref 944763 %%EOF 2 0 obj <>stream application/pdf PMM 2.0 2019-09-23T10:58:10-03:00 2019-09-23T10:58:10-03:00 2019-09-23T10:55:09-03:00 Adobe Illustrator CC 23.0 (Macintosh) 256 100 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAZAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FVK7j9W1li5snNCvNDRlqKVU9iO2RlGwQmJo2x//Dn/AGtNQ/5H/wDNuYn5L+nk/wBM5X5v +hD5Nf4d/wC1pqH/ACP/AObcfyX9PJ/pl/N/0IfJv/Dn/a01D/kf/wA24/kv6eT/AEy/m/6EPkpX Omw28i2y6pqUl0YjP6K3Br6akLUAIzHc9hlGXBwmhPITz+r9jbDMZC+GAHLl+1JNQ8xeXLAz+tqu ssLay/SEzxSeoix+u1tx5qOPP1EYUrQ02OTx6YSjYnk/0zGecxNGEPkp23mvylcPOi63q6vbXVvZ SK8hH726DNHQ8SKUjau/bxK1n+T/AKeT/TMfzX9CHyd/ivyj9ctrQa5rBmur6TTY/jYKLiJo1YMS o4r+/U1P69sfyf8ATyf6ZfzX9CHyTzy5FpXmLR4NX0rW9TlsrguI3acqaxuUaqlajdcP5L+nk/0y Pzf9CHyTP/DH/a21L/pI/wCbcfyX9PJ/pl/N/wBCHyTeCL0oI4ubSemoX1HPJ24ilWPcnvmXGNAB xZGza/JIQ9/As9uYmZ1ViKmKR4m23+3GVYffkZwEhR+8j7mUZGJsfr+9K/0Na/7+vP8ApNu/+quU /lo98v8ATy/W2/mJd0f9LH9Tv0Na/wC/rz/pNu/+quP5aPfL/Ty/Wv5iXdH/AEsf1JfeRWsNzJbR yXhmihW4Ia9uwHVnK0QmUAkcanevTY1zGzYxE1Hi5X9cv+KcjHOUhZ4auvpj+pjur+aBYRXssWj6 veRWi2xWSO8uwsj3BAKAF+dUrv8ACem9Nq3QwwkAfV/p5fra55ZxNen/AEsf1Ii08wQz3ctu+max Esepvpv1hrq79IohZRc8vU/u249aU98l+Wh3y/08v1sPHl3R/wBLH9SFTzbEZLLnomvRQ3RuBJK0 95+6FuCwLKJCfjAoP8rbfYl/LR75f6eX61/MS7o/6WP6mSaFHb6rpFrqDR6jZSTpWSzuLu8SWJwS rowMg+ywI98P5aPfL/Ty/Wj8xLuj/pY/qR/6Htf9/Xn/AEm3f/VXH8tHvl/p5frX8xLuj/pY/qbT R7Xmv7676j/j8uz/AMzcfy0e+X+ml+tfzEu6P+lj+pPMyGh2KuxV2KuxV2KuxV2KuxV2KrZf7tvl irzrUfzc0HT9RuLCa3Z5bedrasd3pg5OhINFku43WlNw4BB2IxVCn86/LYi5i1lJoWK/W9KFACBW pvelTT54qmPl3809B13WY9It4JIbqXnx9S409941ZiOEF1NITRT0Q077b4qh/wAxvN2h6Jq1hDer cR3f1ZpIbq1u7S3ajFhwkju3RJFPDYlWofAneqeISN8i3YsxgCKBB72N3P5meTr6OJpLC8jPpJBL Fb6tYwp8XKUDgt3GrkmStePt+zTE4Qe9nDVSj0ifeAfvaf8AMTyZFPIr22pROCEuIX1i0SgiowPD 658RLHv89sHgjvPzT+bl3Q/0sf1Ktn500G/vY9P0zTdXu7/94sVgus23qGRByccPrjOOPBiT7V3x 8Ed5+ZSdZLuh/pY/qZhpPmTXLKBrWHybq/oRuQHmuLWSQkjkWZpJ/iHgVZvDwyyMaFOPkmZGzXw2 ZrC7SQpIyGJnUM0TU5KSK8TxJFR7HJMF+KuxVa6BxQ7Yqxqfzp5et72WymXUFuIZGicLpt/ItUNK q8cDoynqGBpTFVC3/MHypcRmSNr8oFL8jpmoAFRQVX9x8X2hsN8VQtxr/kbU7y2mljv/AK2hCW1y thqUDjky/CJVijNPiBK16Vr3yuWKMjZ5tsM0oggHYqF1qn5cXt0v1nTLqaZ6RpK+j35DCP4Rxf6v Tio71oBjLDA8wzhqssRUZEIc6j+VyK0Z0y5AY0aI6RfhQxAXjvBxU7jb78HgQ7mX53N/OLvrv5V1 VjplwKrRR+h9QIoTvsLcioI774Py8O5fz2b+cUztPOnk60tktrSDUIoo6LHbx6TqC05/EAq/Vx1r lsYgCg485mRsmyqL+YPlUgn/AHJfD9r/AHFajsPE/wCj9N8LFkli1teWsF5buXgnRJoiVZCUdQy1 VgrKaHoRXFUZirsVdirsVdirsVdirsVdirsVWy/3bfLFXzD5u1Dy5D5o1kTT2huor24LAxxhg3rO xDf7iZi3ECp+J9zUsSAcUpcNX8nW1xC8Vxp88EZWQq0cKVqqk7LoxZTVqHi3btTZVnf5V2ddfiv9 Js7eaD0ik1yI1t4/SZgDLFIuk2vqNtTgs2/jTooT782PO0mg6zY20epCxY2yzsknEJJylZACX0+/ 32PRx8u+KsFH5szIYXbX4plYgMpMaq3B1O7DRFI2+HtQb4qsb81ZHk5DzCkkjRhS9VCozMvxkNoq jeihi2w+Kg3GKqln+al9bFZn8xRxDkI425AKEqrHhCmjVrxb7RHHc8dzsqqy/m5rlzemGy8yPyuK LbWiFnfmWoVAGjNI3xbAVrt7gYq9s8jXWt3Pl+GTV4ys5LenI0rSySITUO4e3syhqSoX0+gG+Ksg xV2KuxV8/eaD5D/xDrAuJJBMt/K12iL5ZZamYmT+/ZJ93WjeoeX81cVS76n+WrzyUuGtEkZpE9WH yuVAKhvTHJ27Gi/edqHFVWzXyBZ3CXErS3VvE1JLd4/K6RyCM8pIfglVqqsh5FT0J3xVkJ8xfk00 aPN5StUR6sGabRirFm4Egi8PLdD92KuvfN35Ml5mfypbT/FzMgk0ejcn+FyDdh1DGWvxL33xVVXz T+TTyKo8r2YKhj8Mui8QkVCT8N5vx4j58dq0xVZF5j/JJq8vKtpCy14gPo9SvFST8F2f91tyPyPf Yqo6x1j8mjqMMf8Ah6wtQWFsl+ZNJ+rqsitQlkui3xLXbhyNdgRvir0vQdE0DSbL09DtLe0s7gia lqqrG5ZQA/w7Gqgb4qmOKuxV2KuxV2KuxV2KuxV2KuxVbL/dt8sVeP6wdDh1+6F3qthCy3Ujzwy+ YLi3ZVaUNR7cjiNuq9B9nplRM75ByRHDXOV+4frQGg23lGaaVdX1+xig4FUksvMV1LJ6jOAGKu8f 81OW/h0wwM79VLmGGvQZE+YH62VWC/l0bu0isvNLSys6C0tE1yaYSMCVRVjM7899qU375Y4yj+ZW l+Yr7WLRdPgvJ7UWqg/VWdFWVpGUNUajpwLUI2CVp+1Q0CrFo/LnnURtG2l6kxB58WluDGjElfjV tcPIBaEUPvXqMVUW8s+e41lLaZqJBBHqK83MbEuC/wCnD8BZhX4vi470oMVWjyr+YXoqn1DUhMyI eUckxB5nk3Jjra7/ALNafZGKs18t/ljdyRrda1qV4PVRZI4Le71G3miZqMyScr67Sq7g8W+nFWba HoFnpCSLbXF3cCSgY3l3cXdOJY/D67ycftb8eu1emKpnirsVdirGb38vNBu7u5upJtQSa6kMsvp6 hdotTWoVBJxVd+gG3bFUO35X+XmABu9VPFuSV1O9bi1QarylO+3XqOo3ocVQV7+XGjWZWa3/AE3d yOaOYdWuldeI+EkvOlafZG+VZcko8omXur9LbjgJcyIoKDyJpvoQQHTNbjhgVmUDU3U8+PSqThmJ HwjkaAdKVOUjUT/1OX2frbTgh/Pj9v6l0PkjThciR9M11SoZA36VkIZCOhpcg7mh+eI1E+uOX+x/ WpwQ/nx/2X6lkfkKygZDHYa5KCFHJ9WkVgrAckbjPutUqRUjfE6jJ0xn5j9ajDD+ePkf1J4Pyy8u 7lrnU3Y8RybUrw7IVKinqcfh4+HzzLcVEWH5faFY3sN5FPfyPCQVinvrqaEkLxq0UkjI30jrvirJ QABQbAdBirzvSvPWv3PnJtLlhQWvqyR+mEmDqqLGVYs0YjoTIf2vDc98ISkIRycRJlw7emtz9I63 H8eU/wCIxr73omZrB2KuxV2KuxV2KuxV2KuxVbL/AHbfLFXzt+ZeoXFv5/1Sl1dL6bW7xRx65ZWU akW8Rp9WnBdeRJ5V2brTfZVJNN0vzpqKzHSrbXL17aQpO8XmC1l4UqnA0h/aNagjoMVegeTvIPnG y1/TNQvpboWMTSTSRy6s05BkTZZITaQqwBpRQRQ1NemKoz837M3GoWYltnuLcWtUCWwuB6wdgtT+ jtQZaB+vMf6u9cVYCdPtwVhfTkR0/eShNPUgxuVp8H+HyKlkrvTpT5Kqb6eHijs20p55D8cJexYy ha1dUH6CIoXNSaH6MUqx0uc6dEj6bSGILFApshzMkxYsqodDPJ2Kcdv2dyN64qr6J5fsHv4tOv8A TVWB5f3kqae0vEepycRh9GiX41otefSlCMVe96H5X8t6CJl0bTrfT/rNDP8AV0VC/Anjyp148zTw rihNMVdirsVea3v57+WbPV59LmtHE9vctayN9f0YDksnpk8GvlkH+qU5DuMVVrP88PKV3qem6baq bifUWiiQx32juUeYqoV1W+5lgzUKxq1f2a7YqjNe/NSHR9Uu7B/LWu3qWsqwLeWVmJYZXaJZPgLS I3EFwhYgLy70qQqlNr+eFmZFtx5P81+tJydVm00K3IuapVpQvwg1G/TbrtkIR4RVk7nn5m/s6eSS bZLd+fPQ8rWnmKHQNXvILqP1HsILdDewH+WW3eRH5cvh+Dlvv9nfJoYbafnfYi/vro+WvOTq8cbL YSaZGY0IIT9yEbmpb4mPN6bGm9BgAHPr7z910PgAu7Np/PNlZ+Vx5g1azm0aIuI1s9TltLWYktQf E8/oglasAZK0GFWIxf8AOQXlF5JZuEnoenWOM3uiVqhJdgF1AyfErA0Zei+OKs48oebdN806QNTs KLHzaN4vWtrhlZT3e0luYt+v28VTcW1usplWJBKesgUct/frlYxQEuIAcXfSeI1SpliHYq7FXYq7 FXYq7FXYq7FVsv8Adt8sVeC+f/OnmPSvOt/pttcc7UtGwU3mjxMoMCymsdxbSSoE3p6jbj54qk9t 5982RxqlreOszsqLFHqOhJ8ShCVoLQuWRmoV4dO/UYpZ35Fn/NO48xI+vW13b6Sscvq/W57IqSd0 VI7e2jdmVtqlwCN/8nFC781/J3l3WdXsr3VtX0vS2S2jt1OotMHYGV2ovC6tUCsOQrTkd96dFWDP +Wn5d8OP+KPKxKVqzXFz4k0AGojam3fFV8X5afl8ssjJ5k8qspoeDTXLKhHxbH9I/wCSevauKsh0 zyR+SCGVtY1bRLmT009MW968KLEE4JyWW7n5NxYUbr9+KpppXlL/AJx4sZWuorvSLqkRiYXV/Fco FO9eMsjgMFWgPUDFWZ+VdN/L2K7urryvDpwuwqpeS2PpGQLL+8USFCSA9OQr1xVkuKuxV2Kvn7zz +TXnAarNq8M9rrIu5rmeS3g0DSZHi5u8gDNPJBJIT6m27Fn3brXFUV5Q/Kvz5ca7Br15dWulzWdw kkttd6HpiyTFWVi6SWskpQtxG6ykgjY/sqqlP5t6fdP55vbvT9Ov79J0WO8kHlmyvoxKf3SL9ZuP QeVU9BCgYMDsOdGWirCotC1uSX6uNM1SNrhVVoz5M0hSSxXgzO0ijhzNWHam9OuBXvUnkHT/ADX5 B0i0tbmWzksoJYbSe/0mzWVamnpy2VzbKkaLLEh4xonIIKN0bCrER/zjn5iMdvbyeY9KNpASxjXy 5pwLM5Xm3xB1DMqqvKn7IqMVTP8AMHyBbaL5DsdF0lJZEbUDLJJBoulX0ZmlBUTXFoYYY14xj01k jAI/aNMVeRXOj30byqmnX8Ng6mS2lbyVp8nMRuVVmAcUkorD41UU3oKjAr2z8hIryPTdU+s2t5aP 6kQaO50i20WMkIaenFDydyikRszsR8I49ySr1TFXYq7FXYq7FXYq7FXYq7FXYqtl/u2+WKvBvP8A r2v2vm/VYLXzAttHamIR20lvo5ZRJAsm0lzPFMQodqckHzpyfFVFPzU1VbVLoS6LJcrSOMPHYpLT iDVqarQKdulOlKDqFWf+QfPp1+4uLC5kgnvYTK6TWjW4iMMZiWvGO7vHarS/b2HYhT1VSf8ANu11 CbWLE29zqUUIs/3keny3kKgiQ/GTbWV6pcbUq6nan7WKsDfSdcMjn9Ia+sjuBI31rVpG4LUFEppX UtQKelAfs1GKWQJ+V/nu4t4ZbO+1F7KUCW1Da1JbMqFRxDRtY8hyXieLCq7g+JUNx/lH5+iuophd XzBGBp+n5AF5fap/oXKgqejV964quk/KHz5G8ixX+oTAArFI+uuAVIpQp9SPHqT9o9sVet+VdCGi 6PDbNJLLcskTXck873DGZYUjejyb0/d12AFamm+KpxirsVdiqyaURxyOFMjRqW9NSoY0FaDkVXf3 IGAlIFleCD0NcKEFq2kaNqsCW+q2kF5DHIs8cVwiuqyJ9mRQ1aMvLY9sVY/5T8qeR2W08waf5Zj0 jUET0oTcWqQXkKwq1uoI+Ir+72G+6kZKceE1dsYysWywuobiSOXhXfIskm0jzHNf6tf2EunT2cdo xW3upQwjnCuyFkJUCnwgrua/Rk5RoA2gFM760sr2yntb6KO4sp0aO5hlAaN42FHVw2xBHWuQSwmb yN+W0OvW2ir5L094byF52ulsojCrR1Chvg41oW3rtUfzZIR2tF7s2sLGysLOGzsYI7azgUJBBEoR EUdAqjYDIpV8VdirsVdirsVdirsVdirsVdiq2X+7b5Yq8K89X7ReebqFPL6Xtwrw1vxosl0HkeNf SVpheQh+KELuvUfcqvsfzH1mDU4WvPL15LDyM91bWWgskzNJUAmR7x+D86A/CenXFWVaP+a2j3t9 HCfL2taf6zen9auNPb06qaAEwmV+p/loO5xVV/MfW/0bf6cx1TUdMUR7vZz6ZHA5cttIl/JG1QqM eQBA+eKsUsvPWmR6lDPP5l1q4ZJYZDbSX2gpFNxqeHGOdKJJ8IPSte1SQqytvzx8rqATbSgsRwBv dHFQWKlgfr9KArTFVQfnZ5WLORBKYIhH6lx9Z0wIvqkca1vK9yem9Nq4q1b/AJ1+W7iaOGK1lkkk kSFVjvNJcmST7KgLe1ap2+GuKs5028lvLGK5ltJrGSQVa1uOHqpQkUb02kT32Y4qicVdirsVeBed /wAuvOuo+cdU1aK3kvFlm9S1lXQ9BnIjj+COP17q4juHZFVaM3H4RQGtKKoXyD+XH5h6R500y99H 6naRyqZ7kaJodoDASTNE8trO1whZfgqiN8XfjRsVRn5y6xFqGttpN9qGkW8ulzTCH65baPcSpDcQ W5UenqF8rg/vDJyCJXhTi3w8lWFeW79dJvrS9/SWjxGzluJrWOWx8tJGLgIjbSQalHLGaqqfC3I/ tMAfhCvZfNnkHUfP2ieXNSFzp1hqawRT3l3PpVteyMsiK4ii9aS5SJQzMSA770o1OpVjE/8Azjz5 kaC1ig8x6XELWrKW8vacxEjBeRQhV4gsvIACoPc9lXog8gE+S7HyvFqA023ggMN8NPs7NYLkuP31 be5huYkSR2ZyqjqeuKsFl/5x+1J9Vu501nTFsLkyD6u2gaa8pR5Of7yTgoZl24njTkFJBoQyr0vy j5Wby3p409NRmvbONQttBJDaQJCOTM3BbSG3X4i/cdvniqe4q7FXYq7FXYq7FXYq7FXYq7FVsv8A dt8sVeFeeL+5j856nA3liHUwWiRr06E10JU9FJUje4+uRBytAPsjcU6Yqluh+d9T0maU6d5XOnzy oE9S28vtb7hgeMrG/UcNiTuPnirLvK/5meYr7W7Oz1DTbs2105g9SPSJ7dUYfD6kk73UyBC4P2VO w3xVOPzU0vzDqUGnQ6VFcXKqJWkgtvVWhCgBpGjvrDrWiD4t64qwO28p+eXnFq9tqaJK0aQyO11w hANKnhrLsEUV5e/SuwKlk3/KoPMbInqa5CSp5S1k1gqKEMKD9IjpStdvoxQqSflT5qKJGNagAccZ uUurtUciwp/uQFaD4ex6702xVSf8oPM7tI769E1aMAZNVARgASQBfjatSB2rir1W0tktbWG2R5JE hRY1eZ2lkYKKVeRyzMx7kmpxVVxV2KuxV59qH5la1balf2kOipcJZySxpJ/uSUvwkMcdKae6MWbr wdlHXkRiqBP5ueYRIVby1QKfiNdUNFpXl/xzASKVI4g/KlTiqWax5vt9fAi1zyXZagsUlIPrEWo3 FH+FW4q2l1Y8W/Z608MVQdnrei6XdRajZ/lzY213yMsNzDb6isgkII5l/wBEqQeLN4nfwNcVZBH+ beuFo0PlwRhiAd9VIVSNif8AcWABuO+Krrf82PMU/phfLYUSSmDmW1WgkU0ZT/uLFN9tyPwOKqcf 5t+Yn9Qjy4OEbcOY/S5B+EEmi6USB8VfiA6HFV8f5u6yyxM3l8ASEbj9KkEGtCK6WB1B6n33xV6T bySSW8UkienI6KzoKniSKkfEEO3uo+WKqmKuxV2KuxV2KuxV2KuxV2KuxVbL/dt8sVeU+bfyhbXv MWo6wrWMUl4IhG8iXjyViiRA0gS5jiYgp8PweHU74qlI/IRUkLxDSgeJVmeG/cvyXixYfXQN+tDX feuKsk8k/lJofl3UE1V7a2GqwErb3Fl9aiT02j9Mh457i5BY1O/8cVQ/5xaMtydLuobb17tleElb YXDCMEHqun6m9KydDxHhU1xV5xNojVIudPkMk/JJCNPp9lFdRT9BCoBHXf4d1BxSq6b5W1HX7ldO s9LjDIpeNZII7VVjR+TJ6kuhxIV9R68WPXFWQ/8AKoPM/pNw0+1Wdi3qB5NMKkEHfl+imblU03HT v8RAUJlo35Y61YmSW98t6TqhWMC2t5p7SNVYMWqrW+lW7hgNvtUJ3+Sr1TRYZYNIs4JbSKweGJI/ qVu/qQxKg4qiOUiqqqBT4RiqNxV2KvPPzo/MPWvI+iWF/pMFtPNdXJgkW6WR1C+mz1AjeI1qvjir yTy95nvfNrXmof4e8tR3klxxuZJNM1GV5JZzzUl7Vp25yNyI7/CTirIYND1b0hLbaB5XZ53UD09F 1owkL8SEOEI5VJqAvbc9sVRWk/440W5lu9G0Hy7aXCKsHr2mi62jPHIVY/EsVSo2J77bA7VVTqLz h+cTqoeHSIZmUsYX0vXiaClacUatC1D7+IocVdL5x/OCPjWPR6NL6PL9Ga5QvQn4RwLMPhpsOvag 5Yq2nm7842j+KHR45wzh4W0zXCQisVV6ojij0qK9vpoq3P5x/NmLiC2ihqqsgfTNeXi0jcIxTgW/ eNsppuagdMVWv5u/OdbeKY2mlqWSR5o20zWapwYBRVeQPNGVh07g04nFWBax/wA5I/mFpmq3mnPZ 6TI9nNJA7i3vI6tGxVvgknR13HRgDir6WxV2KuxV2KuxV2KuxV2KuxV2KrZf7tvlirFtb856Zo+p w2F1HKzzehWRApUG5laGIUJDMSyGoUGgzFzargmI0Tbl4NHLJAyBG1/YLKxPPmgtcLbkXaSMQFDW lwK8jGB+xXf1lI9qntmU4lIjSPN2jatdC1tDOJTGZR60EsIKhY26yKu9Jl2+fgcVYh+b1zfWN5pt 2l/JY2kkJhYLdtaK78wT01HTq0U9kc/wVYbo/mm1EwGqazfT2kjtwW11ZYJmdRRR6kmt3AAPICgH z7EKp5/jfyPQ8ZNef1mop/T0A+Nlp8J/SVAfjoBXfqAaVCq3/GXkRmkWKfW/SZCqufMUTcmZqhVA 1J2UtQAE098VVIPNnkaeVFgk164ldkiihXX7di1GCxlUOpjlzb4dh1qD1xV6R5Mg4WVw5stUsXeU 8odXujdyHavKMme5Cr8VKAjcdO+KshxV2KvJ/wDnIrQLzWfLWmQ2rxo0V7zYylgKGJxtxVsxdVq4 4ADK9+5ydNpZZiRGtu945oH5e+YrMyK9hp2rC5Efp28812GRmLLG6x2zwtVjUAsD7ZijtWBAIjOi aGw5/Nu/IHiMeKFj3/qZAnk3zPG0MR8laazKvpxxu2ssDs1fhM1PE5P+URdcGT/S/tT+QNXx4/8A Tfsai8k+bopZC/k7TZImqViddU+AKQTxdXV6KfEnH+UR/qeT/S/tR+R/p4/9N+xuPyT5qWWreStN aVCHJ/3LghSxZV4iTjxoOPT6a4/yh/teT/S/tX8j/Tx/6b9ixvJPmv0XT/COniRldi7jU6LRql1X koDAkA/s9Ph8X+UR/Myf6X9qfyB/n4/9N+xseRvNgmEn+DdP/vSTETq5BBiK+nQyE0/3ZXrXvTbH +UP9ryf6X9qPyP8ATx/6b9im/kTza4m9PylYAu7SLIx1V3USE8BUvRuJ3XkDuO4qMf5RH8zJ/pf2 r+QP8/H/AKb9iKTyT5sDs3+CNP4uasg/TKig4mgAlC/aWu4OH8//ALXk/wBL+1fyP9PH/pv2MGu/ yr8z20vC6MEEjDkEkMqmhPUco60ymfbGOJoxmPgP1tkeyskhYlE/E/qfaGbZ1jsVdirsVdirsVdi rsVdirsVWy/3bfLFUtnsLG4mhnntopprc8oJZEVnjbxRiKqflgMQeYZxySAIBNFEYWDWKpN5t8k2 3meOw9a6Nq1izSROkFrM/JgtKG5im4gcd+NK98VY1/yovQvUFLwCLiysv6O0syHlWhMhtSa0b6ds Vbj/ACN0RFh5XaO0anly03S+LOTUvx+rbbUFPbxxVkP/ACqz8uPT9P8Aw3p/GrGvoJy+I1PxUr8v DtiqO0jyR5Q0e5N1pej2lncMOJlhiVWpUHqB4jFU7xV2KuxVg35t/wDHFs/+Yn/mW2aXtz+7j/W/ Q7fsb+8PueZwXzxuhZEkVSvMEcS6IahGdOL0+RznxqJ8IiTcAbro7o6WHEZgVI9UaNeXmjGzQ8Fo V9a6oxpTkf3ta/IjJfmP6P2y/Wv5fz+yP6lg1e2KFXsEdiSTI0txy3FB0kpt16dfbbB4wr6R85fr T4J/nfYP1NxavZpXlpsUvIUbnLc12/1ZVxjmiP4QfjL9anDI/wARHwj+po6tZl+X6LgFGDD95ddA AONfW6d/H3x8aP8AMHzl/wAUvgy/nH5R/UqNrVkXDfomDYEcfVu6E1BBP76u1Ml48b+iPzl/xSPA l/PPyj/xKkdWtyEAsUHAEGktxvVQB/uzahq30+GR8UfzR8z+tl4J/nfYP1Kj61ZOPi0uINyUkia6 oVUU4nlK22SOeJ/gHzl+tiMEh/EflH9SAuriOZlMcKwhRSis7V/4MtlEpA8hTdCJHM2+h8754h2K uxV2KuxV2KuxV2KuxV2KuNKb9MVa+D2xV3we2Ku/d+2Ktj2xV2KuxV2KuxV2KuxV2KqF39R4L9c9 LhX4fW40r7csrycFeqvizhxfw38EL/zrn/Ln/wAksq/c/wBH7Gz97/S+13/Ouf8ALn/ySx/c/wBH 7F/e/wBL7Xf865/y5/8AJLH9z/R+xf3v9L7Xf865/wAuf/JLH9z/AEfsX97/AEvtd/zrn/Ln/wAk sf3P9H7F/e/0vtd/zrn/AC5/8ksf3P8AR+xf3v8AS+13/Ouf8uf/ACSx/c/0fsX97/S+13/Ouf8A Ln/ySx/c/wBH7F/e/wBL7Xf865/y5/8AJLH9z/R+xf3v9L7X/9k= uuid:1a4f1d32-2c87-f643-acb5-0727981e9ec6 xmp.did:c0f683fe-9eb6-47d2-a128-55ee6126230a uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:7bed989a-3a21-1c4d-bfbb-8d21100be145 xmp.did:c1961211-5580-47b9-8362-4f0141b8fad7 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:ab17be08-b65f-453f-ae7f-4fe23b51a1d3 2019-02-13T16:27:05-03:00 Adobe Illustrator CC 23.0 (Macintosh) / saved xmp.iid:c0f683fe-9eb6-47d2-a128-55ee6126230a 2019-09-23T10:55:06-03:00 Adobe Illustrator CC 23.0 (Macintosh) / EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/postgreSQL.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/best-tool.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/optimize.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/labeling.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/point-in-time.png 0 0 EmbedByReference /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/historical.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/postgreSQL.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/best-tool.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/optimize.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/labeling.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/point-in-time.png 0 0 /Users/lucasspeyer/Documents/Percona/public/percona-com-docker/apache2/htdocs/sites/all/themes/Porto_sub/img/pmm-icons/historical.png 0 0 Print False True 1 215.900000 279.400000 Millimeters Chivo-Bold Chivo Bold Open Type Version 1.007 False Chivo-Bold.ttf Chivo-Light Chivo Light Open Type Version 1.007 False Chivo-Light.ttf Chivo-Regular Chivo Regular Open Type Version 1.007 False Chivo-Regular.ttf Chivo-BoldItalic Chivo Bold Italic Open Type Version 1.007 False Chivo-BoldItalic.ttf Chivo-Italic Chivo Italic Open Type Version 1.007 False Chivo-Italic.ttf Chivo-Black Chivo Black Open Type Version 1.007 False Chivo-Black.ttf Cyan Magenta Yellow Black Grupo de muestras por defecto 0 Blanco CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Negro CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 Rojo CMYK CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 Amarillo CMYK CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 Verde CMYK CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 Cian CMYK CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 Azul CMYK CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 Magenta CMYK CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 P Charcoal CMYK PROCESS 100.000000 CMYK 65.792322 56.157774 58.059049 62.648964 P Citron CMYK PROCESS 100.000000 CMYK 13.846035 14.843976 94.692910 0.973526 P Cardinal CMYK PROCESS 100.000000 CMYK 24.188600 100.000000 95.858699 21.084915 P Charcoal CMYK 2 PROCESS 100.000000 CMYK 65.493244 58.352023 54.680699 61.406881 P Citron CMYK 3 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=22 M=93 Y=100 K=16 PROCESS 100.000000 CMYK 21.960784 92.549020 100.000000 16.078432 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 Grises 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brillantes 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Grupo de colores 1 1 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=9 M=11 Y=62 K=0 CMYK PROCESS 8.984375 11.328125 61.718750 0.000000 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 C=85 M=88 Y=0 K=0 CMYK PROCESS 84.765625 87.890625 0.390625 0.390625 C=61 M=83 Y=1 K=0 CMYK PROCESS 61.328125 82.812500 1.171875 0.000000 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 C=66 M=57 Y=54 K=59 CMYK PROCESS 66.406250 56.640625 53.906250 59.375000 C=40 M=32 Y=32 K=11 CMYK PROCESS 39.843750 31.640625 31.640625 10.546875 C=18 M=13 Y=14 K=0 CMYK PROCESS 17.578125 12.500000 13.671875 0.000000 Grupo de colores 2 1 C=8 M=96 Y=91 K=2 CMYK PROCESS 8.203125 96.484375 91.015625 1.562500 P Charcoal CMYK PROCESS 100.000000 CMYK 65.792322 56.157774 58.059049 62.648964 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 7 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC/ImageI]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 485 0 obj <> endobj 486 0 obj [487 0 R] endobj 487 0 obj <>/Border[0 0 0]/H/I/Rect[76.7793 62.7852 163.256 75.7762]/Subtype/Link/Type/Annot>> endobj 488 0 obj <> endobj xref 0 1 0000000000 65535 f 2 1 0000954638 00000 n 7 1 0001027715 00000 n 485 4 0001028285 00000 n 0001028515 00000 n 0001028542 00000 n 0001028681 00000 n trailer <<3C539DD22DEA43F4AE6854250EFA30A3>]/Prev 944763>> startxref 1028796 %%EOF