%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf Percona_Distribution_for_PostgreSQL_11 2019-09-16T22:22:33-03:00 2019-09-16T22:22:33-03:00 2019-09-16T22:22:33-03:00 Adobe Illustrator CC 23.0 (Macintosh) 256 140 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAjAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A7y/kDyuzljbNyYkn97J3 79c1p7Jwd32l2A7Tzd/2Bb/yr7yt/wAsznw/eyb/AI4/yTg7vtK/ypn7/sDv+VfeVv8AlmY/89ZN /wAcf5Jwd32lf5Uz9/2B3/KvfK3/ACzN7/vZPuG+P8k4O77Sv8qZ+/7AiIvy48psgLWr1/4yyf8A NWP8k4O77Sv8qZ+/7Av/AOVbeUf+WV/+Rsn/ADVj/JODu+0r/Kmfv+wO/wCVbeUf+WV/+Rsn/NWP 8k4O77Sv8qZ+/wCwO/5Vt5R/5ZX/AORsn/NWP8k4O77Sv8qZ+/7A7/lW3lH/AJZX/wCRsn/NWP8A JODu+0r/ACpn7/sDv+VbeUf+WV/+Rsn/ADVj/JODu+0r/Kmfv+wO/wCVbeUf+WV/+Rsn/NWP8k4O 77Sv8qZ+/wCwO/5Vt5R/5ZX/AORsn/NWP8k4O77Sv8qZ+/7A7/lW3lH/AJZX/wCRsn/NWP8AJODu +0r/ACpn7/sCcaNomnaNata2EZjhdzKylmb4iApNWJ7KMy9Pp4Yo8MeTi588spuXNH5e0uxV2Kux VI/MHlzSdXmia/iMhhBEdGZacqV+yR4Zi6jR481cY5OTg1WTFfCeaU/8q98rf8szf8jZP65j/wAk 4O77S3/ypn7/ALA7/lXvlb/lmf8A5Gyf1x/knB3faV/lTP3/AGB3/KvfK3/LM3/I2T+uP8k4O77S v8qZ+/7A3/yr3yt/yzP/AMjZP64/yTg7vtK/ypn7/sDX/KvfK3/LM/8AyNk/rj/JODu+0r/Kmfv+ wN/8q98rf8szf8jZP64/yTg7vtK/ypn7/sDv+Ve+Vv8Almf/AJGyf1x/knB3faV/lTP3/YHf8q98 rf8ALM3/ACNk/rj/ACTg7vtK/wAqZ+/7A7/lXvlb/lmb/kbJ/XH+ScHd9pX+VM/f9gd/yr3yr/yz P/yNk/rj/JODu+0r/Kmfv+wO/wCVe+Vf+WZv+Rsn9cf5Jwd32lf5Uz9/2Bv/AJV75V/5Zm/5Gyf1 x/knB3faV/lTP3/YFa08j+XLS5iuoLdlmhYPGxkc0YbjYnJY+zMMJCQG482M+0c0omJOx8k8NPo/ X/ZmwcFZ60RbjzUsTxoCKk9aYquZlX7TAV2/sGKtKysKqQQO43A/txVrUNa0rRdMN/qlylnZowVp pDRQXbioPzJxVBDz/wCRCpYeY9LKg0LfXbegP/B4qtn/ADC8jwSrFJrtkCwrzEyNGBz9P4pFJRfj 2+I4qoQ/md+X0zxpHr9mZJYVuI4/VAYo4BVQpofUII/d/b9sVVF/MfyG1j9eGu2f1cNwY+qvNT6i xfFH9tQGkWpK0ANTtviq8/mF5EFylsfMGn+rIpZD9Zi4GhpQPy4cq/s1riqmn5lfl8yM/wDiPTlV K153MSE8WZfhDEFt0NKdRQjYjFVS2/MHyZcsy2+rQSlIUuHKkkLFI0ao5NKDk0yge/yNFU5sL+z1 C0jvLKZZ7WYExSpurAEjb6RiqvirsVdirsVdiqGuP7z6MVeb6r+Zl/YanPG1pD9Xh1BdOitTIfrU 3xKrSRx0/wAsFexFfp1OTV5RmoD0e79N/LZ3OLs2M4A2bMeK+gTnUvOuoWXMJ5b1O54yXUcZiiDB xalVV/hLELMXPp8gOVCembZ0ytP5xukhlki0DU5WT6xSP0eLH0IBMvU/7tJ4Jxrvt12xVF+XvME2 r+qJdMu9NaKO3kpdxNGGNxCJCqlgKtExKOOxGKpzirsVdirsVbxV2KuxV2KuxVivnWLULprayjme C1m68AhE7qeTQt6iOtDGrUG3Wv7OKvPNdm0byv5k0280Wz+qN6VwNRiuZ2sYpXFOEkrCKWMEBXbk OPIbGo2yUY215Mohza8/+YZ7qbSLCbTby2sLq4tzcKbplnMTMGmR4Y43r+6RqcZvGtCCuPBta+KO Lh6sl0PTJdL8yWzaQslppMjiEWvoRhStOUjniFk7D4m5LQk7GmRbGf63eeXrLSBda+8EenxSxt6t 0AY1lDj023BoQ9KHtirEPX/II8Yx/h+RbUKAFW2dVHPYmgK05ydfE4quU/kK0VwqHQDCWWKZV+r8 KylZFAA23IBHHwPgcVbutQ/IVnhW5by8/oRMtvyS1ZBFzeqpsUpzVth/HdVauqfkMUvIo/0E6JV7 pEigYfGUUsAqmoJCV499+uKoiS8/JK4hGnSSaG8VuWt1tW+rjh6DvIyqh7B2dttiST3xVAov/OP1 qZqHQkW8SOR42aFkZIyOJRGJValRy4gcqfFWmKqiy/kKBcTpJocnqRRLccGhk4xRFUj+EFvTUEry oB4tirONCh0SLSbZdDEA0oqXtfqpUwlXYsShWq0LEnbFUfirsVdirsVdiqGuP7z7sVS6XSNJlvo7 +Wyt5L6LaK7aJGlUf5MhHIffkTAXdbtgyzEeEE8PdeyMyTW11xVvFXYq7FXYq7FXYq3irsVdirsV Uri3iuIWhmXlG1OXUdDUUI3BBHUYq8381+Q9Z/TVv5mn1p7y30r95Hp7QKOMasSzs3PgxWJmJPAE kbdlxVf5n8ra75yu7WITjS49MaN/rS/vQ83EclFCkg4RyvRuXX8Almeh6CumRKZbh7694BGupQq0 XqyxogCxoW349elSaChQhfzDlli8oSPFGZiJ4SY1nurYsBKDxElmryitKDpiryU6jZx/Wn/RN2z3 MDQqxvPMRYFXBhBZrRS/JloacdqjFKNn1OkYnj0e+Sa3dVctqHmH06lzxErNbR9BIzksuw4jo1MV Sm51OK4e/ebQ7tgsX1i3t31DX2QB2pxAW2WoqSTUrvXf9nFUXcT6bzn46PfyXSTmKJV1DXjPRiGI kRoI/T3dCK7HxNN1XTa1JLIsB0u4qsYdFN75j5yMw5u9fQP2mVkod1PdhUFVWt9Rt5KSfoS54xhU umOpeY3dYzNGzKn+h1VuY+JVJb4T7kqodZrIt9UTRr2NniiX6supeYGi9OcLWoS0Zl4uFULTxBrR cVetflZJE/k+AxpNERLKJIp5bicowc0RXukil4qtBQqKGo36lQy7FXYq7FXYq7FVN4VdqknFVv1V PE4q76qnicVd9VTxOKu+rJ4nFXfVl8Tirf1ZfE4q19WXxOKu+rJ4nFW/qy+JxV31ZfE4q76svicV d9WXxOKu+rL4nFUN/n8sVQeq6PpmrWjWeo2yXMDBqK43QspQurCjI/FyAykEV2OKtaVpi6fbvAsr Tc5GkLuFDGtAteIFeKqBU4qjfxr+OKpD+YMHl248nzxeYb02GmtLFzuhEk3F/UHCqSRzrx5dSV6d wMVeVPoX5MtGIU82w+vNKkYaCws/3gMigIVitfi+IDcfCKVp1qpRI0z8lZonkh81x20N263catZW EQp6rogQSWSn4GDCn7I7AHdQ79A/kndPEG80Rs09YI4fqeno3J5SCAgslMZJk8BQfEKChCqY6D+X f5W6zqDQaJr4uLkR+tLaRW+nEmIOr8nSS0NULvGRUU8PZVPk/I7QleUfXpPQZOMMP1PTgIm58wyf 6NTY+IxVc/5I6D6qSxXXpyhCJZhZaf6jSFCvqcvq4oSSSRQg/diqjp35CeWbK7tblbyWRrWQSqrW unUYhqgN/otT/nShxV6Hpek6XpVmtlplpDZWiElYLdFjQFjUnioAqcVRWKuxV2KuxV2KuxVjnnXz bc+XLW1ktdLk1W4u5fSjgjljhoabEvJt1IH49sVSKP8AMjzUbgI/k2YwcGYzRX9nISw2XivJaox2 Dkj5Yqza01COWzt5pylvLNGJHhLq3BuAd15DY8K7nFV41CwKeoLmIoSV5c1pyHUVr1GKtrfWTqrL cRsruY0IdSC4BYqN+oCk0xVz3tkiF3uI1RTxZi6gAlgoBJP8xA+eKrJNT02Pj6l3CnM8U5SKKsRy oKnc03xVuTUdPjkSOS5iSSSojRnUM1OtATv0xVqPU9NliMsd3C8QHIyLIpUCtK1Bpirv0ppvw/6X D8Yqn7xNwa7jf/JOKqjXVqrcWmQMdgpYA1rTx8cVXpLFIKxurigNVIOx6HbFV2KvJ/zI8yS6X5jt Io9Q1G0ItVlMNldaTDEQ0zRl5YtQIkPWnJNtx+10VYpcfmaPQnjfzDqlvJxlntmF35bAmCtwCIW9 Q8Q0bfFx68q0+ziqHf8ANCGa2tlt9f1mSURyMXgvvLRlILsSJomJA4UFGA3GKsj/AC9/NWzvdeTR Z7271CW+4pay3V3o0zq0akuFj01uVG6mobp2xVnn5hFB5Pn9Sykv1MkY+rQyXcTk8xxIeyjmmHE0 P2aYq8wgigN9K/8Ah2+FxeTRL6hvPMLfYZmiYzSWgFFeNQGJ6cumKUZoHlrWNStblrTQZIeAS3ki fWdZtg3FgKr66Dkq8O37P0VVTe/8j+b7m6lYaTAgRzcW80eu6kjcpXVpIwwWoUFAVAQKOo74odb/ AJdeZ7W6F1bWESXMUTxxOdf1Ig8U4IHrAeYNeVFCe3HFUQv5f676zuNNCpKvPg3mHU+KyysDKAoh IFAzFWAPxUOKqtp5K8yNfL6+mi2tHMLTSxeYdUMxMEfpp0Rd+NA3xdupxVMrLTPO+iPL+iNMtZ0u m53C3usX90Vfihqj3ET0XkzqaKCaAnwxVmGmtqL2Fu2pRxRX7IDcxwMXiVyNwjMFJA+WKonFXYq7 FXYq7FXYqw78zfL767pNrZCzubxVmabhbR2ElGSF+PL6+GVeR+EMorvvtirAr/8ALiB3Rn0DVpbq VRzcQaG/xKjDkXaNgrFn5Uqqnx6UUoU/lqLeZAnlvVJEi9SAstt5dYuEIVZP3kRH7xPuPjuSoVJf y4WVGnk8tau9yFUSMbfy4fVZ3YlzUfa+IioHYE7YqiNN/KS21TUeOo6Zqdgso9WW7ubfQChdanf6 vHI1SX7qa99tgqyI/kborOxbUZSj8zIhstLNWkcO1C1ofh5Doa4qsX8gvKgDqbh2jYKOJtNOqOKc DRha8twB7968t8VcPyI0N7v6zd6pcXDBXRQ1rppAVyWPwvauleTMa8a74quf8itCe3aD9JTpFJAL eREtNMUFRL621LT4fiFTTfYb7UxVWH5I+XTdieW5aZQip6clnpp+wgUHl9V5DcciBtXFWm/JDy7I F9S8lLIKRkWumDh+89UcR9UNAGPQfTXFU08u/luug6p9dstavPScj6xaelZokyoKIsjRwI7cegJN ad8VZlirzXz55c886nrEM2g3noac1usN3CJreN2YSOS3CeyvA44P0Miivh1xVJ4vLH5uXN8kN/ex 2+mPJzdrO5tpJAoLOIx6mnR/u/i4v1r8icVW3/lf84XetrfwsyhPTnkurVCGEf71UQaVJxSRzv8A HvQfZG2Ksx8k6R5gsrKZvMMolvmlHoj1o7lYoxGqUjdLWy48jyqvE+Nd+IVRfnrUodO8qy3E19ca aBLGqXVpJbxSq7OOI5XREdCdm9vauKvLrrz3P6Igl8x6rDcqBKjG70JSSoB9ORYpGcVG3Lp4rXkC pX2n5gC5llgXzFq6sXY2ate6BV+aggKaipDfCAWK9huDihTh/Ne3k1B1i1zW5kd1lKtPoAUCNFLd AKIRu3Gm1e9aKohPzMhmPL9P6tHE8cSyt9Y0EiJeSIZfhdmUsWUmopudtsVU5/zUt7KDi+vatc+o QVliudAkYerEjBTx6enVgTxpyB37Yqq/8rFtw88n6d1qNiZROjXWhEwsTHEQULkKsbn4W2rvilW0 X80ILTUYBdazqOogemk0cl3oTQAyMp3aIpIVUMAX23260xQ9d0LV4tY0m21KKMxJcry9JmjkKkEq ylomkQ0I7NiqOxV2KuxV2KuxV2KsI/NXTG1HSrSD65cWkSySyyfVre9ueYjhduLizkiIX/WO56Yq 85n0y7sLhRa6jqZmZovUnOmeYi3NUUBiHuKstWrx222+Ppilz2uopPb3EuraiJYS0ygaZ5hJC0Q8 Xpdup3TcVpTuRSiqZTRXi2DJHq+qrFHAIJC+neY2Z+TK7uP9LUgb9a9PhBp1UIeHRb55xJ+l9TJ9 NlmdrDzEAVZQlFD3dQ/HkO4U06HiMUoGC2u7q8Fy+s6kbuH1Jvh03zHIEHIPGEBuTQ1Tl8QIr15Y qiRpUs6wmPWNWiWSqXFtJZ69ccl4gIHjiu3b+6mX4ajatfDFWre24XEE9vquqM3KGP0hZ+YC3rrw HOZWvfs8WBH2djQdMVVbjS5IrX1k1jVQ8rrWQWXmRhzHLcL9aUmvLZvu8Cq2+g3uoTlbbX9Sh+vX CQos9j5hjCzErs3O8oil2JDPWgJ+LbFDLx+WvmEOkq66BJbmU2gL6o6rWRZIuYOo/vCKNyLdajwx Vk2mWPnWPUll1PVrO4sADW3t7N4HZuNPtvPNQct6U+nFU+xV51+Z1ta3FnZI9/NpspuYgLtU1Fog H5pu1lcWYj+0eTM/Tr2xV5wNMgub6Jv07rE81ukztNHp/mP06+i0oYGW5ZSpkFVCULghfiqSVWWW 8v5bvcW9rFJ5lEqsnonl5iAVeYTaQmgSpAbenc774qynQfLPllXttQsLnUebn67Fb3WoaiSvrjl+ 9triY9d6q6deoqMVT/XNP0m/0V7fVZ2trIsrPMtw9qQQ3w1kRk6ntXFWL3nkf8s0Fz9Z1KWM+oWu Wk1e5DKxUrxYtPUfCvfw36Yqmn/KtfLEkr3Mc2oK81XDx6jeBfiIaqgS8abbClPbFVS1/LfyzbMT G18eXMNy1C9JIdOBBb1eRABPHfYmo3xVQf8AKzysyOiyaigkWNHK6jeVKxCgWplJ4nuOnTwxVTb8 pPKBtjb/AOnCLm0qqL66oHdUVjT1KNX0x9qvfFVY/lh5aNxLOZtRrMDyT9I3gQFnLkqol2qT06U7 daqo3S/I2h6bqR1GF72a4ZeDC6vbq5Q7KASk0kikjjtUbdu2Kp+qqqhVAVR0A2GKt4q7FXYq7FXY q7FWIfmPZarc6fZ/o+TVIis9Jn0i4t7aRVdSnJ/rLRo43oByFCeXYYqlPl3Wdd0WO4hurHXdWmdi 6R38+ltKkaMBVDHNH9oPXc9u1RVVN089as1qkp8rX/rSV4wiewqeIQmhNwtR8ZApvt0xVVXzrqTT mNfLOoMgYD1RNp4HAlRz4tcq9KMT9nt86KrV88X5gEr+WtQicyBDBJLYJIFNCGIe5UDY9CRirv8A Gms/ZPla/SThISsk9itHjXkqGlwx/eEhV27+GKof/lYV+ssaSeXLvjMsTQyR3FlIrGRQSlRPsQQ4 r9k8a1pircfn7VfTuZJ/K97EluwVG9ezIkDUAKMZlU1ZlGx79a7YqrN561ASIo8tXzcpfTIWfTyw Hw0cgXJG/Pbf9YxVY3nvVFFu/wDhe+Mc4PMCexEkZrtyVrhV+zuSWFKjFVTTvPF/fTRRR+Xrzk0p jnpPYt6Sh0USsBPVkpIa8ASCpHvirK8VdirAPzOk0j9CxJqFtFclJ4pITc6VcavErHkgKxQ8OL0J HLltXoa4qkXl2P8ALOHSoTP5dT60sRinlTy7c2/qj1FjbhCYHJ5tQlRUnrTFVkc/5MLbgf4XKQQt GkIk0O6qHdpZlWNGg51VhIdhtXbriqb6Va/llJrUC2PlkW+pW87JBcnRZ4FjlhqQ/rm3WNftVRuX yxVOPzJ0m61XyVc2lpYxahcF0eO2np6ZKt1PKW3FfCrde2KvMbnQPNF3cNOnk+wW3uHhdkksbK4b 4HcMXdtSrIQqnlIQC9d+PwnFWWW/mH82yY7f6jFEKpGsn1O24gMn2gv6UVvhZT+z9GKrtK82fmiY /wDT7GOSSKUrN6ENmVYBl5RqW1JaOqhySwA2P8uKoC281fnBPCfTSGSFkkWO9S3sXPNER9wup8eQ 3B7DwP7KqLt/Mn5wmJV/RnqXItWDRNBZ7zqJF58hfpT94o+EKRTbqcVd/iH83zPMJLCVRHGeEMWn QAuZVJV1dtQljBhPGql6nwO9FVZNd/OWMvPJpYljLxKtsLO3DBQP3zKw1Lb4jQV5dOw3xV6Lpq6g thANQdJL3iPXeNPTQsfBOctP+COKonFXYq7FXYq7FXYqwr80tP0O902wTWPrXoC5pGbSxi1Ahyhp zSSC54A0pUAdcVYJH5U8ksJZo5NdQkgz2y+XoEJULx48V00IKJIR770BxVkbr+ULIkb+VJZBFwVG bQLuvQEUrbDtuR38MVVXuPypt3gc+V5KNGAso0W4b0wgIVGpCWVqM1NumKoP6z+Tc11FbnygwE8R uY5P0JKkZAj5kKBECTxX9kEHxNcVV1v/AMpn5PH5VnMe8hKaHdcA9UTYCCgY9Dt2oe1VVqRfk4tG XytKytIkVP0HesobcAcTbkftHYda98VVfW/Kf6m6L5UlNvHCnOP9B3K/uzcAcfigXlxkbkQK9/cY qtW0/KALM0fliV/qTeq3HR72teSxUWsO/FqfB241ptiqnG35QMiOPKLo00skKBtFnVi5CrQkw/Dz 5AKWI+jfFUz0jV/y+0mRrnS/Lt3YyxL9XWe30a7DGOQfWCivHAfg5bkV6+2+Ksm0XzPYaxNJFbW9 7CY0WTld2lxaqQ1NlMyJUivTr36b4qm+KvPfzTl086HFDewwzxCdHMVzpM2rxn4XChIozGqvXvyr TYULA4qwG2i8qyWrrcaXpkZtByq3k+/jQpIrf3cHqM7UkYliFpxqCP2sVXafouhwX2m3F3ZaPPbx MZmZPKl5BcyCOMzvxBZ/TcIrGpBHIii8sVew6FqtlqmmQ3lnFLDbycljhuIXtpQI2KfFDIEdB8NV qBtQ4qqeYrG3vfLt1HPYW+pqiGVLS7QyRM8fxLVFSVjSmwVST0xV5hG+kwiMH8vdOe0ijYoRZX6y EyozUVX047miAsTt4+ClNI/J19dRwTj8v/LYR4lKq07psfiHOM2a/Z6UYVHTFCMuPIss+pT3Mvkf y6xZncSm4di7NG3xOPqaA1elaj36iuKoVPIepJZpEPInllmq0jq9zI6hmRFbiGtDw5AbUagoPCpV TOw8rapp0yahYeUPL1rq8cblbuGVo2WV41qU42oahaSRSOY+Gm+KprJqH5l8uC6NpY5K3GUX0zqG DgLzU28ZA4nl8PLpTauKtzaj+ZRkP1fRtNEYkdaTX0qkoBRWHCCT7TfFvvTanfFWQ6e2oNZxnUEi S839VYGZo/tGnEsAd1piqIxV2KuxV2KuxV2KvPvzhmmWw0mCG4W2knvOKSmZoSrFCoZWS8sGqOXY t/VV5RDqWqzrI9xqdI52EcT/AFxpFZRIZI3RhrIIblCd1BPwmu/VSjG8yzT6hOsWqCOO4uY3Bkv1 cqnDmWqNdVuPFTUAdNu+KoWy1y/sprO+n1k+lKsgu0l1AOj8FIX0g2rnkrq/EbVUjeimmKoEa/dQ fWbP9KPNawREvS5Mh5NKsZCcNZDcSKfabrTYbEKt2usyJDbRHVm9D4VBa+VUWlH5BF1xVPVeS06g dDtiqOk1mWPUWRNZYpHI0ErJqSnmWWjSVOuLRWLmm9dvtdsVU49X1SESRnVyyBYhLI99MPTj5r6c 7A6zQqx226Bu3TFXL5ouZtNRpNSk9S0CsRHqLOeDfulpTXA/wysK+xHQDFVaLzTcWslxcXGrcpmk VbYi+BQKI2Q0iTW/Tb4Qrci5oTtWtQqjrO91LU79dM0i8uNRe4gjlit7W/lkkiBeP1meNNbMfGnL 4OYpUU2qcVeg6BrH5sS6jaxarpzJamUfWZvqtqi+kWQHddRkZSvxn7LH27FQ9ExV59+aNhoOp6Rb WOsJe+iLmORJLLTV1MoxV0HKOS2vVANSKqvIGnY7qsBh8m/l3xaGC+1FxCJTGg8v2bKpWBGaSiaW BSRSnFv92EAKScVZKP8AlTkOmGdPK4awLm3cDQ7g14M1axm35lRIx6LsTiqf+TZvIwuDB5b0Z9NL QtIZP0Vc6dGyBkBAeaCBSSeJoDvSvY4qyjVxcHQL36vK8M6wStHJG3BgyqSAG9Ocr4VEbEdgTirx jTfNPnw3ErSXmqSwWs6zMsSXMwChqyJVdHYlQrEUdqClOtCFKvYeZvzIpOksuph4ozPzSOdxQQFk WkmkSHk7zLyHbidlpiqXp5v/ADHRRcT3Wrcn9SCOzeGZfUQ8uZV10qELIoAZG3Py3XFUZqHmb8wg 88SXmsK8Deg7rbyemwb1ELKyaPXmCten+qdtlChL5m/MWONRLfan9dhMfwosyBlUhZCFbSP3n70J sFb4Wp9nFK64178w19Utfayhldo+Aiua0AZWKkaInCnFSOK717EGihlvlrRfzO1C3iuLzXLq2tLz hKX9aL10DfFIPQn0uBk+LYLUUHTbqq9NiRkiRHcyuqgNIwALEDdiFAWp9hiq7FXYq7FXYq7FXYql 2uaRPqdssMOoXGmurBvXtlgZzQ1p+/imA+gDFUkfyRq5iSNPNWoxBOO0cOnqCADy6W1fiYk7Gnti qtB5P1OOS3dvMuoSejJzcGKwHNQgRY2pbD4QK++53xVkP1W148PRTh048RSla9KeIxVwtLUFiIUq /wBs8Rv332xVs21uSCYkqNgeI6U4/q2xVv0IaEemtGJZthuSKEn5jFXG3t26xIaLwFVH2a1p8tsV Wi0tQAohQADiAFFKV5U6eO+Ktm2tmYMYkLDoSoqMVXCKIMGCKGVeAYAVC+HyxVdirsVebfmF508s aVqNlpGuaRHqpdVvLNJZdOWkwLxoUjvZ4GL9QGQHrTFWBQ+c/wAmWkWOLyVYyySJzZBJoj8AAONf 9KZVXhyJC9PDc4qmFj52/KQpBb2nliwjXUyRPDFcaKtVeUoPrCJdVfkACVAfYlfYqvQvIvmHy7qW nNY6PBDYjTwvPTYJLeVIo5SxiZPqzyIscnFigPE0/ZGKsl1C2u7nR7mCzna1u5InWCZCoKuQeO7K 4G/emKsCt9G/ONb2GR78C2EhSSP67A37sgjnRtNJqOdQOR6b4qhrny7+dSO/oas8saofTJvrVWJD DYj9GdSD4/T2xVGfoP8AN1rl3bUyEkUkAXlswQsvCgA0yL7PLn8x36lVBnyx+cRjKDV5V4RFEY6h bkvyCr8X+4wcSqgnlua9D+1iqYaR5a/NCfUpYdY12ex0+OIelcWc9rcySSc22YS2ENPhf7QUdB9r qqrIbjyprUswePzVqcCgEFI0sjWpJ/bt26Vp0xVafKOtgcU826qBR6kpYMSz8zyJ+rfsmQcQtAAB t4Ksit4nit4onled40VWnkCB3IFC7BFRKt1PFQPADFVTFXYq7FXYq7FXYqslmihQvKwRB1JyE8kY C5GgkAnkst7y2uK+jIHI6gdfuORxZ4ZPpNplEjmrZaxdirsVdirsVdirsVdirsVdirsVeVfmRd3E OsoY/M1rpUMNkstxpt1c2luro05T1n+s2t58JbjGDT29iqwbUfMHmFJoYk85aXExjtXgVtUsFL0j oxQHSHLBjXgwPEim1DQKq0GveaJY7a4Xzpp8rzfuLSFdUsCrlUjJCqukcy/7wNxoD0PcYqy38rfM Guapq14ZNb0/VrExxu0NtfwXT2w4kKqxQ2dowBbasjtsPHfFWTfmnFLJ5Eulit7i5cSREW9o80cj fvAOtvHNJQVrQL9OKvN/Ler3nl+9k1bT/LE4ujB6MQmbXJ+cDSDkOT2TKGEi9Svfr/MpZbP+anm3 0h9X8tlpURJbgPHqQVUYRlqEWJqfjbbqAOlfhxQsm/NvzKl1MkPl4zQIT6Mph1aMurFjHVf0c9G4 0r2PUeyrrv8ANXzlGUeDywZYWBG0epHdlrHR2so9qqQeSDtTviq6L81vNxkDSeWSIFHKbgmpF1Hq qlKNYqS3A1ApX6MVXXX5kefLdfTby/C0/wBVExdU1Jo/V9ZomVStmeW3BuNdvHFW/wDlaHm8GVD5 cLzR+qPSji1Qg+kK/C5sQrVAb8N99lXoekah+kNNt7wxPA0y1eGVHjZWBow4yKj0qNqqKjfFUXir sVdirsVdirH/ADN5zsPL88MNzBLK06l1MfGgANN+RGYGr7QjgIBBNubpdDLMCQQKYh5l83xeZdKu bTTYrlJ0iciFHWGaQlaL6bhqAq1K17V65h4u0sWXNDi2iL58r6Nmo0GTFAnnfcg/L+qXOgXd1f6h HcLCZFURu8ZElYowPRjVIFXj8fM8BU03Pa3W63HAwlYlMXfD3d3P9LTpdLPITEbDzZF/ytvRf+WO 5/5J/wDNWV/y5j/my+xzP5Gyd4d/ytvRf+WO5/5J/wDNWP8ALmP+bL7F/kbJ3h3/ACtvRf8Aljuf +Sf/ADVj/LmP+bL7F/kbJ3h3/K29F/5Y7n/kn/zVj/LmP+bL7F/kbJ3h3/K29F/5Y7n/AJJ/81Y/ y5j/AJsvsX+RsneHf8rb0X/ljuf+Sf8AzVj/AC5j/my+xf5Gyd4d/wArb0X/AJY7n/kn/wA1Y/y5 j/my+xf5Gyd4d/ytvRf+WO5/5J/81Y/y5j/my+xf5Gyd4d/ytvRf+WO5/wCSf/NWP8uY/wCbL7F/ kbJ3h3/K29F/5Y7n/kn/AM1Y/wAuY/5svsX+RsneETpv5m6Tf6hb2UdrcJJcSLGrNwoCxpvRssxd rwnIRAO5YZeypwiZEjZh35tXE0OrQAaXd6gklqo5Wd1rVswYPKKEadbXENFLA/GwY+FAM2zq2Izt HNGtwPLmozyLJKLeSe+8zRuVhKSkoq2rNEeBHSihtl5b4qrLewSTCVtD1eNqLKoiu/NAQqlTLt9R b0mMsaCsfUVqw6Mq9A/KvQbGC1u9Zis7izkupJIIFurjUJna2jclJHj1BY5IpGYmoAI6UJxVM/zV umtvId06TtbO0kSpKJhbmpkBAMhuLPZqUb9507Yq8TvNe9WSb6rrcvEM3wm8CkpGAIg7DWqMQm3O nanI70Uqp1dhb0ttXWNp5IoGkm1Cr1KuhcMmtSUVWapHHYMDvSuKoeHzFcrDDJJqaxzclngSK9VY knEqScWU6woKD0z22qOnTFU50XTfOGtyXSaa15d2tnK0UrJeTStG/wAX7kFdZRWpVd249K+IKqYQ +VfzOit5Zmt9SlmmYvI6zzCQO0YRH4NqgRnjbrVfk2KqreVPzEMhkgg1iNWDHhLcS8ELRESFAmrs 25+ypBrsCVxVTHk38yphKjwaikV0Et51eaUhQS1JVB1mWoUqvLcbHYUrVQ9p8uaQ2kaPb2DzNcSx gmaZnmk5SMeTlTPJPIF5HYFzTFUyxV2KuxV2KuxV5f8Am7/x0dP/AOML/wDEs5rtz64+56Dsb6Je 9h+maRq1/wCpJp8DzGAoHMf2lL14mla/snftmpxYJ5L4RdO0y5oQ2katHyeVfN00gWaynZ9wplPX YtRSx3NF6DLvyOa/pLSNXgA2IWx+S/NMjcU06UnxPEDYVoSTQf1264jQZz/CUnXYR/EGm8m+Z1BI 0+V+LmNvT4yUYUr9gt49cToc380qNbh/nBb/AIQ8y8yh0+UMAC1aUUMaDka0HTvg/JZrrhKfzuL+ cF3+DfNBbiNOlb4uNV4stf8AWBIw/kM380o/O4f5wW/4R8y8Gc6fKoQKzhgFIV60JUkGnwmvh3wf ks1XwlP5zFf1BC3uh6vYxGW8tJIIw4jLOKDmRyA+4VyvJp8kBcgQ2Y88JmokFA5S2uxV2KuxVN/K X/KTaX/zEx/8SGZOi/vof1g4+s/uZe4vas7d453+fyxV2Ku/z/28VSvzhY+Yr7yxPbeXZxb6qzIY ZmdY6BZAzUZopwDQbfD9OKsJPlD81Y4kJu47id5Q0jG6tf3QZTEzRctMWlFPI9/Cu9VXHyn+bYif /To5Jg6TRu97F9qpZ4yE06Oqty332otKU2VUbXyl+dEErCXULWZPTfi3rxn956BRDR7Hc+oeRbxr 9KlFr5b/ADiW24LqoSYuA7pd2oDAhi0hX9Fin2gvU7D2GKGT/wCDNcIkQ+cNW9NhF6ZC2QkX0gQ3 xfV6EPUE/DXbqcVXN5O170Ujj84aqhUHk5SxYsWZ2JPK2JH2wABQAD7lU40nSrmwe5M2p3WoLO/O NLr0j6IJJKoY44zQ8v2q06CgxVMcVdirsVdirsVdiry/83f+Ojp//GF/+JZzXbn1x9z0HY30S97H vLml6ReQXj6hcPbmLj6XpywITVXZvhlZS32R9k5gaXDjmJGZqvMefe52pyziRwi78j+hM5PLOhI4 aTV29JYRLIRJas3qbCi8ZjXr/SvbIOkxDnPau+P/ABTjjVZDyhvfdL/iV8nljTvS4/pv1hHRYR6t sqkNQvxDTlhUHpSv34ZaSFfXdecf+KQNVO/or4S/4lUPlzRgxP6Zk5O9Gdbi1bkp4ijD1gQQTv1H yw/lcf8AP+2Pl/SR+ZyfzPsl+pb/AIS0X0FP6Y4SsQsknrWrIrEE7j1lNNvGvtj+Sx19e/vj/wAU n85kv6NvdL/iVK48saLHGzrq5K0DInq2pbbd60npWnT9e+RlpMYH1/bH4/xMo6rIT9H2S/4lEDyr o728ay6yyxLVRyntStORICqJSB8JFdzv+E/yeMgXP7Y/8U1/m5g7Q+yX6lOTyr5ba3VU1VxKrhJX eW1ZCWSqlEWXxZQTy8cB0eGtp7++P3X7uveyGry39O3ul+r9CiPKnl/kIW1MiYjiWD2hQOQSp/vh t8Br9GQ/J4uXFv8A5v8AxTL83l58O3+d/wASqQ+UfLkwH+5T0pPhDReray1YsB8LiRVO1T7e9MlH RYj/AB0ffE/pRLWZR/DfwkP0IbWfKdit0I9Iu4zEi/v2u7q1FH3IAKN4Docrz6OPFWM7eco/rZ4N ZLhuY38oyY7d2klq6I7xuXUODE6yAA12JUmh26ZgzgYudCYkmHlL/lJtL/5iY/8AiQy7Rf30P6wa dZ/cy9xZ75384Xvl+W3CJbxWrwTTyXt05VOUJULCqqCS7lx70rQEimdRrs2SAHB+PtDz+h0kcwN3 dgUPPqqRebtak0/T7yPy/cTJeW1vO5jcUjedZGZCpHP4PTXelPiGZmORMQS4mfGITlEG6NLo/NWv PGH/AMMXikqrcTJCDU27SkGrfsyL6fz38AZtSZ6FrF3qUUjXOmXGmsgiKpccav6kSuwHEn+7csjf KvQ4oT6D+7H04qvxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV5f+bv/HR0/wD4wv8A8Szmu3Prj7no Oxvol72OeXvMEOkx3CyWouTM8LrX09vSLVH7xJOofqOma/TakYgbF3Xd094Ln6nTHIRRqr7+vuIT T/Gek1ZhphqqqsAf6vIAOQLKeUAahA7k5kfnsf8AM930n/euP+Sn/O+8f75tvPGnHkRpdGqOFTbN xAYttytzvv1wntCH8z/c/wDEqNBL+d/uv+KXf48sRy46bRS/Mp/o5HQ7gmDY8gvY98P8ox/m/wC5 /wCJ9zH+T5fzv91/xSnc+dbGZVT9H0TkzMg+r1HI9AxgJ+yTv7+2Rnr4n+H/AHP/ABLKGhkP4vv/ AOKVz5801oij6e5+MMvA28dFVuS7rDX4So+eT/lGFUY/7kf71h/J87+r7/8AilL/ABxYGKeN9NLi fqxNuWoacqt9XBJO+56ZH+UI0Rw8/wCr/wASz/ISsHi5e/8A4psedtK+sK/6MIj583U/Vn8T8IaD 4TyNeuP5+F3wf7n/AIlH5GdfV/uv+KdH530sIsb6YeJQRyb2xFKUqFNsFrQntiNfD+b/ALn/AIhT oJ8+L/df8UvHnbR1Qf7j3dok9KEN9XpxooBr6RpRVoAQ1PHJfn8f83lt/D/xP60fkZ/zv91+v9SF 1LzZo+qRxJf6fPL9XUiFhcRpSoAP93Agp8P+1lebW48gHFEmvMfoi2YtHPGTwyAvyP6ZMbvHtXuG a0iaG3NOEcjiRhsK1YKlanfpmvmYk+kUPm50AQPUbKY+Uv8AlJtL/wCYmP8A4kMv0X99D+sGnWf3 MvcXtE0EMy8Jo1kQEMFcBhUbg0PhnbEA83jxIjkuwod/n88VdiqKg/uxiq/FXYq7FXYq7FXYq7FX Yq7FXYq7FXYq7FXl/wCbv/HR0/8A4wv/AMSzmu3Prj7noOxvol72A5pHcuxV2KuxV2KuxV2KuxV2 KuxV2KuxVN/KX/KTaX/zEx/8SGZOi/vof1g4+s/uZe4vcf8ARv8AOudu8c7/AEb/ADrirv8ARv8A OuKu/wBG/wA64qqR8OPwfZxVdirsVdirsVdirsVdirsVdirsVdirsVdirE/On+DPrVt/iDn63A+h w9T7Nd/se+artD8vxDxbuvN2Wh8ej4XL4Mc/5BJ/xd/08Zr/APAPP7XO/wAN8vsd/wAgk/4u/wCn jH/APP7V/wAN8vsd/wAgk/4u/wCnjH/APP7V/wAN8vsd/wAgk/4u/wCnjH/APP7V/wAN8vsd/wAg k/4u/wCnjH/APP7V/wAN8vsd/wAgk/4u/wCnjH/APP7V/wAN8vsd/wAgk/4u/wCnjH/APP7V/wAN 8vsd/wAgk/4u/wCnjH/APP7V/wAN8vsd/wAgk/4u/wCnjH/APP7V/wAN8vsd/wAgk/4u/wCnjH/A PP7V/wAN8vsd/wAgk/4u/wCnjH/APP7V/wAN8vsd/wAgk/4u/wCnjH/APP7V/wAN8vsRmjf8qy/S tp9Q9X676q/V6+vTnX4a8tuvjl2D8nxx4b4r25tWf83wHirhrfk//9k= uuid:a3a9f5e9-6e70-3e47-90ff-9d21220eccad xmp.did:afd72426-fb1f-4918-b2ca-358d5cb7cd95 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:f2e9785e-1fd6-de46-ba55-8eb4efd90c7b xmp.did:c782f64f-ee55-484d-b4a3-acdab016f0c4 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:ab17be08-b65f-453f-ae7f-4fe23b51a1d3 2019-02-13T16:27:05-03:00 Adobe Illustrator CC 23.0 (Macintosh) / saved xmp.iid:afd72426-fb1f-4918-b2ca-358d5cb7cd95 2019-09-16T22:22:30-03:00 Adobe Illustrator CC 23.0 (Macintosh) / EmbedByReference /var/folders/rx/z69dp4_17bn6xz2hy6641vkm0000gn/T/TemporaryItems/(Un documento siendo guardado por Illustrator)/HOdJEs.tif /var/folders/rx/z69dp4_17bn6xz2hy6641vkm0000gn/T/TemporaryItems/(Un documento siendo guardado por Illustrator)/HOdJEs.tif Print False True 1 215.900000 279.400000 Millimeters Chivo-Bold Chivo Bold Open Type Version 1.007 False Chivo-Bold.ttf Chivo-Regular Chivo Regular Open Type Version 1.007 False Chivo-Regular.ttf Chivo-BoldItalic Chivo Bold Italic Open Type Version 1.007 False Chivo-BoldItalic.ttf Cyan Magenta Yellow Black Grupo de muestras por defecto 0 Blanco CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Negro CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 Rojo CMYK CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 Amarillo CMYK CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 Verde CMYK CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 Cian CMYK CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 Azul CMYK CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 Magenta CMYK CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 P Charcoal CMYK PROCESS 100.000000 CMYK 65.792322 56.157774 58.059049 62.648964 P Citron CMYK PROCESS 100.000000 CMYK 13.846035 14.843976 94.692910 0.973526 P Cardinal CMYK PROCESS 100.000000 CMYK 24.188600 100.000000 95.858699 21.084915 P Charcoal CMYK 2 PROCESS 100.000000 CMYK 65.493244 58.352023 54.680699 61.406881 P Citron CMYK 3 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=22 M=93 Y=100 K=16 PROCESS 100.000000 CMYK 21.960784 92.549020 100.000000 16.078432 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 R=210 G=211 B=213 PROCESS 100.000000 CMYK 20.856030 14.731058 14.706644 0.360113 Grises 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brillantes 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Grupo de colores 1 1 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 C=9 M=11 Y=62 K=0 CMYK PROCESS 8.984375 11.328125 61.718750 0.000000 P Citron CMYK 2 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 C=85 M=88 Y=0 K=0 CMYK PROCESS 84.765625 87.890625 0.390625 0.390625 C=61 M=83 Y=1 K=0 CMYK PROCESS 61.328125 82.812500 1.171875 0.000000 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 C=66 M=57 Y=54 K=59 CMYK PROCESS 66.406250 56.640625 53.906250 59.375000 C=40 M=32 Y=32 K=11 CMYK PROCESS 39.843750 31.640625 31.640625 10.546875 C=18 M=13 Y=14 K=0 CMYK PROCESS 17.578125 12.500000 13.671875 0.000000 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 5 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageC]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 7 0 obj <>/Font<>/ProcSet[/PDF/Text]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 20 0 obj <>stream HWnWԑ xZ~\av!Z`MQHwDdOOsDAY]Ȭ;ڈ|x{>^woO_[No Z>{-1tn9t<7&WTnG>hڱd Njcŵ|9O)<:~~G__ 6wb E;EORk;Vd"ypB2D/-1-7 %ub-[^*D =Jy.}||"] |s=[o?;c%D6>3)6Ăl{&ۣPBx~YĐAJy4T3y!Φ6rh_fЏbk:3w6 }ue޶;K^UԔӓv3Lq 8㬍\.|,2|RL%:˰&?KֱY<dW#5"ZH{i*96+p[*+.z@}tEOիdPO=ã{ -'iIoDQHHowĊ<`2kڹqp7mQ6PBslE~WXL,): ܰ U͵`oó\#'IJզ h-lCK5n* .REr̾ulʳZ7 %^\/Ry >'Iݵ&}0tSe}@DPRw3t 講$}!Y(.V-1EV jËx`Hj`$MxnHh[ AGxsx[)ڷ4,Q7A^˖ڲI+VJssNA1-]KQ5|RiPg^Z?`V4Šl%E eaSFE,H ,aJl#70ryQz1Ϧ[NC u͔~$0EmIӦ;ٜr}ɘ4 _S!8eVE9VרJRH)-RܟYc+PO{drG1+^L9jSu-u'KTĶTqU)!>*G t %Mh"BM8g=yvӠ/*h إgx{ /e'`(٘LR-]έQFPTAQRI*Z\^4TxC +yQ>jp_*k s$隤 V&u_444>@Iu)6vuL?(r]F,N3~ #MfNppkRHJ\nDSKIDry %*̙w_.~p.>N{8[6O+>O_/$TU|9 O]yQ/C8 OrW|m_o ZH2 0u8P6W"wԿhzKih np^rG @pFl89z W]No&TV#~kX) ?' q?O@_o`裂^RD8*k AK wZYW?X[ҿ-ܝ?9gިvz34?:LaڷqI)@b1qe ?s 䦰{bV`=+_> mDW={MCS|>4?Iף"fțnFuRS 87·o◓. M|hXdҞ3ɴjXDNf|Ysga#0?Eŋ_O xcO+"fB#MsXn~a7X<1 '[Fͩ?Ǽ9~+G@__!sP y;Sqؙ8CLTG3Ҭ3Nw;w`Z szQq,D&;ݛxgcZL4A*'KswgDӤT0$k$tsV.ĀTtcB<v& |va|p̐n_O&Bk5x89 ༵Ш i;~Zޕ^+;hCޠՆ3], E?°XS36r0Ho%EeC&zj4s9idOm= 聕MLhXU+[$'Ћ{MMSn:?1䮞[Mkx=:rOX~C&X -j^\E,la ҇F&c2 Չ1 Fgxb[kWw`'{vc8OVX||iJ9v'{quF=mNѰ1A:} !wݖ:0 7F¤nwirv=SPfWn)(\ؕJ\qxfjRa3u!_A%9_b YXHy2}5Vda*e.t㩞ff 9X yծ BL`bN.)k60 ޸8gKVT_u2]EE#Xn!mM&岸87-UotI)YlƺeQY/F1;Ca5w?/75P-tTsH FO3<P aG`/vܒf|![F_h%2%[5[qD0J׾rv-!*٢PQ.fHiwNxovLt LV4Bɨr1]:D̏wxlSMA7=>AUWDɨdfpB9zsi ƀāDrt@P[E15{'lit)iI v5  =`yaA B֩T 5 ` W3gPhzX ˈA0@M0_s$[\ DAmX9gEUՌЄԐuU; ?^-!EȳoPV3O6eiO:49y@_ BVSuWEFD<@X}jdY9{y)[j N/*S.cr Z\cuwl/e]pxfK*82="Xte6טU• fp"9MvSB>Ql JX+ J5\{cBRf[uǝo!_"GLL\'@ciM]J;8 6h "}GAT61rA1{Sdd FCXӚOwNt| 8I%t kmV Vps{c C[~0f8xL'Ng⣎х9h4\ Gxjl*"2)ajBPQHJ实@D޴:qTtA`PHf`+!I3V.H- {tq*Va2D hP:pr@2( /E/<*A&zϲ22)Cx|KΚ];zSǍ0inR"jf6)K+ƺ]77ԇC&QY6cѢZEZ:h]qQ왂2L떂bυJ]`gTZi4,PhM*ˀ׼$r)d x07eS4,YqMI!I1j%eM l})[uo5iM8vעLQ2KC#|<ͥ|SM :38Ջ4qA^(fH @ _$"(Geuå m+*zrY]~h0?$QsI2(o`v5]De5-2K2U8RyZ7ڐ4JՆ+kҖrf .`/oRDk(LjΕ H{cH!rԧ+p݄B,71P 9_h}K=9î~Me|8\Dn qpWRq c@D6X;iv;@3ĈhTn{h};!Zu|OMzyf*> Wlvkӌ%* S]@XRc2ԥ1,>9I3&I0D^S_XP|kHŒ&Hw>_ 2;Y.q&ظ,R%CcyAڟ'I!8rWaFnˎW1Iop:IP8D]=gP?| )`˛<~ ;|o8i0/]Kv;~ӻ![UFjI"+M15C.Mc'Z z_!/cptfMZEeZxA\} ӭDq8P M&V 4jX^D,1s C%RX%`](.nrrĕ6Jͳ0|7ps«_UzKe!6c0wZܘzr*9lmwq"h# ^*Va(QyEd1-*ŭSTBW5v0 ņ*&_NJ/X W|VҎʄ\ê&>'k]U\erd; K&YhW2U( *R3;̈%QR{i]䲥ǖSbuJ+z4ڞN݄9}"YAH0&D}bX. B B% )cp!0sI Y^(Vesò'eyҗݹOr- m9-ف֨ ʬಌ♒MDKP1ŕpUlpmj?6'Oyf8[ƟeYzAj}n} B0 8V (W4U 1 Wl<}յ[G Ss>iEq2c^[S 9UVxӏn"*&/Ӏ]n[#fw(^KT@!u䲉$P*+;qq:Pz91gJgU~>ؿɲM׉nUSrqv-@{HI/-Yi^3[H84@+`jQ5BhJ %(* 8ejodWܸ?WjsK a`\ C#h!Z8*ьЊPqF?B9t@jZ't[Ulc$k; f2ycv+*Z4I9x#ص,ZK˃ endstream endobj 21 0 obj <> endobj 22 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs -9.757 792 631.514 -155.943 re f endstream endobj 23 0 obj <>/XObject<>>>/Subtype/Form>>stream q -3.725 792 619.45 -156.778 re W n q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS0 gs 0 TL/Fm0 Do Q q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS1 gs 0 TL/Fm1 Do Q Q endstream endobj 25 0 obj <> endobj 28 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 316.6797 1136.2988 cm 0 0 m 1.958 -1.903 l -402.542 -408.974 l -404.487 -407.043 l h f Q q 1 0 0 1 325.4697 1127.5337 cm 0 0 m 1.943 -1.873 l -402.542 -408.931 l -404.472 -407.013 l h f Q q 1 0 0 1 334.29 1118.8276 cm 0 0 m 1.9 -1.932 l -402.587 -408.944 l -404.53 -407.057 l h f Q q 1 0 0 1 343.0957 1110.0928 cm 0 0 m 1.913 -1.917 l -402.572 -408.974 l -404.517 -407.043 l h f Q q 1 0 0 1 351.8564 1101.3291 cm 0 0 m 1.943 -1.873 l -402.557 -408.96 l -404.486 -407.028 l h f Q q 1 0 0 1 360.6904 1092.6079 cm 0 0 m 1.915 -1.916 l -402.601 -408.988 l -404.516 -407.057 l h f Q q 1 0 0 1 369.4668 1083.8882 cm 0 0 m 1.929 -1.917 l -402.572 -408.989 l -404.502 -407.058 l h f Q q 1 0 0 1 378.2715 1075.1382 cm 0 0 m 1.914 -1.901 l -402.571 -408.974 l -404.515 -407.057 l h f Q q 1 0 0 1 387.0625 1066.4033 cm 0 0 m 1.929 -1.916 l -402.572 -408.989 l -404.502 -407.058 l h f Q q 1 0 0 1 395.8379 1057.6685 cm 0 0 m 1.929 -1.901 l -402.542 -408.974 l -404.487 -407.043 l h f Q q 1 0 0 1 404.6436 1048.9336 cm 0 0 m 1.914 -1.903 l -402.572 -408.974 l -404.5 -407.071 l h f Q q 1 0 0 1 413.4336 1040.1841 cm 0 0 m 1.929 -1.901 l -402.557 -408.975 l -404.487 -407.043 l h f Q q 1 0 0 1 422.1953 1031.4204 cm 0 0 m 1.943 -1.888 l -402.528 -408.946 l -404.472 -407.014 l h f Q q 1 0 0 1 431.0146 1022.7144 cm 0 0 m 1.899 -1.932 l -402.572 -408.959 l -404.485 -407.058 l h f Q q 1 0 0 1 439.8203 1013.9795 cm 0 0 m 1.914 -1.917 l -402.557 -408.974 l -404.501 -407.043 l h f Q q 1 0 0 1 448.5811 1005.2144 cm 0 0 m 1.943 -1.886 l -402.542 -408.944 l -404.471 -407.028 l h f Q q 1 0 0 1 466.1914 987.7749 cm 0 0 m 1.929 -1.918 l -402.557 -409.004 l -404.485 -407.073 l h f Q q 1 0 0 1 474.9531 979.0098 cm 0 0 m 1.943 -1.888 l -402.543 -408.974 l -404.487 -407.071 l h f Q q 1 0 0 1 483.7725 970.29 cm 0 0 m 1.899 -1.931 l -402.557 -409.004 l -404.486 -407.073 l h f Q q 1 0 0 1 492.5635 961.5552 cm 0 0 m 1.929 -1.903 l -402.543 -408.989 l -404.486 -407.058 l h f Q q 1 0 0 1 501.3389 952.8052 cm 0 0 m 1.943 -1.902 l -402.543 -408.974 l -404.443 -407.073 l h f Q q 1 0 0 1 510.1592 944.0703 cm 0 0 m 1.885 -1.931 l -402.558 -408.989 l -404.486 -407.058 l h f Q q 1 0 0 1 518.9492 935.3491 cm 0 0 m 1.914 -1.931 l -402.558 -408.988 l -404.501 -407.057 l h f Q q 1 0 0 1 527.7549 926.5859 cm 0 0 m 1.885 -1.947 l -402.601 -409.004 l -404.486 -407.058 l h f Q q 1 0 0 1 536.5449 917.8662 cm 0 0 m 1.943 -1.933 l -402.558 -408.989 l -404.486 -407.058 l h f Q q 1 0 0 1 545.3203 909.1445 cm 0 0 m 1.944 -1.931 l -402.558 -409.003 l -404.471 -407.071 l h f Q q 1 0 0 1 554.1406 900.3813 cm 0 0 m 1.899 -1.946 l -402.601 -409.004 l -404.501 -407.058 l h f Q q 1 0 0 1 562.916 891.6602 cm 0 0 m 1.944 -1.932 l -402.557 -409.003 l -404.471 -407.072 l h f Q q 1 0 0 1 571.6924 882.9248 cm 0 0 m 1.943 -1.931 l -402.543 -408.989 l -404.472 -407.056 l h f Q q 1 0 0 1 580.5117 874.1753 cm 0 0 m 1.9 -1.945 l -402.557 -409.003 l -404.486 -407.086 l h f Q q 1 0 0 1 589.2881 865.4404 cm 0 0 m 1.943 -1.931 l -402.543 -408.988 l -404.472 -407.072 l h f Q q 1 0 0 1 598.0635 856.6904 cm 0 0 m 1.959 -1.901 l -402.542 -408.974 l -404.441 -407.071 l h f Q q 1 0 0 1 606.8838 847.9556 cm 0 0 m 1.943 -1.931 l -402.543 -408.988 l -404.472 -407.071 l h f Q q 1 0 0 1 615.6738 839.2358 cm 0 0 m 1.93 -1.931 l -402.556 -408.989 l -404.486 -407.086 l h f Q q 1 0 0 1 624.4502 830.4707 cm 0 0 m 1.958 -1.901 l -402.542 -408.974 l -404.457 -407.071 l h f Q q 1 0 0 1 633.2695 821.751 cm 0 0 m 1.93 -1.946 l -402.558 -408.989 l -404.501 -407.086 l h f Q q 1 0 0 1 642.0459 813.001 cm 0 0 m 1.943 -1.931 l -402.557 -408.988 l -404.487 -407.056 l h f Q q 1 0 0 1 650.8223 804.2515 cm 0 0 m 1.957 -1.932 l -402.543 -408.959 l -404.458 -407.072 l h f Q q 1 0 0 1 659.6416 795.5166 cm 0 0 m 1.958 -1.917 l -402.557 -408.988 l -404.472 -407.057 l h f Q q 1 0 0 1 668.4316 786.7969 cm 0 0 m 1.943 -1.932 l -402.557 -408.975 l -404.487 -407.059 l h f Q q 1 0 0 1 677.2373 778.062 cm 0 0 m 1.899 -1.961 l -402.587 -408.974 l -404.487 -407.072 l h f Q q 1 0 0 1 686.0127 769.312 cm 0 0 m 1.943 -1.931 l -402.542 -408.974 l -404.472 -407.058 l h f Q q 1 0 0 1 694.7891 760.5483 cm 0 0 m 1.973 -1.887 l -402.543 -408.946 l -404.486 -407.058 l h f Q q 1 0 0 1 703.623 751.8271 cm 0 0 m 1.943 -1.931 l -402.602 -408.989 l -404.486 -407.057 l h f Q endstream endobj 29 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 312.332 1140.576 m 314.291 1138.673 l -90.209 731.602 l -92.154 733.533 l h W n q 0 g /GS0 gs 58.5767937 -326.1593323 -326.1593323 -58.5767937 81.7822266 1099.1697998 cm BX /Sh0 sh EX Q Q q 321.123 1131.811 m 323.066 1129.938 l -81.419 722.88 l -83.349 724.798 l h W n q 0 g /GS1 gs 58.5692024 -326.1170654 -326.1170654 -58.5692024 90.5778427 1090.4057617 cm BX /Sh0 sh EX Q Q q 329.943 1123.104 m 331.844 1121.173 l -72.644 714.16 l -74.587 716.048 l h W n q 0 g /GS2 gs 58.5701752 -326.122467 -326.122467 -58.5701752 99.33992 1081.6890869 cm BX /Sh0 sh EX Q Q q 338.749 1114.37 m 340.662 1112.454 l -63.823 705.396 l -65.768 707.327 l h W n q 0 g /GS3 gs 58.5758705 -326.1542053 -326.1542053 -58.5758705 108.1608887 1072.9571533 cm BX /Sh0 sh EX Q Q q 347.51 1105.606 m 349.453 1103.733 l -55.048 696.646 l -56.976 698.578 l h W n q 0 g /GS4 gs 58.573967 -326.1435852 -326.1435852 -58.573967 116.9564056 1064.1998291 cm BX /Sh0 sh EX Q Q q 356.344 1096.885 m 358.259 1094.969 l -46.257 687.897 l -48.172 689.829 l h W n q 0 g /GS5 gs 58.5773239 -326.162262 -326.162262 -58.5773239 125.7556992 1055.47229 cm BX /Sh0 sh EX Q Q q 365.12 1088.165 m 367.049 1086.249 l -37.452 679.176 l -39.382 681.107 l h W n q 0 g /GS6 gs 58.578495 -326.1687927 -326.1687927 -58.578495 134.5454559 1046.7550049 cm BX /Sh0 sh EX Q Q q 373.925 1079.416 m 375.839 1077.514 l -28.646 670.441 l -30.59 672.359 l h W n q 0 g /GS7 gs 58.5758781 -326.1542358 -326.1542358 -58.5758781 143.338562 1038.0029297 cm BX /Sh0 sh EX Q Q q 382.716 1070.681 m 384.645 1068.764 l -19.856 661.691 l -21.786 663.623 l h W n q 0 g /GS8 gs 58.578495 -326.1687927 -326.1687927 -58.578495 152.1412964 1029.2702637 cm BX /Sh0 sh EX Q Q q 391.491 1061.945 m 393.42 1060.044 l -11.051 652.971 l -12.996 654.902 l h W n q 0 g /GS9 gs 58.5767822 -326.1592712 -326.1592712 -58.5767822 160.9267273 1020.5371094 cm BX /Sh0 sh EX Q Q q 400.297 1053.211 m 402.211 1051.308 l -2.275 644.236 l -4.204 646.139 l h W n q 0 g /GS10 gs 58.5758705 -326.1542053 -326.1542053 -58.5758705 169.7157288 1011.7994385 cm BX /Sh0 sh EX Q Q q 409.087 1044.461 m 411.016 1042.56 l 6.53 635.487 l 4.6 637.418 l h W n q 0 g /GS11 gs 58.5763245 -326.1567078 -326.1567078 -58.5763245 178.5224915 1003.0524292 cm BX /Sh0 sh EX Q Q q 417.849 1035.697 m 419.792 1033.81 l 15.32 626.752 l 13.377 628.683 l h W n q 0 g /GS12 gs 58.572258 -326.1340637 -326.1340637 -58.572258 187.3020477 994.2922363 cm BX /Sh0 sh EX Q Q q 426.668 1026.991 m 428.567 1025.06 l 24.096 618.032 l 22.183 619.933 l h W n q 0 g /GS13 gs 58.573246 -326.1395569 -326.1395569 -58.573246 196.0860138 985.5795898 cm BX /Sh0 sh EX Q Q q 435.474 1018.256 m 437.388 1016.34 l 32.917 609.282 l 30.973 611.213 l h W n q 0 g /GS14 gs 58.5763245 -326.1567078 -326.1567078 -58.5763245 204.893692 976.8452148 cm BX /Sh0 sh EX Q Q q 444.234 1009.491 m 446.178 1007.605 l 41.692 600.547 l 39.763 602.463 l h W n q 0 g /GS15 gs 58.5715332 -326.1300354 -326.1300354 -58.5715332 213.6871948 968.0860596 cm BX /Sh0 sh EX Q Q q 453.055 1000.771 m 454.954 998.84 l 50.497 591.782 l 48.554 593.713 l h W n q 0 g /GS16 gs 58.5789413 -326.1712952 -326.1712952 -58.5789413 222.4649506 959.3587646 cm BX /Sh0 sh EX Q Q q 461.845 992.052 m 463.773 990.134 l 59.288 583.047 l 57.359 584.979 l h W n q 0 g /GS17 gs 58.5815506 -326.1858215 -326.1858215 -58.5815506 231.2767181 950.6427612 cm BX /Sh0 sh EX Q Q q 470.606 983.287 m 472.55 981.399 l 68.063 574.312 l 66.12 576.215 l h W n q 0 g /GS18 gs 58.5767517 -326.1590881 -326.1590881 -58.5767517 240.0473633 941.8793945 cm BX /Sh0 sh EX Q Q q 479.426 974.567 m 481.325 972.636 l 76.868 565.562 l 74.94 567.494 l h W n q 0 g /GS19 gs 58.581543 -326.1857605 -326.1857605 -58.581543 248.8422852 933.1552124 cm BX /Sh0 sh EX Q Q q 488.216 965.832 m 490.146 963.929 l 85.674 556.843 l 83.73 558.774 l h W n q 0 g /GS20 gs 58.5793839 -326.1737366 -326.1737366 -58.5793839 257.6506653 924.423584 cm BX /Sh0 sh EX Q Q q 496.992 957.082 m 498.936 955.18 l 94.449 548.108 l 92.549 550.009 l h W n q 0 g /GS21 gs 58.5767517 -326.1590881 -326.1590881 -58.5767517 266.4532776 915.6784668 cm BX /Sh0 sh EX Q Q q 505.812 948.348 m 507.697 946.416 l 103.254 539.358 l 101.326 541.29 l h W n q 0 g /GS22 gs 58.5789261 -326.1712036 -326.1712036 -58.5789261 275.2226868 906.9346313 cm BX /Sh0 sh EX Q Q q 514.603 939.626 m 516.517 937.695 l 112.045 530.638 l 110.102 532.57 l h W n q 0 g /GS23 gs 58.5786591 -326.1697083 -326.1697083 -58.5786591 284.0201416 898.2145386 cm BX /Sh0 sh EX Q Q q 523.407 930.863 m 525.293 928.917 l 120.807 521.858 l 118.922 523.805 l h W n q 0 g /GS24 gs 58.5802078 -326.1783447 -326.1783447 -58.5802078 292.8171692 889.449707 cm BX /Sh0 sh EX Q Q q 532.198 922.143 m 534.142 920.21 l 129.641 513.154 l 127.712 515.085 l h W n q 0 g /GS25 gs 58.5789261 -326.1712036 -326.1712036 -58.5789261 301.637146 880.7351685 cm BX /Sh0 sh EX Q Q q 540.974 913.421 m 542.918 911.49 l 138.416 504.419 l 136.502 506.35 l h W n q 0 g /GS26 gs 58.5812645 -326.1842346 -326.1842346 -58.5812645 310.4190063 872.0148926 cm BX /Sh0 sh EX Q Q q 549.794 904.658 m 551.693 902.712 l 147.193 495.654 l 145.293 497.6 l h W n q 0 g /GS27 gs 58.5802078 -326.1783447 -326.1783447 -58.5802078 319.203186 863.2451782 cm BX /Sh0 sh EX Q Q q 558.569 895.937 m 560.514 894.006 l 156.012 486.934 l 154.099 488.865 l h W n q 0 g /GS28 gs 58.5812721 -326.1842651 -326.1842651 -58.5812721 328.0147705 854.5302124 cm BX /Sh0 sh EX Q Q q 567.346 887.202 m 569.289 885.271 l 164.802 478.213 l 162.874 480.146 l h W n q 0 g /GS29 gs 58.579361 -326.1736145 -326.1736145 -58.579361 336.7916565 845.7955322 cm BX /Sh0 sh EX Q Q q 576.165 878.452 m 578.065 876.507 l 173.608 469.449 l 171.679 471.366 l h W n q 0 g /GS30 gs 58.5812759 -326.1842957 -326.1842957 -58.5812759 345.5794678 837.039978 cm BX /Sh0 sh EX Q Q q 584.941 869.717 m 586.885 867.786 l 182.398 460.729 l 180.47 462.646 l h W n q 0 g /GS31 gs 58.5791016 -326.1721802 -326.1721802 -58.5791016 354.3861389 828.3105469 cm BX /Sh0 sh EX Q Q q 593.717 860.967 m 595.676 859.066 l 191.175 451.993 l 189.275 453.896 l h W n q 0 g /GS32 gs 58.5767784 -326.1592407 -326.1592407 -58.5767784 363.1860352 819.5649414 cm BX /Sh0 sh EX Q Q q 602.537 852.232 m 604.48 850.301 l 199.994 443.245 l 198.065 445.161 l h W n q 0 g /GS33 gs 58.5791092 -326.1722107 -326.1722107 -58.5791092 371.9819031 810.8258667 cm BX /Sh0 sh EX Q Q q 611.327 843.513 m 613.257 841.582 l 208.771 434.523 l 206.841 436.426 l h W n q 0 g /GS34 gs 58.5789452 -326.1713257 -326.1713257 -58.5789452 380.7566833 802.1032715 cm BX /Sh0 sh EX Q Q q 620.104 834.748 m 622.062 832.847 l 217.561 425.773 l 215.646 427.676 l h W n q 0 g /GS35 gs 58.5767784 -326.1592407 -326.1592407 -58.5767784 389.5649719 793.3441162 cm BX /Sh0 sh EX Q Q q 628.923 826.028 m 630.853 824.082 l 226.365 417.039 l 224.421 418.941 l h W n q 0 g /GS36 gs 58.578907 -326.1711121 -326.1711121 -58.578907 398.3438721 784.6170044 cm BX /Sh0 sh EX Q Q q 637.699 817.278 m 639.643 815.347 l 235.142 408.291 l 233.212 410.222 l h W n q 0 g /GS37 gs 58.5786781 -326.1697998 -326.1697998 -58.5786781 407.1377563 775.8703613 cm BX /Sh0 sh EX Q Q q 646.476 808.528 m 648.433 806.597 l 243.932 399.569 l 242.018 401.457 l h W n q 0 g /GS38 gs 58.574131 -326.1445007 -326.1445007 -58.574131 415.9335632 767.1238403 cm BX /Sh0 sh EX Q Q q 655.295 799.793 m 657.253 797.877 l 252.738 390.806 l 250.823 392.737 l h W n q 0 g /GS39 gs 58.5786858 -326.1698608 -326.1698608 -58.5786858 424.7492371 758.3884888 cm BX /Sh0 sh EX Q Q q 664.085 791.074 m 666.028 789.143 l 261.528 382.1 l 259.598 384.016 l h W n q 0 g /GS40 gs 58.5763321 -326.1567383 -326.1567383 -58.5763321 433.5235901 749.6658325 cm BX /Sh0 sh EX Q Q q 672.891 782.339 m 674.79 780.377 l 270.303 373.364 l 268.404 375.268 l h W n q 0 g /GS41 gs 58.5754089 -326.1516113 -326.1516113 -58.5754089 442.3041382 740.9265137 cm BX /Sh0 sh EX Q Q q 681.666 773.589 m 683.609 771.658 l 279.124 364.614 l 277.194 366.531 l h W n q 0 g /GS42 gs 58.5767937 -326.1593323 -326.1593323 -58.5767937 451.1116943 732.182373 cm BX /Sh0 sh EX Q Q q 690.442 764.825 m 692.415 762.938 l 287.899 355.88 l 285.956 357.768 l h W n q 0 g /GS43 gs 58.5717773 -326.1314087 -326.1314087 -58.5717773 459.8988953 723.4207764 cm BX /Sh0 sh EX Q Q q 699.276 756.104 m 701.22 754.173 l 296.675 347.115 l 294.79 349.048 l h W n q 0 g /GS44 gs 58.5775642 -326.1636353 -326.1636353 -58.5775642 468.7153931 714.6964722 cm BX /Sh0 sh EX Q Q endstream endobj 31 0 obj <> endobj 78 0 obj <> endobj 32 0 obj [/DeviceN[/Black]/DeviceCMYK 80 0 R 81 0 R] endobj 79 0 obj <> endobj 82 0 obj <> endobj 83 0 obj <> endobj 80 0 obj <>stream {1.000000 2 1 roll 1.000000 2 1 roll 1.000000 2 1 roll 0 index 1.000000 cvr exch sub 2 1 roll 5 -1 roll 1.000000 cvr exch sub 5 1 roll 4 -1 roll 1.000000 cvr exch sub 4 1 roll 3 -1 roll 1.000000 cvr exch sub 3 1 roll 2 -1 roll 1.000000 cvr exch sub 2 1 roll pop } endstream endobj 81 0 obj <> endobj 84 0 obj <> endobj 33 0 obj <> endobj 34 0 obj <> endobj 35 0 obj <> endobj 36 0 obj <> endobj 37 0 obj <> endobj 38 0 obj <> endobj 39 0 obj <> endobj 40 0 obj <> endobj 41 0 obj <> endobj 42 0 obj <> endobj 43 0 obj <> endobj 44 0 obj <> endobj 45 0 obj <> endobj 46 0 obj <> endobj 47 0 obj <> endobj 48 0 obj <> endobj 49 0 obj <> endobj 50 0 obj <> endobj 51 0 obj <> endobj 52 0 obj <> endobj 53 0 obj <> endobj 54 0 obj <> endobj 55 0 obj <> endobj 56 0 obj <> endobj 57 0 obj <> endobj 58 0 obj <> endobj 59 0 obj <> endobj 60 0 obj <> endobj 61 0 obj <> endobj 62 0 obj <> endobj 63 0 obj <> endobj 64 0 obj <> endobj 65 0 obj <> endobj 66 0 obj <> endobj 67 0 obj <> endobj 68 0 obj <> endobj 69 0 obj <> endobj 70 0 obj <> endobj 71 0 obj <> endobj 72 0 obj <> endobj 73 0 obj <> endobj 74 0 obj <> endobj 75 0 obj <> endobj 76 0 obj <> endobj 77 0 obj <> endobj 129 0 obj <> endobj 130 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5767822 -326.1592712 -326.1592712 -58.5767822 160.9267273 1020.5371094 cm BX /Sh0 sh EX Q endstream endobj 131 0 obj <> endobj 132 0 obj <> endobj 133 0 obj <> endobj 134 0 obj <> endobj 135 0 obj <> endobj 11 0 obj <> endobj 128 0 obj <> endobj 136 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.578495 -326.1687927 -326.1687927 -58.578495 152.1412964 1029.2702637 cm BX /Sh0 sh EX Q endstream endobj 137 0 obj <> endobj 127 0 obj <> endobj 138 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5758781 -326.1542358 -326.1542358 -58.5758781 143.338562 1038.0029297 cm BX /Sh0 sh EX Q endstream endobj 139 0 obj <> endobj 126 0 obj <> endobj 140 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.578495 -326.1687927 -326.1687927 -58.578495 134.5454559 1046.7550049 cm BX /Sh0 sh EX Q endstream endobj 141 0 obj <> endobj 125 0 obj <> endobj 142 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5773239 -326.162262 -326.162262 -58.5773239 125.7556992 1055.47229 cm BX /Sh0 sh EX Q endstream endobj 143 0 obj <> endobj 124 0 obj <> endobj 144 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5775642 -326.1636353 -326.1636353 -58.5775642 468.7153931 714.6964722 cm BX /Sh0 sh EX Q endstream endobj 145 0 obj <> endobj 123 0 obj <> endobj 146 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5717773 -326.1314087 -326.1314087 -58.5717773 459.8988953 723.4207764 cm BX /Sh0 sh EX Q endstream endobj 147 0 obj <> endobj 122 0 obj <> endobj 148 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5767937 -326.1593323 -326.1593323 -58.5767937 451.1116943 732.182373 cm BX /Sh0 sh EX Q endstream endobj 149 0 obj <> endobj 121 0 obj <> endobj 150 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5754089 -326.1516113 -326.1516113 -58.5754089 442.3041382 740.9265137 cm BX /Sh0 sh EX Q endstream endobj 151 0 obj <> endobj 120 0 obj <> endobj 152 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5763321 -326.1567383 -326.1567383 -58.5763321 433.5235901 749.6658325 cm BX /Sh0 sh EX Q endstream endobj 153 0 obj <> endobj 119 0 obj <> endobj 154 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.573967 -326.1435852 -326.1435852 -58.573967 116.9564056 1064.1998291 cm BX /Sh0 sh EX Q endstream endobj 155 0 obj <> endobj 118 0 obj <> endobj 156 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5786858 -326.1698608 -326.1698608 -58.5786858 424.7492371 758.3884888 cm BX /Sh0 sh EX Q endstream endobj 157 0 obj <> endobj 117 0 obj <> endobj 158 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.574131 -326.1445007 -326.1445007 -58.574131 415.9335632 767.1238403 cm BX /Sh0 sh EX Q endstream endobj 159 0 obj <> endobj 116 0 obj <> endobj 160 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5786781 -326.1697998 -326.1697998 -58.5786781 407.1377563 775.8703613 cm BX /Sh0 sh EX Q endstream endobj 161 0 obj <> endobj 115 0 obj <> endobj 162 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.578907 -326.1711121 -326.1711121 -58.578907 398.3438721 784.6170044 cm BX /Sh0 sh EX Q endstream endobj 163 0 obj <> endobj 114 0 obj <> endobj 164 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5767784 -326.1592407 -326.1592407 -58.5767784 389.5649719 793.3441162 cm BX /Sh0 sh EX Q endstream endobj 165 0 obj <> endobj 113 0 obj <> endobj 166 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5789452 -326.1713257 -326.1713257 -58.5789452 380.7566833 802.1032715 cm BX /Sh0 sh EX Q endstream endobj 167 0 obj <> endobj 112 0 obj <> endobj 168 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5791092 -326.1722107 -326.1722107 -58.5791092 371.9819031 810.8258667 cm BX /Sh0 sh EX Q endstream endobj 169 0 obj <> endobj 111 0 obj <> endobj 170 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5767784 -326.1592407 -326.1592407 -58.5767784 363.1860352 819.5649414 cm BX /Sh0 sh EX Q endstream endobj 171 0 obj <> endobj 110 0 obj <> endobj 172 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5791016 -326.1721802 -326.1721802 -58.5791016 354.3861389 828.3105469 cm BX /Sh0 sh EX Q endstream endobj 173 0 obj <> endobj 109 0 obj <> endobj 174 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5812759 -326.1842957 -326.1842957 -58.5812759 345.5794678 837.039978 cm BX /Sh0 sh EX Q endstream endobj 175 0 obj <> endobj 108 0 obj <> endobj 176 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5758705 -326.1542053 -326.1542053 -58.5758705 108.1608887 1072.9571533 cm BX /Sh0 sh EX Q endstream endobj 177 0 obj <> endobj 107 0 obj <> endobj 178 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.579361 -326.1736145 -326.1736145 -58.579361 336.7916565 845.7955322 cm BX /Sh0 sh EX Q endstream endobj 179 0 obj <> endobj 106 0 obj <> endobj 180 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5812721 -326.1842651 -326.1842651 -58.5812721 328.0147705 854.5302124 cm BX /Sh0 sh EX Q endstream endobj 181 0 obj <> endobj 105 0 obj <> endobj 182 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5802078 -326.1783447 -326.1783447 -58.5802078 319.203186 863.2451782 cm BX /Sh0 sh EX Q endstream endobj 183 0 obj <> endobj 104 0 obj <> endobj 184 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5812645 -326.1842346 -326.1842346 -58.5812645 310.4190063 872.0148926 cm BX /Sh0 sh EX Q endstream endobj 185 0 obj <> endobj 103 0 obj <> endobj 186 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5789261 -326.1712036 -326.1712036 -58.5789261 301.637146 880.7351685 cm BX /Sh0 sh EX Q endstream endobj 187 0 obj <> endobj 102 0 obj <> endobj 188 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5802078 -326.1783447 -326.1783447 -58.5802078 292.8171692 889.449707 cm BX /Sh0 sh EX Q endstream endobj 189 0 obj <> endobj 101 0 obj <> endobj 190 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5786591 -326.1697083 -326.1697083 -58.5786591 284.0201416 898.2145386 cm BX /Sh0 sh EX Q endstream endobj 191 0 obj <> endobj 100 0 obj <> endobj 192 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5789261 -326.1712036 -326.1712036 -58.5789261 275.2226868 906.9346313 cm BX /Sh0 sh EX Q endstream endobj 193 0 obj <> endobj 99 0 obj <> endobj 194 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5767517 -326.1590881 -326.1590881 -58.5767517 266.4532776 915.6784668 cm BX /Sh0 sh EX Q endstream endobj 195 0 obj <> endobj 98 0 obj <> endobj 196 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5793839 -326.1737366 -326.1737366 -58.5793839 257.6506653 924.423584 cm BX /Sh0 sh EX Q endstream endobj 197 0 obj <> endobj 97 0 obj <> endobj 198 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5701752 -326.122467 -326.122467 -58.5701752 99.33992 1081.6890869 cm BX /Sh0 sh EX Q endstream endobj 199 0 obj <> endobj 96 0 obj <> endobj 200 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.581543 -326.1857605 -326.1857605 -58.581543 248.8422852 933.1552124 cm BX /Sh0 sh EX Q endstream endobj 201 0 obj <> endobj 95 0 obj <> endobj 202 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5767517 -326.1590881 -326.1590881 -58.5767517 240.0473633 941.8793945 cm BX /Sh0 sh EX Q endstream endobj 203 0 obj <> endobj 94 0 obj <> endobj 204 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5815506 -326.1858215 -326.1858215 -58.5815506 231.2767181 950.6427612 cm BX /Sh0 sh EX Q endstream endobj 205 0 obj <> endobj 93 0 obj <> endobj 206 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5789413 -326.1712952 -326.1712952 -58.5789413 222.4649506 959.3587646 cm BX /Sh0 sh EX Q endstream endobj 207 0 obj <> endobj 92 0 obj <> endobj 208 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5715332 -326.1300354 -326.1300354 -58.5715332 213.6871948 968.0860596 cm BX /Sh0 sh EX Q endstream endobj 209 0 obj <> endobj 91 0 obj <> endobj 210 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5763245 -326.1567078 -326.1567078 -58.5763245 204.893692 976.8452148 cm BX /Sh0 sh EX Q endstream endobj 211 0 obj <> endobj 90 0 obj <> endobj 212 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.573246 -326.1395569 -326.1395569 -58.573246 196.0860138 985.5795898 cm BX /Sh0 sh EX Q endstream endobj 213 0 obj <> endobj 89 0 obj <> endobj 214 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.572258 -326.1340637 -326.1340637 -58.572258 187.3020477 994.2922363 cm BX /Sh0 sh EX Q endstream endobj 215 0 obj <> endobj 88 0 obj <> endobj 216 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5763245 -326.1567078 -326.1567078 -58.5763245 178.5224915 1003.0524292 cm BX /Sh0 sh EX Q endstream endobj 217 0 obj <> endobj 87 0 obj <> endobj 218 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5758705 -326.1542053 -326.1542053 -58.5758705 169.7157288 1011.7994385 cm BX /Sh0 sh EX Q endstream endobj 219 0 obj <> endobj 86 0 obj <> endobj 220 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5692024 -326.1170654 -326.1170654 -58.5692024 90.5778427 1090.4057617 cm BX /Sh0 sh EX Q endstream endobj 221 0 obj <> endobj 85 0 obj <> endobj 222 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs 58.5767937 -326.1593323 -326.1593323 -58.5767937 81.7822266 1099.1697998 cm BX /Sh0 sh EX Q endstream endobj 223 0 obj <> endobj 30 0 obj <> endobj 26 0 obj <> endobj 27 0 obj <> endobj 24 0 obj <> endobj 16 0 obj <> endobj 224 0 obj <> endobj 225 0 obj <> endobj 226 0 obj <> endobj 15 0 obj <> endobj 14 0 obj <> endobj 13 0 obj <> endobj 229 0 obj <> endobj 230 0 obj <>stream HV{xWG'ICݝ$YI"Y^K`yt<@J *_kUĪBUۻѶT[E}i~ŒԷUP 빻!_K~{sfs~gnx.8[7|۝4p%l;?x*7mݳ~KAPQwDWM%Z7A޿ͽG}DJx7M exzx?۾sWoZ:{ԾEuZ3퇋mZ<}Q%162H]r0Zѱ| 5Ѵp91v2/L?ipYᅌ^]ˁ4EH3q/#?SNNx '6O1B3'Q‘T Ph JB,t`ތ`#K .P^x+v;~܄$>xo'|_ ܁!}Cx?9T嘈`؁A{C؏#8/va8{4P1MfZi6i1MFTO> t xO؉?xȤr2h9ɅPvD5"Q>P!4 2rS~i>%Rw΍1 5LCo|F؆ u ZFBREt.frqƙϽ1\'3ZOt=t@ӵG[G9 ZMbhG^;ݧܾb_W|}Z:#wfxi%pVu6FJ{\TIBdy w.K엘[oJS˻/,0B%0:y<6rpg?R9ư 3sOt 3zhNH+ʴ Z6Ifi2mvxIv\zvv)3 JGWQ wb+`ԑ;swAf᳴I9ݝ=^|a̕(W*mcU#|QЉE <v0ky.L<dóvx2&y}'<|lף}(/P S^Lƻ߇j@-n"fьOb> тOc6>+_VKq'!($㛈.j܋klǵxI~)61𬈌Nѱ9o>ϺMdj9:9]R>lO/sIc3 -/}&P/ѡQkIBbm%OIS`|J2>%OɩOƧiy6 aΔg^n`@LE2U4 5_BWJKџrQE$΃L1>3V7%Lȫ0;zƴusν ?bca`> I$LI]&w5eɶVVM:ttkG'MSR5&mگ6MSk,i;iqss>ǹ8qO^vus ,~P-j{4VnQ_E >Ąޘw+[]QFUሀ I v@rV5՘WaoL[Ka^M#3ü lF g+PٝXf,[XRT!Yvp9`we]`lh-S.A ZVDNj^J!]% uo>R2bқ3d&EA/U !wc[Ow-xKk=R vKP`˥Bê5#ӛݎQ'h߶ӵ۞f:fGՎȗm8U;#`8H*4`FY :VGH?$+o lQiЖ 6Ao툔tΈOѕ=tzviPˎz},Gp.oupb D?f`/`_CG&) FA0w:rt(zjcy@,(8zyY'ADaGr,!2kqn.D']v!:Btۅ Yиk3 I < =ǨyZYsݛ>ohg!|i;Tf2lvGl>TdGXfk﬽>?V7(2ZU|YI |f ThN%A\&9$mH%AFǃoLjlUJ RIvFh4Ȳ A퉐q rvxnw-H@MͲDx{tfoR.uߺ^N7 m[2DȜ͔(c%3+,T-55 54}`p%Sf@=o,s}|ȗ˲qT[>s ^g8aA;G`G9Q2^ JB+90.Lg5Ȟ'+B\M'{&اzKaM4dj `I;H6(#qG\Gk߿5mڸHS&dHskFLDb'_gH\q)8"%[gGnۮ$f*[ol>U[7N06E"yD@ T#L4E#0@Vɔ\( 'xDzZp9ˉ{iC8h6 ѦEA.7S.K_򖛅`+_]|L@X YU΁=\Kai$G3f$[bq?x TM%arIk3yr61Fo8ʛFUhOLJH^矞6QJ-!'Cl}p"{"㑴oiJXƺ- ?avejJysHѪAkIxq L4*}+_wٯ,23pq=y@pAQoY V3u[5ct?;x+'_R]CC{-#WM>} 8:՗4A9P@bA_p)ĩ"(g ?yK{& Wpi.e3] fJLdn$j``VUsD*uF=ux6S 8JPH@/IlAoU4kTsYXQcTllٱؘ; FzL`sMh3'S Gn̆}^W ~7/@[/99Tf")Tb~F\qgdCha冝Oj{m m )$uSxKAӚfMȿlzeiS}/|B>SSSc;U8xcymb~ B|H2 LI#V3dv<*BG `n=#vHR5_>03u3wB~E}R4:4~D.j.0^QWxf2^wk^Xcc K!lPRJ (CkJ_BIJZ6j37\F#K?i ;CHTxZ>EEa!i MB<YI~gSˠ]һ;˸k#nd67D̶@՞KU{6{}ÊVQo q^䩗sRJTh+ rreOQBN$ =C#ˌL}U 㙩 }c*Ct%X&[,!/C)$ f;`0(əs!%؃sMvsTҼ=ʕ_[' %&xct"v2);,~~BrϿod?Fq[S^a$E8.O Sho"CPryMՕ}:M$wO*H^-L{pI$Č q6F/w%!IGIFH#qtT#I.9Δ=dDw끘Llz[-܍StSm2֑n{(yLyIIyb.j AQKS4[t z^^Ak  P'T"w T tn#^vzY/NgsH΢e*-;TB^[Z+G6yEӀ63j@"d*b5gPF EϠF.#iK[3b3[: {*"m"JN+d>sCn+Iyoy>$m]zwc9½PHiSDv9-)AW|'? wssٌw-wߵ| θ<7t^&W'3؉e̎?M_ٓ/BB]-|n'T؆{ Tutr W酳JjK=/F?8uF<5 2Pp%:W fƈJYGdƝ PWgᗔz|@fO:/9HL?7ǰ?dG+T?esh9PfX)䠾E(> [6_7#iXX)΀ïxwuy&I۹KPDKd9[ϊ/XPU95dGG9zx~ykd;` $*` ܎qnP~q/Բ5d=k CZYه=V"* Nxe%J*V9Xi?)Iߢ ^zh=h=MZc4c2Tϲ#7{A >!Om} .qQ)vQ_.MDQ?w&Zh-*ڒ&,liN:a2-t'-q;4Bm ]KR(WE!~]8?fwϜw曛; wsL?Ҁ~^Vu !]_g¹ 9tq˜OqDU 6Ĺ oŰGMxkxA#ۼ?Mq^hc!ߜm,֡&9bQހڼjȳgm c-F 8|u^܅'P3-,-l%I,mVmLvۚla~akⲭOl~mk7 Q4.zBVYUHhd6 je剙_+eC$+ZKc"_DU2C郅. &eEIԜ0bKO?EaGH#T  nLɢi%$i3;L3( iTF UiOLK"I8 6h -)FI]=(BB kh'vD^/w;$>Huܣ̬M!RǑ=jj+x*m$*cK%Or[n`-[o endstream endobj 228 0 obj <> endobj 231 0 obj <>stream HVyxTW7KJB μ$HXL2l:ZIR!jZێXQKUZmE]mmU,RuVhܙү{{Ͻ9w _ >+VODo5]"ÖM#Ӏr=۞T5[7wǻ"@5u3/d Pw`pd,غ=/@o|/b[@'Ϗ~o΁am=M985{ZW"YI02H]r0ZlbhCi78 SJGiNe#/e?ipk<ëx'IJi)4DUi^ïps8ƹyq+^ITCx8Q ^PL4цXXUx7868K-{1Gp#(%܆o;C83<i3T嘀K`؁A\ac؇؏܎89GFs,fM4B&!j yIPh* dSlOGnpvTKJ/T趋0X"rE+#ҽz]Leeژr cJX!cIvO@jHT: 5R~(Kw8敎zkɘ(/[sxl䥑J߬v{ ټ"._=V[-%-ːƺ-+ 8+In#8,Iv@:M])ƠP属@R h2$"Rͮz2fG*+fX^K1 ڈt2'Hyj Kmc{!]Mc jA(q؉BAۖbwd\5r  3ߜ[.-I#tS)tv򜗜#ޑ5Qp㲎OA?mB3h HҴwd%8?AKzl<< b~MI&$#`(d-d- KȚXaIO1fde,:{y<^fPZK$Ńدj+9*TI G}4Rc$Wm|ܳի#Lb1NWߜ $0!f&W&-&&.| .(l6wi)q{ v7uic+d"%+9J7S%̔S fʥdr+%kTTSL\ܥbAirT#Q6*ZMb|`|Jz>Ƨc|J3>%OIm2 l!έʤgZjʀ_ӘY4s /CWGSKrZSE72eldުnYg> muTޕJj n:ZX6^K]l,˲l/6h HJ)/}jy@QLɐEզh7tzSvٹ}M'/޸qQyqz±f߽^v!5< ˙MJڒ QbuyVWQJd ?8?8L׮2{r\rj Rc%= hfıPXB~  +WYA/ ~bmE'<-OWcXӰjOKmVsXQv+&*S_fʍw܄(v;V4FazЫZ|βVh0<69ONJ1il=[g5@  p~Pɠ4P۠+ޭRjBWqt(6nbvGDXBE4NQ'Q[W ՉUzz]ںZju*K7(Uccw풟3^z;W3ㅯ]Y݁x].+I>bKbf'`[ᩪh!!+6sY;ݞ{{F>~|xLcl*S*T99cҧ TnY tUUع]N[:M?o(:LCb^틥<}m ]i?׍ukԤ?5T+O?)hc-l*׎5 PXi+nPFCEutUC+u<(_e鉨-[{1툌<1^1~l(ۙhãNkb⿓V«K\4:(%EN%fK~xMޑf3*|KhFv!p6&Te`eNٓ %t/cJ!ёqr!omog;5͖r+c.]hB½}F'z _8P媭m ֋;}N~6+:p(jDY(rZIm&G II,ɶ"),ś`8ځu(PEEqERvQ@(|8Nh1{ιޡMO(_ 饖h!5}z*5qHIŜ#w:ji@ K}X )RZw#gi= ݒP)6C*1uQq~-p8C¾ejϯmNd]/;=6R8돎^w .A.Ab%|Jnc=؝Uf雾Zչ7RXOLLL_6Q +PܢhN]_X xE/KFѤnȢT׺sKa]< #KQnRh{!4pGgMgT"^ݛ:-rRc!xޖ5B&,y#$+HYKE0[[ٞ-iRs081̜|cu$@0sWHƐY%`@DT"n : G}^!;i-$ Spd pDxsl Ýk-3sf=^_zړcPHCX.6@moDZ{]3_4mmJ\'@PFA p v*hE &Qpi(!X#݊-e?6|[AGSܚmf$@G !E) f-rZ^Yь0xgnO Bzf/DL#*uk -) ؆ m"xvjmU'nZGrF%/x$k~om$QoO"Btt@`59Y2.S}aW_xe!wYFcJqa!*P`i1-QmuZe޻x+A03R#5}+~P-BjvӻK|wОE,:JM2V@uP&V\I54KRuEJ]/^.LƁh8i]9]}_Oy&HF$.8GT U,v8>d+*Y.<Zh03p*!*oFU6svȎ}ŬnHlfLS*f-+(jb ]f8ڭ찞|IgqT>C Sbhw3E4""d8^$rF M_BW7L+2? {Ýщ<ߨnjHY>0НQq4,ȕc27Hg20fsE}Cw,J)cȉ=Q"""=ڲ76x<{ggm˜@+@DvṴ<5*qdU7@nd||PEGjnk/L@h^-,ԩ:i(xB*Q8NSdB.?\~{*5zpg繳 Vw<# T1>]ITH۳iTyQt ~AV?mTx|G͛|4TVkYy 04&0ByVKQA!o u Z0MH?V.5PCYh",Jp(?З%|E_:Fznj:rnìf5 4DghHaU%K bE_p'NS'kQOE'ζҥWN}S5"g'!,P>&?DH͑!f VRu.H<@H}ٜhnI`T^w_&5)XYYAMesc27 @p .ylcZc⸮w, ,FX?L^:Ԧ/8~tYE8!ʫSYME4iEl,ǖ"+ȵyJiRi߽3l.Oߞ3瞙{̹w뱭Oe*p-V+n#(_!;XBH9!uh $=a`&GU)/C&ҽr1?cvQ6f2K#/ڕΌx4B򓎿앻Xjڧk3V7Q D=cNeܖeB$(nʗo=obe:K9VΦF#)'9\'Z3"Ɠobmʌ0ӡ$bg,)>6lꨗׇߏ<1AHXjFa>U讲m>jR/}LU/X@nh>0-cweɃxLl9Ueu6uuCmWv~W;}8_d %[dDP|e_Y^h|䯱mKAʅ|r0&7ں\t\4XmHy> _օpSw?Kqc ط + ɇ+Bͽx ҋsm6h[ d Gh^%Z(?K8?)<#(6" f6ƴt6M^&:MOդ/C~NQY؈bbR噔alA8͚<~K&y0 ζuVr؃:wcEz EWY!N)%OS`nGi_ce\~\!s Ya5+KQ+(uqwiM1ڎ383C뽢6d1sZ2G\ǣed1bFFVz=LqT[Xw,B6}+9v#K S̱k 596[0_mdl>s@@I!lkx)1qBMSq +)i&⌸͂mwe26q˂* ~<eC/,8+!VUw~L\DoGg7,2pƵy_(ƛw<'NxzK, j B1]pCa# _"C HTb a>[P#x;Aw<Nr(w!92LkDm@؎3f%3&Y߷_f&~d#a sD{-#jfʅu ~tRB> endobj 232 0 obj <>stream HVyxTW7KJҐμd3oH’ LmXMAKߐBvlV7*TEZKUMmS,. t* T RxO؅xȤJ2h 9ɅS vD5"P!Q1ԂGщS)?4ϒ+A˜:LF# `>#lېzDh%-vZB+h!h9Et.3{#tدx;էܾR_W}}Z&#Wf3x1j8b+8mn =9nڝ:vQl.eμٯWO^0?\ v~C  UiC1/>u~fEjS+ʴ mVM U[׮Ժ\$֮[ݣ+;)3,ʘGsi&Wb+`4+s׈w!f᳴I9V՝5^|c̕WmYc"|QЁEV }v2k/vTg{sg8B:wxǘ7AzQ5^wex&qx |&nA"'1tBg0 |\/ːF +p+MŷJClq~ҍ` ~x -wWDG:r>o> g>9T_qbgbv(,,U[ңVyUHkʲ!+K"HBpB̌MVt!YnV%bkr+futiiDR2,Kfb5yxT͙p4iXnwr{UDxLwe>5܂}g9zjJ8x=.`33 YXV+BfqYf6,[,S Y8V`]FK@LY ;| xV~U$H43UY5F1z0U; W.z_}Fj!|0v7[ZW#bn=I kMAJsfW;Y Q;#Gf]>i`%xt0P_K*!XGܬRb A@߁+F8[< ] >BoMj:daU%'9t?/mJykޏvnDO+qGFA`wҚR p%@hV&P~B"f 9Pp ~@Qn<9qtyCGh3`m"G&Ed,!q XFW /D~!Z~!z_N;W u"^5 m@$|C;G~݀H݀H.0 4  nՋc5ԭT= ߷e4;)nnP/K"#cPO%ӻfmvs&۸%} vxHKD5tޛ(|L<O$4 |V;O'wnvdsRbT m?ރx%zEleD u~$  wJs^Way\KKB}'dO nL\QOcg,P{s9i>^pK |3*X |3)Ll0IXoyP r B=r9i֫ڂ^1jdhys4Ɇ??ῢt+菮_ޢdvׯcWoKԎ6l3/Z}Ԃ^fzW b 2O5kLdb[ԢZԨG {֌膳Y=G"$Qn`D"TZ'R="se*⼉S,Dz"~EEUO k%W Z\A*LT 'su+7YUiSDais>3ҫ=6,F&Z}SGry>A]w;?[>'I+AEDM eclC5>j3nh#\X eFCW[-f?rC?W}lS?g;_|'$&؀IHH! $$ѮUkiE@&ƠЩEBcQ+u&mڊVmi߽1 [[~9wy{y5ť}YKN>>Ɩ,.*t^WZ:s;Nku%uU@=^-#gUZ+sl\@tEݖW`-~jB@=PT?nEYeuSw࿵{pUV;gؚ2'61_<Ҿ "A_TŜ%ʄNfĽ)˰W:yei&ȡ6c/*n1[vEe&HhvVѕȥWN B NZ3' rIDbVtѵ4A{5gRb)J!yR0xvQ5*h:Ahk`("aPEs|0 L/o/)qj"nkI1-S=][;Ou'cRߢ5VA<: ikK//޲.s1kDp0Rs7 jb@K}.:[]^vxocmFt Z՛^4˫卫]u 3=@] `ϜufgW.kuSl{-5='T׷tmMݷoeӌlj=0n>6BwiF 4W`k*^TÀ_xʚC9jێ)(`M1455tLrW\ 8=܅HWzbtX]Yi(1_ZHd3Ui h/E`ޏ܇-T0P^LM<@ Q5* r6QPsPh)p|*cs":ϕ={t/߆3wdq]{f3b6}"8ϣ 6Ad!}pf!2T 2/BwT Ex㼫oa|78Gf @To?NQ ]{o3먍2;‚ (cʊX{HT p?X˱eߋ;pF.Z ckkɫ<91 -a"^~ki1{*}~:[5]z?F]R!jIzȥTA<' *>8-BɗZxXBed z3A7HWѤi49tG}Nқga!ОyC}LMv|p*&?} {bD_A/$s@er.!겉4LMůc.3*fyi!kemB>F벉ֳ4;2,]v6>vvdž'Ó# gy݇'G 5;>P푮F'㻆 qnN ^j04NFN$ZJ+ ucd|> k4A:DG0/1@V.CP}PXh/wڐː&i2MfpF6M N@2!( Y d' *} W"OʦQĐ gH(~zdp"(b##c_Ɲ  ؝601hX[998 l]6I60i7($'3FƎ S\6x8Iҡ#9$$rr0h`ߺw#f6 endstream endobj 10 0 obj <> endobj 8 0 obj <>stream HWn|i:y>" XA;3="6;y3҂>_m~p7?o>g׽Lƹfo-4EOx;Q*j5=֧yy :КhۍnWy ד)b~ 8V20ƀmli^Pc XigS;j5[Њę9E?q,Մ4֩H×qn8=+ 3  rS.Lc3SrЙCus 7\MW"*A7Kvۜ$aq9d] `@ )&3g9CvASp3L5Iݕ ~,ś\hc;sg_A3yfd;%NBq!?VE_qDB^dDRqk|\>HS LGVV@?ɥw4+)ZQrQ'~94ޏ>MdzmBb+^^w?g&w3>l~-YIG|UE"AR 4Q@HCǤe@NVܼD':9Rɪ /'/~!&+ArK$@dyW)ts#UtfV',Tˇjѽ ZEr2,^gn'K3wN.XƕzaADDTzi EfEoؕϖGW]ق5 >Ap w*[ YFwף|R uMARTWBLl.R_Y|im2WCWMh6ǏD EuGz(dBY&!O-xZ`-l#] +kW!gkK@EzXnoP_eq#G=Ke7 `k8Y%1Ҍ,Ecu9_UUu79]yZ2}ÿh[օ "qjKDZӏ^+kZw[|%g^x3e۪kXeL0i"Z& 2WOQwʎz%^P'80:YhSSޢk"|`yVON;UJrڐV2)z_z}<=תXa#` Bě߾nD*]43Ok;"gKLKS!r>8]zZsȯ½NI%R׶ֹԟwڒUu,l^*I;>Ml:z;D%B_ 5UŦizd%N`G;= ulcEQ/S'RAj SYr"(BNng䩔Ew>5J} :+Hs EH*`snЉ,ѠaHml{LإQ34Ss%iiL%z9QTW՚zo':NJDZwGT}o҇BpuՍ @kk @(xZ)BEuKkaVF٩Wڪ_-᫞-"vf`Nnʏ֥3L0 gs"d|kj5ѴހmgXMtq>z݈8s%"grFʂjT+nv$ '\%'G;$VE[MbwĘGI^椚9Og,vh[iN $5 ?2$ O+^AEAWi<93Kp(W,3%ݴt=S!US/ 2G$M1A<_5T( !d] p"hyӿBD6M&3o_ъ 7mG#'Ɂ*h 6 ,3y)iTy}LF-'$W'W8Gp0Ftg\B_2@ꦘyPk ]- *7ip[P~]7W*NًdVbp|:jRXC袃)$V=TU]~jJK@Ag4T|Zp ETG ($dx1, $L5Z]~Nɩ#LK РR?#ĿMRqp5RFgUBϓQ; ,eeK>ݨ> o3e#p엜 nF\FOSk ^[aHzЈp~pi;]^jXr*oL|!g`Z$o9)9OUx TxK" ŧfz3\Ȭ YqcfB8a6R xzIYHC ԌX "3%mKu &:I$6Y?w@S H;$pee7ew wW.p iizd%VsY1iH)c8&D LyT֫ i$uųI}ŌL&oYBdZ/ͯtȩkWKM bY<Zx9Kk蔝i/hGN41/V0.8P^!0/ӲVٟYځ{˲/-Fi+9 i,G࿒>Nr!FC_i-] VV_YJV xDX3l1s|y}{MkYa%>^ QHzظޖXWj0%Tz?хB7,Z셰+#flf8ݪ 0\#`w !-V3vvҒݡI(fZ3{Du4g>a#6CS$!J1"y05{q=)ǐp+n+ Q| ~hp,bWֹy唷"PVxzkwޣ)[B{}.4^yjۀtcJ 7"JēsAekN IEAÄ{:,a[ ұ;4c(K!8V#8z''7<>Z|qS(j _yՒv"hݱJI:9qehSޝ\U yejP?4kDS8N> endobj 17 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs 193.926 -2.683 -197.256 785.455 re f endstream endobj 18 0 obj <>/XObject<>>>/Subtype/Form>>stream q 193.926 2.683 -193.002 780.09 re W n q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS0 gs 0 TL/Fm0 Do Q q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS1 gs 0 TL/Fm1 Do Q Q endstream endobj 19 0 obj <>stream Adobed              KR     !"1AQa#2q$3BR br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzq!1A"Qa2qB#R $Cr 3STb%&'()*456789:DEFGHIJUVWXYZcdefghijstuvwxyz?hBF!hBF!hB\TugOtf,z&x:+,d(Y$v; $65+{]Rb@s'\Oq'i:Eޥql k@\Č =O%}m_X[+#$CʊdZCqqI[u`>ѽeH 9Zpqf *S9ÏQHY+뛖Zq^[*bTF/'@dVP|k{_quyI@>/[v|p'u^˾=fZZ=,q p$P~]uՅ i%ڲYQ pC6sΧ} 7#H);ʧ&2юL3Xxe~TZnx^q`O= <'m}u+0ϛ/RNOSp^_fdj\'~UkʨTzbd>|2A:-^X[DgkO#SPq6 vGg?ޒƋԷ{v+וlZ}%&mN#y:aYAK\ysyJZZji kHh4bD y/!yޗ%lGZij,)fbI$$֔\m}gLmug@#cJ]౵UUrvAI0:!/W q#s^%CX3O*o lϨښejJSf-D\S#3CK6HVhP U'k Us\D`Nz$sC <5I" I|>K$9.OR% nCVoI;2 ooQSs[֘!HYխS,}AaQ3\G [#['b>u@XiGqGp沍;޵:^dz {23qqJ[fa88f3 ]HRĹ.WxW̜hImM@=,UUc蕊X/1sv+[GwfmFreb ??ܦN$ A_ 0CĐ Fch#3׳ZIǀIUVNɱ6 l#>A< .7H=|DG)k={`:KHt(S%xg_<PORZ9K0SKV}Ix:^9 !2ClC:̈2X4#fu@hSi`8|V l A5:w;n `wTPM|BO 6d)/KnH ?VZ3,9q䯍*OapLPqʗ`,G/!\`9|'V~ L;ؕ945 AC{knV&Wç" ?_hzA{bI">Gr[bNI+>ViW.fwkI}A,GO5HS?|,#b4m 9hQn5ᔕSO+L Zqo]vJY)_NRWI$>a6#fvcُ_6Fk0StVY=u^N9"?wjMՌad[ #e>~Կ,3("2rYsD&lG>8/zis{:8&4ɔrsѶx_;9YV1O~>a=i!%͒]bRNFO_MS7Eۛ0d;9q<vU>&,i LUi7n rsbiP\Te]*9s=>>oXZWr9W]aFf]ilF!lrJ\R,$Lp4\"1$QЌd׋ֻŶo;4 튭kǑd6Zܖے7C<5iHaENhSsۊ$%dRҩBPIwK@ 9OɎ“~Z/ٚ-y9$d&W?$yz!$+R8"-kىq7ء=_(R&,ã \yL(/+*N"u z7)1~)=+s0ѣQw91ΥL~CyX:@7g!-ҟt+7PG G^5(V#bT;|r>gVvaj8S[euwOX'q?]y=Ej˔yk.J7*Zf YX@ěH\F2湧}ON||7eU4ԭN̓1ϳ~+O\Uk*9? 0<%ƏKhw4r&cdNO @OS1.U~44 X  \8IJ]݇- `F qmZҥ~оײ%kzxȘhaZ1C;Ɗqy,6׳`8p1 /3HE:l#|~y#麗ƌG"Dc]ꙫW%Zܳ$$yrOYQns$$cr^4B̐h8 񓧫cdZ֎5kJ*ӁkA%࣮niuJ0b:{Gyؑy*vdB,5]U2u!r,=J6m<KRv}F182^>/IaI`yb4.[ ~<[nk';UqMTA1s @^aL-HZ  ʐP o5ħ9PxT݁9#e)4zb #M2pѶͅd˝/l>~_+/[OBhi";Iم߆aan 뮟6-7~n0uN]S2{>鯛 p¾ JH]aԘxR_cљ H'vl~mf @{HK {/mx<#~!X]ijYJF Gt[Κle@䆞9 !8>'g's)Tq`g!=~q7݅隆 kA9/jݸk՜&e]YOlYc)zGUKj S!_vJ(C'@D)Z:MjK|>}W#vbQh7E0 B=^}|4VMΥ&2v?yՂjb/{xndܩk} /JcB\AUPY;`KʠZ^H=7Q 5Q]?|(ه}oN2ӛk*it$-p̋ Tw'J#W8{rv^[};bxe+ aPx~.c. Zimc&^@]MJPS&@pu8)4Lޫ :YxlKbI3ۜ!sIɷ;'OF'`h9zTzUAY p1O(YUqv "b`Ѳ֙ LUO̍967 uJƵ0|#Nlt[<4 .LIEՙ)Y7PIXRF7kА5OTCK) r>wizA 8!,JvAT0{>HqH/0vGQ& W:[exn:zK,x-.yyʐkhS k_;qpZ]\F6W=.VM%(3C+"wQҦmtkl Jj CO\tx-ʶ-"G 9Dդe}BwPnWLV6ao#|rLaGJ5|1;&7eO:+r{1+:#tnxKAq |F KPvwd6(bY kⷛ`}PT-I-xp2pDi߳ىYRPvC$obl^\Qmz- m-˝Q#^9ut\ߎ4$PC}%Jݶx w=,Ǐ}J5,OQ7L,1Խ?f ~3+z S-^Q[\yV¶[I l,}i7dGٖO煈cCsVzXyKm*4[ Z;vC 2 y8c؊9>#EQviJ`|8jn]Yݻca-s a.$"x%{Z8,VU^o]dc!g9 SSP`l,{Z 9*6ѦZId/цoX,78"wOyoU;zCu_:V$։hz<$va5ElA;%0&W,A \jx|k75 $J8!T}оBEG1XI>߶/ '/N}8Bozr m_  2l! T@c_73۱م'vоP߂ENÓ6n}Ђ#Ag6cbNJI X$:Й=F$s _: V*80-Nyۃ_A!|-c)J/q| ]5j)cFWc?.v5V,BJ?',s*v <_|$HY\-TSdp-$ -8HzRճXOl$7mݍ^PnY|Vm9Y20?쾡FzͫBnu{wcsN 7ZU;ݶUЩ(Qo 5!|+_V{U8A 0dr:2zdj'87DyRpYT?a7!wO_ awឞ Q֧=lRKHVxMțE,%$byMϧ)V+ZY A8?Jrٞ1Zx]Aߖ7 d`R:Nvf$xN't|5,V-QՎU#>۸bIbMՉ[½[Ӧ;ʃlN `8r}afzhIY%৶aa9n}/gMFQZ'.k%֝B'ֳKfjI\Nb*G"ৎĭAcѡڼ1k79F'q1+\͔w~rGV4"b M>@ ᒶ}W(Qh-c_]U!a9kQŒ7HC80' {+:;)w;AeBp*oWᏪ,6Fh)|9e24iEG>Teo{ۅ9;`mۥ\W_eV G'tAZ.'?Z䄙,э !>*`=ga/b[ 6~\Z7ox6I ''ጯ[3lXIWb>1(Ѻ8Hob΍@Qv8Ll ,;nZI LYda-e2c-~Ye6>XUɥem4Ak@ nqoԺKұ$N=Yc;m(7"l=?X:*nҸD@2D+O1R^y({K1j@dXKf]x O;KS4 (&GX㯒tbGG5Wy 3; L%%pT%U܆VNN]өiލI'8NN3֨˗@ U# k1 Tkt`ǽ>y9V[L*fhU+bzhd#RzQrJ-VVm6iH-x f  H#ciO{ ps -!10|#hnaH]N&+hBF!hBF!ҿhBF!3E|ses>N"ciIʱ I#rBAcFk2ORI>OI8-kiVYI~\re7B1%y#;1T$*I?gsΰӲ(u/otXI8]wXb }}1btp6]}h ǟԄm.W34I^e Z ,Jʜ@X>JmHRku tZIy B]n8n r~VGfH^(:1ۑ6 .x;ꑲc <.;[\yRx-GeK?eivA~dݫ1WIԚn0 v2_45cYRM檎[mS3fAp=)Fy.;d`}}gr]~)&ƏLzj܊I!=;ܢgP(_Bۤk:eէyN{{I% q$9Ϫm ȫb {GbQ>ߣ_vZ}5*J =3n9I^[ֶ+$K *bR܁vuҕ@h k69ͤ\&EG-1-'VV%%[}j.V6+Ȼ ;`Lm5 Na :Ժ[ǕXȑ 6N`-6T-t=?g}}*{K qi  =r5vSzHuX7`6oHn/k+049͟=cC3P%nH폅];RƭV2 x%䩱5P~We*ikHj5~G!l\Q$Qqeva7tGǔΕk\=TKKa 78T&U\"U*]8(Weݙ}}em:o5;Ax%h]$kY.sWi-/wd8kת[eJHܨPmݜ)cu65j:)ҤI 9/p{c+\bV|!G^Ѭ,[RިktJo8kr$_a}~[3_$eWX+nIGPeӍSLc*:Ph`. ϙGl} 'esXmC{l]ҭJ^k`9p8rs`IҸS{3C"~Xa}D6#'v[{sRq\ y$8G1: ϗt3X#BB4!Є#BBӿhBF!g_F`F,Pe5L`&Kv@es#n\|dMӟ5c\kYn`|ID}U{sP2r< n==0b (2goSc Fdڻ7S6O-+YɣJG^*DnIb93KE9%EkMBh&OS'$ $J Tiu8{I8ZzLՠ~2J#!D^cNp7lxA:J9#}c#ϮW*X;G$̰Xc=ؔLS'Vm}_"9N)=%FIcDr晫EWhRxbPoٷ:_\@IXS}pCz3sL,eABX3|rSr>5vReS45Dc hf=0"p|*rtÏŻV6O&pnO/XL)k'WYdCx0ltO$$mOsؒQJ}G_dh=յ v iL9>'8fNei͖+ʍx$w I [ɷk0aaoݘը5Vs]ڐCs& e)I+共19H=|*+zCkmjVϻCa6|\D6:B')dvHI;>JɥPgtǴ{$K cSNӰ.õ320x74'RMCkZ֝y M$ m$SnRepGRFwk$nA K$fY"hlxɿ?qBu فNj1mu@q?nȐ2݉Wpܣvb:K@0*lA"v!xg֍yHR6oum4{@lڍo[0 п;֖*"T3 H^H>__dJ}bWwr@]eZvG"\W_\0KO2~`*~ܠ=!rheގڂKv6NI%' d2W[J2!i8l{H=4@彺썾-v uVRj{G5c,5kTAqrȃ}[ Pi6%#IIOʳmM-w=s`CZU-FvaY$nY:2V"_%8XKwm vN"C)[_j{نBjlvE@\i1iq*Ψ)_ҝȿt2_Dxۨgp{{nw+ʽ_U;fE6q O=J.ٲ˻s]d+.;q /c %8oZܰ~+*w8qN@wr%~ɠUixT D7>|z+bVk759~ do*eFEE.F4"3<yeb>wвbdd|ׅaR4qY`q6b vb5 vDq&>DmWĕrL#~ X]$BBl[i/'*'YT1hkPLu$\_XK]+fIe^Jme[;4[ }66P\N auQ+m%Y7 OYJ;15:^*$23N0MCωĖ[6DGXnKFrP/ezk)SYy Mrٹ\b஌P F0"/f$iii棥 8500-IbAʳBN/ިKҕ;iWp-2/ $U1UVy>n"^1O Z&p{Sa۵THI& rvev)dfb$Hlۏ'qb.UGRiC`R͡s\xGx'|ZEQ1rO=)a} j]Z1ENv lxߔI^m:;%/NMjņj$$ <oohT Oj)SE66*Sn7s@$+W;c$*;]Nߓyy'7>o}Vܹ߇Qb}0ޛ9%x:_7Gj5Hַ{"%7[J̸zG.6wVj0y*DhM‡# Ӑ$ d4 dlqbc R̭+nګj5`H*Av#O湠 /c!|sKL|_F!hBԿhB\Zn?~nIgYKםXV.ܜg# u߽h hs4@'`YV ؆r$& kKGU ozԓU'! + qZ0nBȽիZ-%BnYvbY{[[5MR\>I,{I2mlPknAq"$-^KAka<М2-XӋ"kQ؇6}JmKveG~uAT$YRnƲF-$ܨVI;e!FevۋMԪioRYWRteLeU"0B983+#m|KH]gh4By%}1۶`\IuY^:I ڈH{qyC~~s.\4cYM树gk-8 YrO%P4N||Kβ-GMۨզц<48_JwyTmF@vSryل'Vt(ֈ.m@8':t]Nd&y"gaj9QۂAXc0LL &se;$H nr^O[Bqp]ݣl0z3Ss3ڻjoŵp"T+Q.Iϔ'ϤSNL%hڵ8q/y jloALF;?*o=yh-cZ;q< `OhY{{h a#бrwN1%L ߐx8Ho֗"_ - &TV=$A#XT`JЪAZm-JޥG۸9 "CA#=~4G)#Up˹bo'Zm' +ETĞnEe-+5]&<ٿ,p 8ƾŏ rRs}שithI*6d$r;\#tJC\̾#+P9$l͔B'7@}k,NSY1WWچ <ݮ],: b8A:BQ"Z_\bK% lt/@;^++8]DI|q^X#m^1̦Y+*P`367'G @p}3OӓĉzVh*b{.Y8@d0X5R; _"F]eQTx@|WݦAǪE &4y` $) 䃷*|хb$XZ9l %b_u³a }gwj^$A# ixVvL$7_^I^J,!1ƱŚTxH}NbWSѻ?kh8=dŒ[?b4XL)Ff UyPjZNkRk.00d@#)bQX26Cؕ|k A' Yf~+5 v#lyF_ʑ1;m\ԣ*2u& /37 6d-e-XzgQ`\z/2uF薇s*w8XkzW"I:(#*l=^=NZ;ג+Z;^o$oJbl;5guJGTf2֘ q>e1Nq!GCQhay(hd/I+c5nڔuXtd{$mIN ;C^I>)$ƑL~V0Y,{SXo}bJ4/hV{SCSvvhw~+ю A]q,y̮F;~dfOI-S_.{ѐZ~r1 Qt\F6|we "Ic7n|{+j.m+5M9M1-80:wcP E3юt*$'I ؏qHq.}yb˪;w{ ln<M.5<݆wcvi<ǸFx'}|FNugly 8 ;\џ,/Phm3SG%pĐW@ѷ})5 P:"V>jXJO$nﯢWHX`.Fv]vG+coXd`qہY{U|~tB wj:XT4׃.2ݻ3]FjsaKĊ I $qBTMΰ.Jyf^ sML@$w.UooЀ6> 9n;#~( AR*T#LaB݉%': K{Q|>q>^6S5bڵ0╣JQ<;+$em_ tv:Ʃk >gq~鎪,0:C$>osBݼ6{ׂDYFϙ$|#mB5uJ*qNG}}m@j֚-ê%DAq6+:PC$K"jyp'}vvmIH]߷*f4VsC s(6v0Il{ 9^Ť8GI ͳG;"CiFľ.Vc)x}Q- sDÌ*rexkЭng <uLa}[Gf8Y O 6I8_ޚ v?OHж+j0:kq=J:lŜoޱ׉O|{Smn2N ;$S=pg̘䭼J8 Y 7")Y5x^5ݡV)P vRM}@#_\PjS׶ /owju$y{bI%_VY3$(㷶XåMh&ғlkKr]..SИk,{w"V1Fvs}e>\PʕN19] eu_֪@w |mBUP{r{ %n+FF\Yʮ8#묂EǩKkK;fF#q F7ŘSWm I~2A3bDSg!;CTm p@rl(YLEÏeF@2@_ YSicF5'.Z,,L\Lbg/jYfcFpyp9>sz1;V43J/.FFH_(SaHo{U4L)c.+_kN>B[YAr;Hy1_i2˚}؂ XYPXG2$uXPTCNWڀ,-jwuC c -q~W$Fe=E$rؖpShk6j;1s I%sNF::7R[KЉRgFU%.XPW}X%r]%v-Hq'Uk=f88Nܘ3 #$v%0Pյ1H7=|,t~NՋJu31KP*SJaȐ ;uI_/us{vQ7هAw e뭘<' f+KC"r/kaP6v4yً²ԚI'&Y}E"lF][4Ӫ03#/o#W2A@#+ 6RnfFrXGU[}!{J{j-pRm2+@C<+Rgx鞉w9\KJVZ8-ҕYoQ` k#gGۏ*4nuiGC$ `N_}ʖ͒GCQ"GX 䵯Oc.NT4!Є#BֿhBK!nbT\pݥD`c @2o6jꓵ6<~c6e@- \P{1yrjXބfܙ_Θ>| Μny>k[޿o)Ks52Gmbyq.q$* ]ݬF!PUsj'ҹ,݈偒 '&Ģ,8w;a,Tn `n N=/ZXP:jY&툤ѫp=n5XU7^ڡ"lhfK`HeN{$ByP됤 ̋vndq/ niN3J|-l&P<(b#2<_6uYw;wM.4iÌ3uK,rv? ZVH85hN#ۀۑi@xY3 _Rhi͟c8/^Ì"jR>;MzEٕzϖe4A_769N[j i m0pDN|}{pڕQޘh5E͕Txb_)8H;Q{Q}cC ^j:@lddžs2|FDW>Vݩg6+~QG-Ԅ^ ݬ{R,^a m̰`]+7r|iƬSrЀypH(Mξq*Z-Tx@%ƙ&f2G~_)4ګXHTr,YHRd%_6-+gmAjW9$9+tQ fZK<R*'w6>dn7؝Y2{N6[%]NށcZ/^.ftwY%yM#sŭ\\9ќ|?*?ג.pb*̠ef'mc)݈M+ѹ`VFojPHwѼ/üҭ``1+:JF[{$;2PA>YGN$d'6:՛QcUu9|ſK$2ՂT,fA+$$/ f`F# y﷾wnѹĊ#`x!1 ]{1 yUVuVFBxT&ai?mki]M5BI  =LWa$ǹhȃrv] ;kZu*w,R)ѵqAOI.e̤8yhZ,H;o7W)VѫfAVcv`@"H_=6$b UԤѤśjB}՚@hN\bGG\9ƫ[/$uFf>R0{SzGlT{Ycs=7<Ц E8O.v,VQry '$y0Đ<ۨ_`Ϫ֑4p`r=WcqXc5l=cgB6NP怗c&c=b!M~Q^+\u~8z&?Jc9e+0x}GmE])N7m@fwI}2MBPMm .x/+?Qй+jر2@E:?0R_鯩A?碹]d3Hζ; WuiL@8yX,tz~x^!:T6%nPB9HW,5Jmży *l uO%ZUœBG(dN$@фI:'&$>fߦHLQjHWsD VtCO["W֌bK129H "Q@-4";o ɞL7VnJf < 鎼r]o X#H|s{EvX/|0G=m_1}Ӆm,+]SJ| {2J+7вIm 2=wv&R`'pyr3e|:cgHeo}4]bpn|G`EEK.U\)DȰK9yx3>6=v^]vmjP>3LOÖG114{>FH wN/}$yo%fƅk껾28?GD+6 ʔm鐯b'pHv"P *_zCO#_{BxZ ·t$ow8:d!1p}7mZ1ŔfgUhh'}G:ZJ|Z@9ǚ3C^W.=rVyhu1bBk_ :X\@p:yO OׯW 5 I_ Q$,Gw-9{ㄭ7΂K Z1LrΣbf7ʖ[ʠ؟PMjRNi mZOψ\;ڽHxIk=+D@Y7Fd}%bmYm~VOtQĈ p_gh 3Wso:[󽂵c6D2ҳJF6E2$ef+=Hk{9= A!v vE!=EIqwY7r1 9Aޭ'2 ym^ݔ"Vey~o<zI!?qsLu WoM%iJ JUcZR$.x8VQTjwSFa$A#p kr{2 wGy0pJ\쁇c-уϢ|0bbY"6VV;4"B ] F!׿HFb ~5i@lY񍂝d oZK{p `V6tqY oG'ԶdTIV=@VY@[[$$[L<8{Uq}GK\}O?ZRb@KgA ӨYB# ;x@IԁjRI&\Nl,@8RB[T%nu)7JqOS@zO%' Ctd %d/6mJׂx( GǗӓϟ}ҝ S-,-َ֦Z!6چ+8]Ѻ=wh\SmQ]a F }1na=Ձ& ;v~1L }N!)>vޭsAOiQetLc-6wc%9AZOj, nMw˽O$Nz.Ĉ"+`i,NT0lw"W>)֏e-JtبIfsGRIhsc\D͗pR;.Xɢ =֯5/.p-]UұHJˇA M~N#U~kf$bag5 1$zGyZwN!YƾB˴Id0DJ;l6tZ>0F1Ԝ眭Ӷ.$v%y@ 6#.K2>j.i=qqGҴz8h" pU?UGqIK5y&EĮ ̍+̌ A*=N,a1Ei`]'a (_1Վz` up܍BBH_%$Ef9f$!rRmV 1 ,^ncdUY)\VezvEXAd{Gt*JJ-n_;c}9hL)>yiT^"QVJ+ڮ|` y{>O6[^Ѩ_Q\)Ϧ) e@@ -ebyO#P./q:̔-V}06hsj\aůr3-7rcdr2cN lHN-B>A5M66ըw£AH"LHJ={&S,U=]n /_JR*S.1ݍԥw0^IwNaV>%včq;{i'M+^܋zRoc&VV!P$JpٯٓxCoJ72ܥeXwG ρ}|%ybw1$2o1θA=;o<{)9%OXeZa"3ЍM Y<^`)Q}hYg~٤V!sY#=,}"A_M2ʆФvxGRb#+m E9$a]Eͷ=*\~}} kKH~咽jkٴ.06 ݆WB $+!jLnGe4kO#_Y1 팂pY*Xƥ%LCY:n6FNij-S݅ew-"F2'#<T|6[&S[bwGN#qfƻƕ>PM{Xmk>Toq;L4y]jk7q/;aQ)̰ZHgfƱICm&]4##"b~+}WߍHexdic30-K5`I2ݝ%!a*$s jQY x=~*O+ZΪWĂ kC\Ɯˡ,09HYa~{t"ZT߀Nᢣۘ׶'4wIKar{&D89YXE~Rҙ3G>|>萲Էk=&3Xf84k#݂ؕQH{ yݾ /-%ϔ~C^"ڧD9i%u|o_–na3酟ec$a%E+)"iC3'鬃ܒu6tS=Xͤ"v9ar$[K4R^J!n\W՝7mǻ;k.V9 Y Ɍ6;c+2xbhWVjУ<7񯥀@z5W.i/ıt2Jhice^8b?CR=}_;Q=S}F#cķIt,dֳbd-cʒUV:̬{Kw/Kd m@%٦ d 3^'gjg%: yaX# )`XՔe?B=-݅|BHh.ըZ@a-Nk$ago՝KanI Y".+1RH%${ﶳ<;޿}ٻsAȌoyBQ^r+4cU?QA#o ܍@JmsLwcP ,"wfwA_k_62 W(['!1K*exʗP\U[NA(N 泾kw.펐 2c]y uTq]+UoQM̧=ݬae0;2gde||mxCs۱t|llĥ)Ln eBYYJ}vI')v[!h}h%^EAHH7Lu&sd׭ap"P*'Ui9pO}kWP%GEA3Sq~JXYM4VXA0A-U,_6dttۚ%֕!#ͥޫd Y)klĬȲb8EL\{A @]ӫ74i ]$B>ک"&L䇱E?۹AlƝZhI2 q?ϒu,"4!Є/п~K(]Og+9XRP3~XVTq$)BUk JE>$|Cꫤtw*X*nO,PYkAΥ5 @띱o]RFI%/ 6ꋴiWEHQ:s"+/cx!㑖n%Il~k  Ưyhţ{,9$4e%w5َ(<_vXM`D>sX:x\ӷ4 mxi;4{閻s\N#=S;Rlr "K  AՉ8Y`rۏwZ Ld78$јqE4qTqq㪀欺ϑe|0KPo^JΚ }O#ݏE)4oZKe2Lj{QX죊uIa)b\$rdh .)bY.hG;R)PAՀ@ݛIYYKxn !o}#]]"1Șr=gs٣/6E#]$:-oQWIYz4zfOŲ6e3o`uzUTM֦Gï1indzD$$6YBbr`0{˹]UY!n0#FQe_%?V)F *ZVy%AB|J Cl̴d OHвڅpg7*`UM/_ZcW%E2<||3~m o?-k_1h2Hؖ.F]@}}IH/3/zuuE{6ɤ+<+#'`e}꾟qV 3z_6KH*X\U6:cTkdӴwD[5 mYGK.i0^]5ϴotN;I%i= BC.Lvd f }S~}jMB˓E݆K*;6C+&Iq }Ri;ﯛQջqFi p_pc;%l"q谿5ʜjL9Xc+q YTpx!j6ZƊ/0`FK\Ii0 ܩN)#UZhF@mא|'4 Zh›pT.2^f~ & t>>:iMc9敇ݜJ~mut@:NKW{&8]U$ܪfC@}?Z (v:$AOfnlIܻx_Rd YLH>R*k-pUyoߣD#r^FZXYlIMX;o@YoY~V3rAUԬ2n?l\o</-a>\@}mOwœ/!kW}ʊeN]څҫjIZR'h̼<}(sA9@$/ʸzta i#$}l$<6%+%~@L& yб W=UY^)< mב<6?鯠LO 6x&>+IEYhB^UY!|H"'`rW#% DI2$~vpSv#_}|pYSyXVf#XQB"TReGcXi$ n7)=IF?iq4lJs#mdʅ:1;'ښ5.*Rx-MD-p0}-{1L$tD]R1%LwҰ>dہ3+3Ls[z6ݯvKdp"c.-ު5BfBA};6t›v}N59#ü1 :2\kTzNoצ n6S4'%7jѶ~*UssTxq9+k+ҍLekIjǗP{_)T,L{N~ܶV-9"Z5(|u9~|,x_&)׵Э1BY1rnIb|4T/Jrk~.Yխnj90 8Dcr8%ZQQ$!Im7 uISYSt;eU”UJ(]I {nuVaIϒWlx &W9k5IF3K4JıdڄpW)IcO0A%xFﶾĵeޞ'W3~Q#%XV2$,mаpKxr9D^9/)a@+ wbvY0@6C'g0]GYܜä#ri#Dd:N7ֽv.񍶳mV9ck\ww_$ń|ܼZ>l7+*#f#hB{yqiN4- or~`:AWҽxZzݤP Bv u_B+KaKHI_Q$4yWh DJe6DZ/ݺ*=5i4qLIc2լkt@sRPn|4}Zi=V׮*]۝ۀ4Xwd  m{ײJotf@Y+7&)m2Ft9\O/^25$mF'6bVdqӵ^'[RIA9ABxȐ՝Kzj#Stջ?rVZ2Jݷ(*(ImiHN 4-Kh=9_צkk &GI5Za$QII#[.?X pz%,n+[U܇N;QO&2:?}AM=XlNsRxz1]""x{2߼3.D @۝魿syS\ #zU9$NdydtLZbBѿcs NVLOBRR'(UgԲU^"[Ok̵L8o u+?LӝvX30ps&x!)N@/֞yt$"vcj%!An>WcMk|dTFPtql:p;\PuMFxu$y40+X(F4`ȃz+;+2qtyvdY[=RX0:Ľ;W/}Xɬ'v, gASl3m1:u#4vARIu[:L,.uy{alpt-S~^dNiu8qI@ێ}%(=TMZ/2Oq+C&eW1#+0Y [۱d%C^4^nL務,K.Ò;Bɰ?nBy㓀Vvv`m{haX&T7lݡǃ$}Y ׍'F6ljG} &Bt# '&鿇2مUO 1reL75/.DmjRh y]KOh(ԷiKHH%W|'6kڛT^:?u(GێE<1 6϶ $-GHu :†jg .V}Wߟh_~}+ #3qmt>_)qtFTolo^Ӎ&; '-l*Nc/:#%}sw*.9Tm\V5KKgʻ]Q/r\^u`.j!園~DI 5a%6z^%[$>fGN#<;{k)F+WJ+vg⿐Av`uey+Gń2dbwY/>guƈUoʲ|,NBc/}ijc*;lB*T+'շm+]Y#iǷ!/ rXi+ 8x'[v<}@F>.{ B_ܓ vm}r0GCX+2(w;0`辅Wk5Rdb Xo_ٿ}=ǒ2)$-ubY7¾6T/ ~7)q.W ҵSʦV!Ho v.ٗ{͎-IWڂy,sO~_#!yM?ufZ2:Y 16;mϙ`8Ts߼Zo[>R4hpeVy-U:w4Ve#xΓTB#5%bFi7TJS+`#tz8/԰z/ڵ7zqh%vB }a;5Τ1wV՟X ,KHωy}&:dZo(dIB|V><Yf٬[Qq}=4-Y.`&C}X͐d< H7'V?PB1rwF%)HFW>/jm1Eۊ5ـ4 Kh"WuYGTw~ KS𼙬Z G~\$4cqH1#H.*Ab׏~OV:~d:^$(H⬑@#~_%+2. ύXo؝§`6vO%|,I^eC Dan+bv|}\ybTXd #[[|%|}vEJKcXu績Gu!c'0kSA$5֎#Ÿ=]% _pW_BwmVr|LeٸO]hP%RxYʜN\7Kp"=p_4٩W]?0"v.qJxlWd|G+յS0$l;O^fΝ•s4rUVEvP;l}:]ON֒D'q#Ϫσx).Yշ_Zv/ٛebQAVM=kZ\9YI: CZq%~/3B9@\h]P5+'Y?>^G۾@t2O'KZ|>X|o}I ݦHop~U[wcj'kP9ɦV6$OY G+w-HҡǢMv7a/涬 U8Sc9^W!G.-;MNB&z][QZ(^@v3 =~K9:wLW!̮^༫Ƭ#FGX <{}t6sN'_iҵud>tFH5 >.t\_SіJxH/I r5$1ĖPu٘x`tS\/a/HkqVo'gxwU!}funMĎ$ξX86-;`^V(c|ki3#~90*.ͼYjhVC ,2ddz`˜. jg6Ea<{v'0H啋]Á |SsI4! ҽ|X|VO/43YRkC]CM"HR5fPX@4ж}R it `q$+ $ VlߥuD=/xц ƅq5rYy'=6XnkC]'1Ǵw-~`&Is&1<SQg1Gf .%rHNhHǰ~2F67:s=h[-"Ҁ^7dlHBv}>8+ʙZSlƱ4iِFw!6 Z=HW,Gپ z]&c| wlz|%Ly%۪( \n9e9ɮvh2K2ez7qKSwUk]Q9|R^7+KnF~c+݉ZŴJ;zCH,Wvk=챡DlݽȥAk* kie'WZi^ ]?a.UX~FbOi dҝYN_/6UCr(ncSkˢD\,q`s<|E#WĖw3NNӟGP9Vs[2v {m')?_ C)c嬢ڋ ]HH# 7oe]=,Sy?hoKhZ(1Z'? .ޖ“M,GlpU{;k=eNu]mZ掘[?U׻9V,rP,\6v; =w[Ǒ '#}|.)VP 2WSVSaU BID >~|DpLm#_H(_-ܙ0vЃ(_A&Op2x~wc|! h+D`}gOо&ET؛ q_: /jE R'/aKP]8}~ ܅i )(U?f}ԡ~|&C6g!N#!OYcr8s%iSFzO?]:Шۊ`d/J^Ծ"M9іy8|b=ӗRK0tNOqak~1Lv.?@?jIeKU{[OGE¾BGBHߞDF{7_H1i'aZ b~?2z#oVւC~+=\d[8n=HzjאuR}Dzʦ0/=R}KhÊ~|wZ(wSo g9C.G/$W VD#8[i2sȭ|H~Yڔg#xeRs4QEEҍ!,y[G4,["%|Ur["4ǿ(LU٥i0KlS+BBV$R2ʑC˱īPWob}/T/ rU2,BFe_Mn6<}ßM/jHgpC )%OB-oRci񾅋7u`0Y }B IQ$ۃ4B*][MB7Vвka ޞ IɼqbPalcOVNږʭm9Bdb ֎3).k"Foh>0P6RF]џ}\lʆB&.Qi~˱Hd#gNJS94ּ-.͝G~ָt<П5n0ŪP" ]s*6:Ĉ0/d}j+Rmð姃DgSӮz|A@pg'ib >uM0s/S{mij-㯧k 0)nPu h#ܚ lǟq i#e[)5 缶I#823TO:Cn0uHlVaD%fIw¦])f0*n.5bSkqv `51RgLDZhbDTx>|tH\+6#U6>;}7kT,WU:$HȌPxо~6si{E}@M+8BI1l }; N=h\;&U'I>XOk-نF.J:^_  ^{jKZYHՄh }>_ebXL%Y[h#>fW/)f㗌(cTjs>?f pe+cc0FȜs;X^@OI\P=+RFn/I&krͻK*֎ HG Cy 3MW%IHiiU+$ƓZGcӄ`+QՅq䴌O3Bje01[]-Kf!Ge0X7N[gs*g#i'$d]`k*5@=t  (Z3畨iX/ӷ_+ L[k!]($܂Z 8?r 6ضkK\~iU@\rш+sP^QVT-6얭%vByOZѸuH<6]돒PH-Ϫ{J(7s^xϵ.A,iDֈV=wI#4 KS_V1yxJUf*nKcmQJ݆-DzsօƋZEKpXݮyA'X tW2[%[g)qr P]f`$H`v&1+jM3NOw6wHme}m8/=t~붫[,~,|DppŠ2}|w+8{hKeTvR|Cgw[PaCt[ɕbaf`閿 H뼞LI,XQW{KSeivʏ޺ i ![Fj% xq؍dIIVph24;W-c 7va4Uj9G$g:V6A[Ƿi}kC ILA>g1GոTܬK 7U;i &8쯹RZO߽ixi5[e:DY\dXB FʼQq+\%j_ue譳_TzeoS"$<:  xˑkC Ub$ /s!AbI_qSaxQQ'$>0qcIZkJIRx#ƨ8{t&%&{j!o-#TX *Dw%G|3+2I((_a"㾄AB+I'F$RNp^3m _\~>T&2Rx;𱧢NJ`b{ mEH&k+ZY-@!xzX:A &Ts ,/ē{x%EO;/`v|Y2i |J_`Cj;P5x U [pUt jC1#>y\ia/Fy+[7P90;++gs `QW錅8lK7I؍Q ݍm&JZ.ď%=SJj12k QJ[ڋ*QuIlԦwvxH ,;b ]U4bBT2]Ye"-K>w I44QE=0@=W̶`9<Hz U]юM2]cV6oy;xB-sP\uQԩA0Lj'+:m&KTf3C{<._O[%z/5fd2Nyz :B.KY]j'1#{7u5[II"-)\.w1|G: iWԴdk/`Iaڱ3UyG` >DWK,UԧD#DVY~'.16S.nQZGF4nN+h/,;Is$cZU]]h>G$c~μedSdxreT{kZo6޶0W[RmLQLxq%یFfұVyURĪO2[YӢJUۺ׷ϹmG9n=ތUB,e QWEE\CfI)+JqRٗsI~;2d٭ݖ ̝T<RNoK zݒXy 2*ݵN#q}|,}!t0=pI2UƄ?>ߝҲ8X:C_=PM9c]%mB $ !'Ԅ.x7#_`8BEjTRY$2PxЀCJWC*AK =SYB 'cG#$7/".e7rBG_оӭX} {mB-\KoЍ_Y)$F~r4/ ML+W4i?&I.[} a @a<.l~m g2};Xq0q.fx=_C"ki<,^Z>riz6Uh< ê?ԾwcHX2 m2I!x*ƩGVUZ4Ӵ/OΧlۚz=VR<>mǜs0 WĞP'%̲ҩ=BE$.N6&tWh Og;,)Wsj`׹s$|K$lugDdz}aOP3ʻPU, G{*6pe)^Ur̚~T#sKJ\"|x,uI8tU;lUx6UNl BFv}Lz<[% #S$c @Ͻ[u>_Jl߸s7Ů&֧ I׸ $E7o- u5x2$,W/S,l-z] f `;HiZ «ٵy`qFVZrA ݴXռ`m*՜Ap c n>x%i__n>]ܢr夫3q_ P'jtʍ (-Gmlӊ1ݗ̵a >UV#n+A`vmIrwj:MWn{KO :hr2Rv݇b&Ubiq7䠕/K0J6*XG`G8бBJl:~Yahğ$A/,P܍jm! _PO !YQ7jР* UDjԛE dиf\_4W}Ǹk6P~TMoU ZZԩ?MYNkMJaw!#2(jfٶC #뾲ޤ&ᄂ?ζ#n5@g5jR!~5By&6(qfHr?+cf#l7I SFu]AaNq$-:G(ef7h:;9j X6*0x>>iS?Um>]UƥAG +7z\J䫕#svD09E:L/j>Fi״^MPHh8f_&gugHcs9h#1^d3e#k:9^Le^*szuinЯeHUɝ,|eZ ח-ڊmdU`Pa\<k}ӝޡڷWӮ "N fZ<6D-0R&ObOfP1opШˇSsKH Q>Aluz(Jc|*>@; .$|A$7!Q-Ve.3UF#ӬO4t7A#\5/~ft⡏nW۟}d OTgIR6tvxp;>$} Xv? 9e1#ǹG77;L.[֣h ocpOԫ"鬘ъsl_G T5{Xn-a/"Dr\'V[jTs9ideUd2+]5s`ͪ#kąnn)T-k% /7žʤ=Owgk$keJ!q"OGzF 7 إ]@P}V{c2z96E{ 8RdPr*o i %-џuy41gi35x"ᕚ5$FBP>8xEJw.<Ǣޥ 5kwݥKnUZdfEi` #,T|4fIHir1A'^^ ;"&?8H>3?db~z'b?mZ8}#'vr$4ЄT6:7 N3%ڗR~T y$ "3ʵ) &g1z4uˠ.VH!j<ʭX b7y#NK =VohOLs}a6i/̗,@bvqB(y0ԃkh79p߷~/_g%jXs(bJ"3' JT{69I&} Y,~Zauxnm^oL|s6֞Rc+pGNHK)zNkԣkOTTg t#X{ J~,s~azY+P(Rr4v-}q .Np'mSٽhm(\Ԩۀ\k e%F &pR_bӤr/޲"fB9{op Wf5->[S I c-&k]` jvΪP9hpG*bIJtF5q2`@ m@]L`>%|@}E/Y+q5SI'U!6;e'$#O / V'G+{G'gͧs )}CQ[+=տ:뤰)~AadEZXgn2}eoR&?B ݗ OUnhOpsH5.*GcwE펠z7Z-XVfLp$"AuΊCN8y$APHgyb !;W_\8 ~8 CV6'+5)\vXXY$V!y^g|I%*ZX<0q5a˚>#, B*{+nnkוu/oXIu3xXJ<$oYPq0ZN \>us>CZƓ{~eKKG!I+5TTI-:*Yp[ t_m`o$f`&*Ӭ u @<KNocD*#&jw/ fwޣGė4=Idyë3]]z<ZOIg;aCnԩ?R}{Vc*^֭vв|O@@uwY)GJ-܏mDp;V؀2Ro}j}.ډ_oȤ&"3@{]IԹ^{7XxF*5h|ҽ蛾reu?nf][ХCs4RsйgcGX^#oYJ_:tV,I tD){"Qq=Bwk'@g84c]%nۍo1&ުBóE>?~_@hI*NIx.{w j0,b?Sr}cI#;d"i@LRgn>Ǻyl=mqLc-&06 G2dUtWb[ZĴ&yїp{lO@Ҿ/ ]nQsA"Zmg*y/4Z"S5kIZNgL|AV vm}!XQlU.·ot`~iZ~uڅgy߻YzeԚƁL| P&`P[7+*BŞAc_`~da2e^vQEi 8e@ p#JЛۋx338!o5ضQ˪X"HI.ZAY#A?dt5K#`Ⱥ8ʘcwdXnɿ1jH7 ]Awm#i'yy|WcfL.fh֬nl(Вq@X^P%ke{`2O',?4l:gg GUܫ̧aȍkMUsVϧhVr|BbCN6$~3.Fh-x$ͨ{Qֵ>$AK[I=BTխ5Y)lbb)K8<#չ}ek*JLa͎|DGĘ^/3 [#ep1|NDD6c$Ex;_|{:<ñ%Uv |FF3N&@ChmE]VEbnVFR\kij4;;oz@9Dˎk+C x/BX%N '9<_\x%$[nox'_6 -6Fu'cwE|LY1wթ+r ?g2m۸_ۓ,+vrZCDs!Ԧv!8)H-o}|M3:=yA]f;M8#4j'7&3”e$ji p9y0:c@Cɴ!ط57;l=ҕsM/k9e~|wd6}:X•_ȎNMb'w [7d´{=}i=L/ '+n/5.vй |ֹ‹8yBKyȴ^>.~A3TkP{M{}|ժvNvs 4  ":e24vh1+$ ;xP7:uhDp~AuL>y cY.- =mh3=3ҳs8"J+BSvwmK}wYUׁ;zELkKv*E txcN+}3P8  K &bߍnjNYݖ)mͲyi|e/-CSuf< $g4* v@v!U:H_w4qYMGQ|_ aZ;fZ7g!A'ا`)k{N^4]BgҬ,}7  ^M{BEZ! yڲ[=Ǎ?eR)x5?vT)a{cG;~km-N4m]s2vw,&JrK͡tY o~^ͯA[.$p_ Qiu'HT`ߋzRI#*ۄmvk/ͭ4ڜ*x.$}zJaxeA[ta@F~QJo3G3poο8V1Ԭ*} }V6V{ i iyL/jxPu hSZ=g1fQ)F=|keǁ>IޅsZzVl}jy.pƇ;Ÿ@d?k='_ѝ,k%O^0X¾7lʒ̇óoMgvcZΫBc2A1߾svc}7snn]^H;J@ 0%2NzC4[ ߷:ی #ﺕF9\GY r;3xf }=>4_ΝB$/2.dbʪ$#ۅ[,5G`.-#U^ d&HU3koQ_Cks>̲ٜS9v#ݬA" }/E`bB}hom x7~I#+ crY ne4= AG(MO2WcNaXФ,Kfx{nzP)ގ[ 'x= Nہ[Vh}r߹^:b5sp !J2 xUW`Rh;U`G:g}LA)ճā٫4{gӴ7A]Ů_]('k5%1)VQ}>GQLiZܰ [qӵRµFһdnǏ V?'886{4nHwb# iK\I귂| 5⩧nʒ!hs \Jswl;}a&꾥5a6ϊ,KWj?4HUvUR o~_) ragi>@`y1Y.G Oͅ huT5 7tO1&2щ~sݱ=,m}f;ė@.to.^[iq=iId#K|`jR]Qa p4d ;~F^Si tZ޴ΡFC]>c`Wz XVh~K!0y {m)N:i>=rld=߻ʵLx&``鞋 #U[m4ɧjr)y'Nmme1[D>"ܺ0?nEt:'cW?O"pSl]czR)7ƾs5Bsp:ܧ\RfrUEr p+Q#]=!T F d)#CU .;D=8XvLSePPnAXŸ_`$ $K+RǼKZ郹V=] ]co֮R,mӬ>(T6-ȳkTkQnn*i {wUqh:gqV拍Jvw>~]WYd.DX9trEnM˛p}qȃ_ Yԗnq@_Cc\m9;Ր"O$yid=l>ڜt=1& rdckcj0ݯf8^E 9vbA甅ImYDtNٺM>2-=ah2<廒y$e+FL98c鉌.. Tʽ*i 5rg)PXJwD Ljjns@'> :A&5j*gj Eg yX@a:Q' 9#0i2$7ZlP1$V"{n>| |ܳ"7m0:h2~^vjZE0 ~XYw)oɀ\w1C(j\PȭH@e3Fȅ}mPV:NsrF-_"t5i0ď4b͌Kx'm@<.µ)ޟRľڴ }VsR⨩mrOX0ʘ)0τ|%L]kd1$6\s;KomtDe78 ^лGjrZ)4ǚpprдoh'词Ydoj 1uX lJy7*< nI_ѢZ6J_vnkP/c=C,mӇB9i@o^[Ó8:`τƒvM{DVC\^?u*0)Lo'r9q!2ɹ #:G.vTӮ+q5ܐߩg:+ ^Ӵ8>O! ]=`pFXG.1زImi{[$~搹؞Ꝡ7/o{Ikj헽cU$07ƺ*&ZthZ5n;3VoL,U2 [yM]JE,k#}G@ÌǢi'uʈVN8K`n;:OܴΫZ B"&&ZɎ|Э/ *IfhQ‘E/#^gm!%;iHQ%3~Oj3G6n⽈ ?& ۿ<|kw>`,W}J]]VՂ.u})l*&:Rf`]|ҭ\{ I'.= Ee|WRCeX).F׊mDgwvٶ!>ikֳpWk߃뀁P4 7q%l |,\]tv~nJݗ BCEQđHtpP9]3KZ~{=5{U-@Vn$bfaxjwEK2R:jiʧGb FX잫X.]VjOuCsZ0$ew3qT+莢Z,a<I4}+#Md.{c>޺Om..\ʗtYO{UV3i3WZ2':eOcγkא Xt)v3V]4 4 [>0߃Jc:˭r;߬c$vv`IJ࢒T髩6ԼJivM,f7<>j :̣RAsp!7Ucc.ZDhr !rO&nccpǒ\2-2vDkS[[_,:.G:tfn/|<6;J;}+7U{f~ p7w =&*04@Z^>rB۩]Wig68q1\*s&, ұS(h0OҭLGRbc "ꆬB*7$*>&Icr7M>I+L$z+?[\RhIa nQ>>=n!"n G^5X2@O`sxXEv@lY_z"˾WTc$~puVMYuEıNN1"[?_OM2VzA)&XَTR@ZYh{\yy-k7Di/vE/ Zc`0Ld!othtWڎHC/NC5;K>8`tx眃' RbOhjrL7.0E:ce6t̒yvI6*NR9W bUR țX_vVz|x#ȯ@YFY7-k1 CIVY2_D*g!W!Xr $~Tr~_f = r:^]WM0XD@k3lcj&VAv 'V^FC̄:sp2>ſvr6l։01V;Sw~δFRޟHE==q8,\[F Ź Ad ;9weTw><}i- fl+?66Z\ˌ0S렯tMSg2e-hL7ǿnj;Y[iݰm{[]Ry/ ӎD E6t :(eپ`,ZPoy]ư=h/L" &F6cݑpWRqc*kfku'C U-Ǟc(3 -Eۭ\Onӑu]XHSWy@f#q` S`=z,:}6ꕛHQk0Ş>.!q jPzs(!(ٙGFK6nGswBJMskN`& x=0='vn-JVI?ԁy:vg5XOiBnc3h@A%_.͒%6WBFךbU۹8n%Zp-'ވpDbXWv8>J |iv_e6D tIOwO(=qV)yrwn7h&PH_>jխ #cI=|jl6vnW]HWyY[LAP_g(oNs*!f 0w7= kX 2|b8޲OvD/촦Kjz#wV zr1vZ`&46 df6;oދ2\d˚~K.a f2&<&LAQ+1p Wd$N9%=k-а!l5\KA"ZKLp _/5[_+n{ (vraF'ـeAαpYV=*JmD7d$tZG_$q"i ۄNp1>3-NQj AD_ 2Q-%[#$N;^ l~ݵjnd-A.q4.^ \5͒'sU,HuPᝧqu8f31|[Ϫ^ W|0!O/NYf`/ZI4&f:du}=I4v#Q-R&} pzy^k9XoՄJ-fHfx۹QJ#l|&}8 uj"Z-Kc@.h>޽VJp&E4ʲ]TFZeSuO_X h|@G2x.z5փ!#l#$C`1*8ʺɬ):1vn;9<3:CsqBHd~(4EzEi qq cH[Qv GDqɂa4Slc"9,k)p>E.0[Dnw0{5ul|y,9@ۍҍH$Eٟ}E @{hMP)=&{ o20ҽ5TճɳT URRYBOs8B9@޾'~ް5$"uPX$Qx,N~hԬWJ)[4 yXF9w!xj \R:?>Fvh.™yCk5zyǧSġr[34eiXb($.Nہu Vӄc&ݓ+S$̛FĄ7%-$o?_ƾn)F[ٷAQMfEd!+ăxܻlI;mkInWƜ. 8 ݬ#Xш+'ۇmdH2ѷY`?ryߓmđ\^#åX1@U]gy{k {2zNy?<%ko'>&EVkV {<@ܡ@Rv͡J "r።8w<fˆE<[׃GWU(4x'eBuV/il!^ZN ck&< $dNڽNW*$)7v-@,I1鮹Q-v x[a< ≞@vcā}2m45;ć9x]͠ ӕ)q&>Y&D3}ﶱu9Y 3=6k=}kfFL=k9R' *wV?=Gf#nAE' r `OOUO(ZF٥]vhe#%Ѿ-)6U9Ik=-a5c> _i\x-ivw.4Vv'%tZ5|Zܥ&jlܛNԛ(d߾hҵ}&_ Z@d~%sg-JFi%+=c$BL+SFN~O4k:5iN/@Tق[2œhML$D|rܟƋI+}C$9LvҀ]a=ƛR6Vh ߛdg,=[轪Y֔lp$ qڭC*L)VXr,gqX&o4q#cB=o 0P˚N:AZF6 IYVcI8)cWhB7'?9NhWV}^ 7 L%L+^\Zix RkP')6t(vtw nJӭh0Te01ntg ~hgƙLue$V >}JkV/}:ھq~Is<&U9XcV܍3M;+\mvF7vI _Y}TuZd%e;/ !ߖ<$w֤$01z&BCuhGmqCFo!u]GƟ@![}H7Cpgn@ts|l{]'T`iCJa:"y:1lhDo$4(AU!XwX 6^?S6 ^)~;vN]wNʏ;a *||u8VI uWy}6St•ž7zjQNBJ=-VNE,B{V7;`ہ+61~MνS k5 J\IhS#}I>'S}.Ny)~8Ycw VX2L?n>Ѭn[5%<vYcOZi+, f::s3[Vv>P6 lNi0HZ;ex~Ȕk-}u!c>(\wk v2avWcg#ki33}kX}IW&珑゚Ӵe`\,J@Uv~YK{Ffp܎ZFAzW;b+^$JpMW@O9]~]'L[E/ 2`CDIE_s;:)b) BDXoooBZuL#󔠪[+[ֻeUZu贷yelh `}yr'Uz@f -%t6B~=gl ;AIٯu֦whO5J,SC_!/`U׻;ZPJUy7-xuLS40';ؽgWjj cCѓ3>VSO"Z(W{\g&a^4$O}cxTRVvڄL5i&'cU~L%^W2qⲳ'%۔jH?]qJkĚV5Ŵ33< quKKAW6m$n͸|x 52ܝN y+|@P,8!j".<hWp#}vsS34 );[Uǃpwpq[f:3c.AmG,KAQ |vҁmz_btKgUxiakafI"D xCZehK5Т$B|K;__S}gsG|$m$Á-ulfoxVĒ2q^PVnvߖ2^JR߰VSd80J|/'5Qoܕ 2?F70 dնѨT`}?:}+6H|%sybXOAKjZɹ@i 6?=D&W.Sp<WV&FJc:lSҗXJO%gM*\WnLr8_/\Z5_tacih˷ =?`&\Vu6Uib!#%NLyZ[uw2-$r>9n?;ƲctXTg^i_hin} f'KRzZCʉ9zOUɯۡrSq}fBOZTC5i 4_ѓcp N'[ےI#FZcK"OhՑsCF#Gy_>ᥚKu,9kv!_[T* PkםLu\GUtWak/bA+Y_!__T,>&%R+k5(<4e!f&p9C3Qa{XI mÊXYNg56HHw'2XyJmR"Pw:KQn"=OpBFg v@n|ZX+"K=G uD/ѮRuiz+u־m"*B[8,a*$XA]&KtGjDI CԬS3Ng32g] ]52 댏1JFb|S1NFivnew;V]˒jeժ#Z->$^%ѹPiĺF3ˉn$Qc#q1vq-$bf ŤqXPD&2\I#`O'|0D֓9]i4+1o#qQ5Rceh cn RG[twr"21c< J* m1Džhg<3i4{I`;TpD~C:*<}5BR *튝'x_ߤ_%#d͔#0T#2 IC;3b=}3w%}}~+ &#l5mMSbF; |fa 4[?}'d׹bWY'GudHC6`HO }R%%gӧ|7O5tWO;~^UHWEsG'}.)Z25^KrxQӎ1$]`8yX'm ytmÜxNIu&'RFʧ_D,fOESX(v8`ym„y~CuFSzla-iEΪ18Y|~rc%f 27=@vP7>C$yDkJVޜ<>8^qc$ygFA!gh!%YK~k䬶6mxlFO~2K),mkC&lVV+A,}(, T"< S;EsV0ꯂw5ŢHh8q ' Bp_l/_4TDRxI>)1}T3^sZhŠ&H%-Ww Ԃ C[DNrx>VK qv>=|kmz*?#kg\ 7)(>|"+)7әm؀v}iű$^a kz( 5cl$dq?;2>VJ9$QYZ e$ ~q cĸy!hp.#OI'Rwe //kK7R@4Ѩ uÄĉ|]6:ͮWi ,G_N([c=\sںcu6xve )U:riyr~VaqV!6/ !*Oqxy{?X\F?c=948u7Y&Ig7TI;s,OqmUg ̕{3+3p;pE>āvZD bΟJ✬u#$(6et$}QŵKz9Jn]o=sL zBE/^*JP0Xьiq?acd|ߪRYQcmn0z[PWEd7 K'h@o$$eEָ}Bd*&k d70V~c&!}qݜ~*'h+WgY1+LjFݟ}!@At$Vt1)V lw;{"Iy^zLtOWK Tl[BWIgcg#kv:u1pOWJNʄU{Z'vL)?>ݥ'u?UePJ [;#*}9pe G@Ի;Сh>@}J}վ=^Zkwt$;yc֨eo=>l'MF+}?Z;@3cCWؑ*IUv*u?J0T;e;FFaI_y Tx깯 uoZ^ƴlWX`V^Cb?( N΅cNw*k閅}vl%ՙPcsA%2|Z} 1;UK20Q,7HRr+Qt^<,h ZwjѨic|.x|WcGŎؐO 92=Mfj٥eYBoa/SW s_gҵdS 8./ @#Ϻ神)Ba<+Lhq N۫:^Xrtm^{.o4il5"N30XoHԵv+/f&u( as 4M7Z#2L4,UryVbX7ϱ 2G|Rv-S%K: uQCVM@ސy z.RTOge\W}WQ{ƝsK; u2棙3XG@NDRv}er~L6'_dmKD鶕V6L5-?mn@|AӖakN1Xx'W;S*ī w<݌/-yۛ7?XdQ eľ@i6&L5㖆J"[cb`F6ٗ~bDF4ںF8O#h3 ޮL籶 dhrȖ0c H}q..qy:A -"O͎H^𻏺OYU%kT~~D,Ēub7l28Dd<35h1<ǭHfqX $QTERуW`^_qێY; Y)v)krp$/d3W0eBh%M^G>\:YJi蜋9n^vXޒ?B_?1=תUIʠѶٔx>ĺR^$&/;\gT9jNëe24kXLS6Gf>OV-!JsJ湦5AB{+ ;CR$4bU" yFdISʔtj-4ȇ OXCo.Ӱ#ADXJ?fRv;xi=S\4 S:M.;2 r#eOװGّԆAMXpv?hfe#RيwMN qi;AN/1+$lsݸI܅-jk 7l&$ZYW(f K"0Q9#l@FЮi3Q̝h'u\OZޝϜqyO)(rbJ+TY5W%cQ">+Wuz"X8 %OXCoohzAsAM.Ih8q1[^&ҾֽZ+NON$R"tt`C+AlGcV*0Dr7<}Xa>pϢ{imp;ZZ\2N`Iȉ13wb5!E xWro@Rx!8=Fh%ᏝXs1ku>_~EJԕEimU%JSۯC7F7摬G@&Hǩ+:N[<gwy#WI|JArʹIIV3"#[86w6JZF v%Q>;kAJ1fFJuL0:9?Zf1خ1"@ȟV>;,Ú8IӦrax+qs[X̙eR+Cyyy9;, -Sz.ʵ]wrx39C|(RIQDh$|c'euPyǺږo-5z\O+TcUI;'Mik^@`-Zyq>VU{YlGm|u2u u7iihϙM_9e漢:emxV>wY4|*ή/{j6w3dtxNLj4%zcbȻl= 2)/ ;ue|0R_m A5u`灥-0F_DzO{k*f+%onl7]aCE* .Neۇ'X:€'$ƸÍ <u-7Ly{ntQKI&:Nezn}TpeY@&Sh떘uv2C [pBr#n#J'Kv1gr:kw.S]j?wX' ݚcnܼG9WW~NHGQ/`,bFjR6xsOC?Bk؋JWRHtކֵ?U` :$돈^G/Fx䱱ZzD{p ڣwg}<(5]B9ڱ)謍<w8DvdSa.vd et=<' g-rfk~a@eb\{_XUx~Tk|9;Gܢ+ıM0 c&$qH:xHТjz:`:[*flUX;tH/b ߯!/'oJCWu?ke^8F 7"^9D+BC1?#cS/;֊*WUq% |y;cZO2i 8pxIc7 Cq}7xUΊ J߁DW,AQf)yU d#̳# {mug?uP/~bT-t˚e.\G/fi:g'bXXǧ7-4NZG'zZ묷wWd 'P6J M#R7s\G>D/I|8i|o y,c8ImW2N v{j۟ϒ+aQiuǔ38}eԞVޥ(o.hyoBY-4A/1}Ҹ.VmZOAx;\x\QVSZ <|G ]V]*Ш:'k^bXÚxsH#~"#  JqU;u"s s @,+J~̦bX-հwaJ;!+ȟr rKۄzu˩ny8/LJX:^ae̊;ؐFs?9>! |>U)w>i ~k.RnSsIѨ,r9V N)؝|C\ZJyKi&0q8{X%Yk-\ibbnKF YThS@[%օwk_;X D}@a<r+"Esu +T7 zD2ذ6+79OUPoV 78[D<9&1't^.vȳe@jR[f$u'b^pken :M 8~3wDxY}"!XIò??5]jڕ*:paz.[*m$i*Ь40 "IU`mޤ*NᏝi]/;ǵĬw0(&,ZIcb{<騋V9+Q-iVKa=*ZYڑitXf0:g'g6gjb; %f G&F>L,j,LTLnsbwOw$/NE1NuEQ+ Tw_NTwGu@mip!iM$ / /?Bd|SkZPDD}ܓ_ @}Zէ,fG%]Dx[!kU:K"dW#"Eǚ1J&Wտ}7}m$"^7ryvXޕ,ض]cvр,Hĸ,M_֭gp2d32=1S%%^G' h#GN$>nN svٍ4dT;^D voW0:s9^EfյMS*݂hR$l7N] lv,f>y'T9ΓW]$VU4$wkDZsݫl\ὼt>Yĥ[&ɉevaЇq'5+7bv~iSgnݟukiqcf!q=7jQJU!T.$!W  }+ )ZWT|n&&aȂ߉_y,دJ+G62J\hH!LJ6!s^@x>VMUBB[jNٙGj6T[ܹSx$c~QFZJm[wpᗉ≏.I&[pl{w Ӥ6F!ӿ~<;.?+BNLēB:)ٔ@:J֍2ʭi%+kw^ڨI#<Bp'u;~KbK⸑ٕ7@ʆ!o„:uZ hCI.a2 dt` ]i <;JXUp& $/Kөvoc -TnRy.aIcuJ*idL|?#%VYy8Z9&+9FuAȑݿ;N318';u*thA|VTM1^V{${汜Iӳc螾447yEӝ)2mP67C9)G9O-9mJc3ϕ>%̊eBGvr} HH2?ICZKK\].ɎuZ/k=pXe^R X+Ǔ LԔmHׯGqu;=2ǢODW|\3&Z+PW^В_`ٶ!w+.mG}/V;Y4`ЊhGP ƒо?ϕO̿ l*U;Zjf*6cc7D?**vmՒk1O$Opļ8(qJ|~K#-({ 婶Dh% QmH܂4j`dMXUx,8^ݭ;-xO,ځ.M&E+un"KX2q^sy~J D\ﱽix*>6HqcnsKPQ]!fjRFG̑pbu[|L֓1#a21߈xfj1cJapgg 5]jV5@!<3w_3tnx2}9NX1Ğ%defZ6,ݟ Yh_aP.Q5iLt`>|A%Uj4?_.} H{Ruh`pü&v~<|e)qg;GJ+QB]4v e}u DIJu\ƙhsq$.̮*etdlL#'lP=^In<~֒Y H%k&` TWPIsx0H 'RuOt-y5089vWG^J ;8j[H{pT$ǟ# k;UP4&zƴ|䞁8|;~+4z'ҸQbK]ɸ7"dhbw *veC99}Kh::{- A {k;gKGN*40P8;) MRTw1FM5)1$LOOQ&TJ .$2ןO'Wѝ1$Q$2Z̓1H\@q?fn(m ddM^W_x^fjVX|֌cۏ}y_~oڎ=e~ u'9V0&hyn޹-2p\aq~ WPt]ۯV"cnr~ԥ)BԪb +y/[m+MzNVR9 +9;~!mc$(Enq_?/mB V'NhUFH/Zolg[:&r18^i;mN4?jVjWnk 1P+ym]MhyRGjUS KVe&,kn?]vV BG1x?y/_va!s(bG+4,\d1c8 k]`CֹYYaIh⺲sfUPYnukc=XllKg]HY26lXl&2X!#~ u)%l%}> w)[60it 'R:2J=+6&jIgg]5yZQ0eۑ>4K :G:E?{5Oױz`sTyix?sdcy\;*nUŎ8mc@፹ Yw+/w \Pc!]VNHefYWp6u_Bx<ϟ) R]&@*"Ubd_I_Ŕ p?υ F%#<+n(dVa?hyГp̧Cvf>q~)bl3JilݤJPuu؟$qP<">Y>G UmT;0xJI"@qVn#`vBICӃ>^b˳0١H!~L+ PKM]C_YҒ}8SvR\^Fv#N|'XC)e%q԰EG*7\GĮ#Y a'd Đ}<p7 GS-r`y~q]Ŝ4iGkQK"K16o>nǾ*i6SpA\U؛3Sbbx u=1]} .jo|zZTY5 Wn \|zvu<%AhL#収ҍ@۴%Ԩ}}+tY>#יɆڝdȏ櫼ԠB[>IΗl닆kK98R_ؚQx.ZZOV0DPcǶ 3/$Nmmʏxs79xs9I+% LިV8ܳueβڰ.ح:AAZ04! dd[9=V$ YKmgݺ9ƹ@Rm9ԟYq%ӆnʾ-o-Uy&B$nTH65˜|-'|c'˪w^][d7c8gk]Ԧ'ph( eOYRu)5dd4)#~jHWMik}ْA0c$ sO4_8"N6 >QpD~]M}H9aA5F!ԿhB ؆jyf \<Gn;GGR0<Ĺ&8$e$cV;an {A"s3-2!P2d1нbȆ4"e)*r>I1)a^[uK6 8sy{@ ֋Y5̮ fx ŝpӓGc#bBZqUF(#2ƆV;7Bxԍ_U![y:eL_.a9IeE:/rv1pP=?naҎjuO,>oykC"a<|V ; l}jRHL957ݎMKRxPZ[zj& A@=O+"u,*X-yFm_][QeX5 ^ ^GF8ۀػ!7_}2R"QĺmT!~444+ӫT0`p!Q>=ΈX% h*Wៜ9[(jBY,^z",|f6NuG9I</ËRLJmf~5I> mc{K`g|t-جG]O%~*E$_1ga9䈫Kp䁙:p~MLLqI3͙Xl1m2, X既q GbI%, Uآx<@nI21atq,|rhQJV+p3e([ã\6OcܔdIݙc qʿWk&s`5eo!>Uomh_xb\D/YqL؈Y:!Ĝ`wy鯭 'vs{bg_]ڽ<2.n8B3T" ? ̺^H*F{ 6ZuvjU<8<`IOU'!F>IRԽTr45G3ܰ {z&Pe6h״NX730 }S>S^ \~ac&189!Fbv#v:)%,{ps^#J8[=-*zXh6rVc$Qv${vV1)@ Bi.'xIĆ<lSHLJvՙyAjR֓0`3q+XN^7gtYoEa}Ht_^1吱p1scuwYfTB1=˳ʢ('u4_; 'ξl.3~JΥsӟ#Hi:M}FƋVScK8ֆ0Sׯ~ e~9.Jz],0.\yܫro;i:wădt~[ityH++)?sb+띢.zZ҇ЉkG}TݣM{H<_B q5vM{1+=ӳ+"7쀍6y+TW nLmt/(^jLtY Ci]O?X> $ kG'\[~ؖ&'L!,,#$n۹C6|8e}cHufUvdݜ $J@p81$g _=vjY&_tE_qΔv~@ЦR Q?'7k)\Lmҳ%3eY0?mocLjn<.}Qkfr>|%ߖY;TC,ep\ a*t߸X<[\N70C>ogx]H<=QHUxkNJ6zٳi=* 2]ޥ+lzZ5;UQb6Pď6qmJ}y>ct˜A#{Jc0!Kۗy22[9oWKl&cz:/ gr%Pʅ)CFymFyTUhH=W{OlmiloLj"]qt9S`}fqOtįA:JbuXKlP_PkNePv WbXb8#3]l"2{7)e!Wmk0T6qeMT-tp6K]oLq4k fBvpޡH.ӴrSv3|I O:4&BGdRA~ }|W}6.Oο},Kwc^J%f.\?φjxptd }:K A \9Kb`% C[2pL'iԝaď#_ Y0F>;q?\݉6I[+ZRedQ>_ mGFvX7x$O')9X^[w?&]֒5'vmd%;^!:7$֗岴]۰aQ 1ޗ] UÞmmNX ~o+Fk,fLl OPo2?gB[vAsZ H$P+1Ff e!G$ x G' ]6)߿pG$i$A/cqu&~Lg2\TWW%c$A7~9 _j5e׿Qjy I{m}XAYy/Ǒ-,k{ w"x]= u |)svn, ߖߚַ)7;H)啳 9ǗZd$|Ɉicgy;P]d"¬ޯYf8]۫`nj]  &rA ՙ1"<9*(R27N1#Ƴc 8E>6pj4[vcOmGA}:NޝSxrF|[KV4 4%_?MxEWLĵֹٳTvYJ6kaNvN`V9"IL H)jJK~/]{BktZ5Rݸ˱e@I*}?/#g=O5WZ^!zo]iW h2I 'p}W[܂IN:Y`+UI܄$~q6d%*9m?Bs kXJ2Fy_j;z~kJIY+<0T sD^j}Bŭ 4F;vkmm&"W`mR}vg$P!~qlNVTu׭V6⠢?0Nkh`T ʪU\T4ğ T`5BmY'V Jzy|OY[Y k^0K k. 'i- }S_r*V|Tuj<7I]csv9 ‹{QȂ} ŵ/fjWR{r湗46 /<ޛ ?U,Gr:80*q <̄rOa]M!ԝSc؝j'1}ƕݵmפX9p-!;&3>KsLA~[%{JN EB[m{R6?l,;yGHR{Z4l/h˳RKg? %%vU5׍K+i\ qxӠIƗ::e~W.M]??gګZmK[Jqw 9}CUA-\n>/P)k,1cMji#a=*1yo(ĕ>_V-r@4`aq$5 '/a9m'Vp1f-,DUP);mW伀0>eL2ݭ? tQVԩSK]6E;AQ5j'<-,zL_ f&Jv5F7b>@p|%ԅG~CEiJ"l6 72JȺ;ʼ+$>%ݖ)+";(ufMfgyA m.}/+AK%WRWqQj rc5.7trA#HrQ[/WG(겦Oi)_[lCW6' =Ef/l5i!>./L5,=A )G}A`-<fCgz(zfKw]Iu̾>ޛt-d;3'S:{k^zgT4FK%URnX0% gF6+YTO͊ {wU)PX}Rs@k KHHwђ`:G;E+-y5{#h2A ;#G)8Q眺=Z^{%X72a1gп,n.mWѪGcxi'_?]Ao5[gj)Γ#wD7@NZͦ&|Q sh5ٴ9q259 _ GkJ+A,'v* ;mh kV6݂w[*gqJIym63R`1$T2H$5M5+9zmcF2P+;$%B>Iz~E!g[v^s[C5>&n Ĵ!6`u @TaVC~ɒW}'{JI|HiRVwgD.{ =֧{Z-3sL@:YbDm}4wuJ1=JN٤9n^{}YGl5 "{l &;y ^wcݬ[0g Iҕn7 'R~DOA~nҴZV:uFQsQ߀3T AN{eg1y%Y$OpݦJ!x"Y\9`@A22q~+z&;oT#.P㒤,$IXV2w,7,@|pY島;ჹh>!p<2C(r)I2#ZV,ّobi:elzg].kc@/_22n䃞8_'$p夎(n"HVصd'͑P) yQdݎ%"$|dk]+Wr͢"W' U_~C=m(I; ;Hו Y|{oND51Ӆ!Lk`h]n~y qAiZ]%]O*:ۣh砮ˊ{6,{"=I@mbtJW#wLtk?0n+3R͚lUzOoB< N AXAP;aiX9]S@^#e 1n/moƱ2Tj_En1c,#{ct';c]F P E P=+&=b-E$0dqI ݾ}}vRtqp3O%ˈ y<,rq_&VeBFeL[0G'Rt5ڹi*ѐmA52%ϢݓN(LŴz֐~UDnߒm3NβdyN_M挃B>x0MEy$Dk@x1BIY6翸:QHT~ٍ Ϻ-xA%HȬNߋjrMI1↪[rnqduHZ@'Uӯmۨ8\]O`phޑ̌4 D*.bGV82WzF<.& PԴ;ڷ!m :}a$b[2 b8ql]Ʀ-ZEG 3 kE̶q4\r7ÝBӖ;9OG'Nt={q`929 R4.p4IcRU[kT^.q8' !L)MCV k `dL->gT9Ac hBF!ֿhBF! Uk]b[n'x&A$r *V؍aZ:iD tkTQcp FApP?_֮KRtّEP#(E '"+Ɗj `~ 1' ?$p- ֩`z׼Bq;7%ӌdFc)tu ?(y*?*c*6̢E !GRѸ1g̹u]3KX[5 qw2zNR\N2>6>Vܻ"l(Y$ӴlI%f SuSPZIzrmنZΈmYk2Yg.2F=?RwdZW@11ttE*pXS [`p(|+60Ua7F't #XXG6N|Zn=➺ [OqpWEm/6G7)v O.H ΢J圲Ǥ mb2iWob\ W=Eav <5쨫uRrLEZ%a{%1&*WlY­LBMWJZB ?+v~ctA(AZT 5Imqi$uR)s%vp&:/s28{2qc>UH"v>]mu, uAtB:6.ql Nĥ?:QR ĖSsBO+0$Xm,y I]߲skl7eÇӤKꁭ5K#'diIzKVkװ9Z%Ecu^{ n[)Na`m~eqmmV1nPk4;%@% 2]Afدɿk%SRϐ>}/p)^A행k.Ýu7a axpI\zFuw U,uf!|!>@i!; w{@ki\XKbU9# x,r9\lEa ܵN|/yҴ51tdwlosuA6Ф^\sQ2!ăv5:;դ,nhj!g!;A]UB˗Qs_ҦlhڳsAi4\3;j8'䷞/oևgSf 'h'5eKkY3Ov~Qۑm. vy} #b3d$tag*=_ }ttᬆ.jwV%'I'$k=G .V&g>Wc?g{ +?<nF?sN LwKUY kC0awfQ#}B K6Ɓ o8cwXAsU(#FF`>Ok,YMCI>Ǎ20,^]fYUIayuW9QKomᶾ,a|z>>ݹH4,5z/ca- _܀k,{9}le D IHهBj|4v$m&hlByճ F>_BLuGtU"GYhX5o'y@`K" wiJosx)V4[?b{>]][wDҨ:A-8>Ig_#$1+x`c5.l6.HCTh'vC0 >vzO}[m}'}56IvHoK߃Hb|yLJф#8;dNovV.nVC֓A %{@I>iX7TqX]3qӎ̢IV% *8+)샶9ins6L50 _e#[X쪠8B<@-{n8a}QҪV-Uq{\78['' ZHׄI0{QXx$,W{S٫Vk̸7Aw-sp HNzKrxO "c[#۟>p)v8/>M״s 7znhFBi^tI %a7obF9|k2Z? 'UkJT-bӪ|,G#>y5F߲P e|{;d$|#ҸK/k)Vjf@L&mI(ټFɤ$}"YQ"z 2428ykV846`I;Cx AIZr;K9jfxH07;5 zdB 0q{C݂}&)zOjly5=;Oa;sV, l`}|9 d~'?Quv@}rsSxK؉, ܇dCm:X:HQ Js|op˶:l!=H$>u$Si $B:9v9YO$rWؐ|N3d\LSdh%Rp7'(Ÿ;}8vd9.73 z/;Hj /]C}a&Q"s>+k5jG5MTK7)Jp[N$*<@~K߁Qϗ?H0^fapIN%v¨3:{IX҆=kہfs#EuX:l9,կk˛JT9 hlC!!t5%Vp`ԙN<$Ag퓵vӭ[5KJk7kƖwmSX,dBߊI%ff%bI$֟[X6IrI99Hjz֡t.{~ —ӄЄ#BB4!Є/׿hBF!v^ :2ַM `9)ٔ@:Nڍ=`F "'┷A鸵$9 B_z37]Oo{IqaZkimdVgGnnȂEX?w^kOt\yHgR j-45IG-e);8|O=W骵6*|[N5fsT|ny:y2p*"@)DeLǑp]\{a;5a[ȞS?!MX,EQ;z>c+$vj~!1!$LYLŀ|V`ޝl h˺|_/F<5h%S4jv/෹NW3RFP9/;Br0C"/gu6f([9Aa|Ϣq4aNwRɌz?f:,hk'M%lqV<{ %;B '{߁Zt*l(_ck.~-g B8bf"DX%cȻ{x:42nrWe,7Qᢓw2Fܔ~柨 X{"s\F?4_z@@Mj?{uI05H2MCvh=CǍ|.e0 B]kW|uePmEFxR̥2HT1<8&1om(ֻ2"xZ"(lΰTI(N뺂<$;X&z&vѸ뒾j*R9!KJ٦e 叱W Pqtc;h xh9)9b+ L5#+wߏ(c$n6N|Ncs<-txǜ,_-Y͛('(.ŶEz#Oe&WW ZL[S=8RwYe9YcjJĖ`[$#_OQ vҝKѭp^e'bjKDpO4]˻4r n>w?]H_WbaBHaLw ;\CÝ"w-r=G,En סY3WN(N?m K?."te-|K[ɤj#5/" 53J.rVؾ[[ԛ[{zsk_QޗY 9)_i'~>hyv"SȽv>Ǿ;+KѦX wl=\S}'^Գe'S+װC{T#ƴ;~jH/t@~YAn@?9~U0}RĹk#RG)Z(Cbp < 0}0x]YSr*^hkD|?VOjKU"'8B8BXuX>6Pо(_YJJ ~Uu]5;2mWRk"VI> lKSՁ q/"sβSj3##N)[֑QOBA#c!f7̲ٚZC'"d)fXے(c7Qmng5 >'UOEC+ܖ1͆wec:!*%,u9dօ^6O9"`rZݻs}j |H?G) }վìJE-ϴ7 h}1M] a [I_,Ō>n\.Fe2ƤIv_*)J-R{Iq3N(-YEHwNi+:_%3XC YZO;3vG",$ :jjmWx=yk FZIRZedlev}D2I𴚙cbI^0cۉe`cQI>y{ qZUmZkX7L/W]f|Iބ}|cl]rrӆ"lGXLҠP6cJhJ[kt $~s8ME|mHT#4X]w]ǧD$Ԙ.#"1C{h_Bԙ9QGk"ܝY1.Bk] n5Q x[aO D޴d:dF&'FIwy|ۃ(r͙Xghb)|v;LIN_a'{Qu0H9>9g,іL3SRg$Dbл?%ĪYa$&T A}r2;H$Y?}W\'{y$.̮o,("T4Y촫ܷ8 0 e/YQʦ^$1p=JT5i*@9!#mA-w4ӉUzJ CAwgi*T26lp`˜\v\[\T4 L$^jwn}G9 q$3ut&Є#BB4!Є#BпhBF!hBQ[!m%Jd*ڎ^$ZiT9 91E{B)ppiĒC"zd'VqF .ch/3Gf6[FTkCiO<GTtNlu⊛%yXTbB۟ 80mkLq#l)2p '% 3FVWJ ..(-ػ7UnD;AXmN{1Zg.h滌2nDR8k$kֳj~3*!S=><㼖TWݍ 0'u HJ<,d'Y٬KVl0\X?knjZY/u4rߴfܘM L-|[9G'`6vώTO_# Þ ڇS-`>k;꼚K$ؓzHl<$p$l7&%gA/aҬNd| A_#;kc? ǝע4_shh\cCGE~I^z^5w [F?H?CD PZT8ׂ7TU`Dv>KZuesܭL,(V ğ#y ;UH<,5f2q\{r2R䐨O`4 *nplCD3?3Af ʶQ#Į$:ɾG}Y%Liz5jNy d]A#Xy@<}5pJ띁X߽kN免sq,T9 [=*:K&d'p1of=OSk&-͋٭ԱKx0Kgk% :VHr ZPr>l ?g[^n GÃ^-2@2V5e+;B*Fܣ9{e? ]>>Hhk]OԛR֕J5Zwh=7ku_;n߹^iUVŗV!B}Khg+Z Zn־sdS`-N<1+M:+sJ'F(Sn-wK~QVo5]1%j]MKq'#p@[T+nW$lAX -rc'I^Xmf4L㏩yƹYVa uxEbw~ue%$GuqY0XꌓO*M#rShvx܁鯜dtˡ?\ˡNR]h!1nH,65*+loWh(&+In0q`7΃ 6U#Ji l^.YK!ٓhM}ĥM$\T<nT?n@/񯕯%a~'9)]6о=J;zESzM!H?n"YY1ݓ}ksxEO>, hw낱 'c1agt.avm=={MᶰfqxI<6ݔJ5 %nV.mpMnfm0zܮRIzW?FeFuI*_RvF󠸈wVjݎwQNM갞v7ⲯ?+XMZ_A q4/&m}gmO,kT.vJpssquӷ훜CISIzfdۂ9)P^3#G7>4%&FkR3$55}L w+1i2Hb!ZK~L }m+E>VH`&ϽLq7z-.+qZVj|UC$Mmp.{\5UdIܜWYY(e3̑v-*ƠM;mI؏}op}{CԷϧ;Z\IPvgl]<6'j`[i"FŶW䣑mq?@ξ/PVAr͕KA?c+@u%I-|Ďy'q}k #r5f׎O{-p˭)6`:C' ]ߵRjpChj3nGŘk2 qu9㎓G[6lD%,^ a9qpw~L8PVrZ~nXt[9@t;=pql ScMV$|R7΢"3!zz]v9j,- Vߊ"ԭV욕;Lz>gרU;i53נI8TB֝-r$7-'NWŤBB4!Є#BB4! ѿhBF!hB,HwgQڠf)O>ܷq4v9֘$0| KzeV@ 薲}+38|A]?Lfj-wN9beu䨎2xH*H#|}hjnsb#{$ ǘŽ{)sRk/8ePm 12Au5:͏TTkZiTh'ݾA%vXaK)5fdWHK6<}qVgB:c8PgZCI2 II輕7=OWWat1G5|ۋ{$5h)n$HW1/"=6ϐeP߬X-ȱ_' 6Ć s#Q:F8_h̦:ޫuN)@K&@"A I1[o+fC^(IH_EOVڐƃM\Z>g4fN+&nQNiJ2}܏QF;7ggNUDT7i0xV3Z(&R9v5q6m~jGӪo)̱0㗸Ʌfd(*J3$⏰r[lX~Y0PN}\9ŵsdDLG;J8d6ZrDZA̒a P^j5.U(6EWT a{h- ̯ܸ*Y ?l+'萾uGCKz>7捕C+,W#oLJaOU O밵{psĨOӗNK[{U`k";Ln.*o_mFvދKs x!|u2a 5aarSjikFekH,5k~+ES1roŹJC4X,V  u)HJQsuyI-l̇Oᐜ20WO)jP0q+Qe1qЅD:ى6=)?imDZʛम$)nҶ2:d좥Qވ5HmO'U *'i4ЪprK=ywQA+5g:}1ZX)xeaŞy IU;3,yп4QIFWjCmedY}h֘sqcu*Tq.;Nock2mPDs|Rw/fXŔX Mcβ)1 ݖ5plךcjmT3$7Jʾw5!=$*N\ѷLKD I׻nKn.XyP|Ϗq .-kqVq.;O%# V?o2FERܹ,5 xӪTX&34F'ny),.56Đ.#t#a6VNjEuox!4B;H5۞%"f )^:ßP[K@sIʆki̥@45Kp8:ѳ5yջ3z{$UV1 XUETE 1gf}tqs=O3&I5hk@I$@9㮮P?vtЄ#BB4!Є#BBҿhBF!hB^=;Nۖ$5'jMORM4[ VDvZq Zj76ݼH$|KNB}7pA ,֯M2X\uTi"[w&Xr 7ܕ-)ZW(x3ȩANӞ̞Vk]cϬ 5ŕVrV+jm[j XFfFH m7u ;WU,p=&\D,m;/j}*p w.<&0vcْGP gŁad#{1,+Y\miRvgAԥ nZAc&XשF0 Oٴݖ!n͡WqG=o-J:6J^ 9<8Fm!$HVsKC@s>Bj*EW#s"5ia&(} ;/vĥZHQ5#Lg1R8` xF{;F~LvYȄش;{4)p@My2 8Gv]ϑa`_Kӷ&zL;A18yKb8U%V(`<$$kl +Kܒ ?0 wș<Ǘyݬ^d-R7ՍJyNuU*Ifp%OPx?O}|jʱ$dp8zLs!#$ؓ^I緫뿶! m'98j5-W֮#R $"e `6ꑶ$yҴS[9"辘pq1R6sˉI;ӷa+ƶFx/x}ܐw#a_w6li:Tqm,@mkx1xeʶafHf"RcgfJh[Uuҵi4k c~KG.[&gYEuhnJ/_kܝγ.g Q,i5Ȩ[Uwk!@v˲A"^R?&#}k/Emβ١<ݶv0{-*E- Y_s k/XLU^sۮ *JG9g!Cml O +v˲~yԸ%Y#޾C/kukWk=X]Xҧ˲1$/$ @_OgjP<3dF":[|VRJa+FRfgxDC- XÆ$ >HsG~=IR V:oR5b %ާo&=C7 0tvOn:|/=G&KUxrc{uvv_<+6֯g}]> ]E\\HN 1X#ϓoH9~ԉeanDJNoD/2ՎR{ca(K|Gx'm} w$Z=$}8N;E anXKd hxܕʒ> >6 c?UFCrLdte"o vڝR敚͌`m[ 9n-r i} *~e z7Ъͮ𞇧?T}x/5P'z&|h""2D9`6cLjz<:F֎Np}^ |D:}e OE_laGciiy4ZA:?54hiH&E LJym}hdKfHOcE@ ̅QZ%e1F̋LFma 4mwI^b-(iA]twX'r :F #LnJ[u\jUnݯ}7\^(YZ+ /2 PC~}apJ4Ћ{Ds0.%ZLOB6)FgfNiGH7N^Oz}nGuBe:T)jtT-"ВA W:m6m ѵ wK~d>|KMrqrJc&O.i5iNB^ڼ {ZYCPujUk];R"$4ڛ Vbh$7#2*wAv 2x\8&M6"ɋ($_c|kAY0:2NDu-nݹy'6*eH ~>.Ѹ&5&4kZsL.`$rpKLOBA[7MxzW*n\Qﳝ:6057A-;!V:Tmt C2[ Sק$IQI'r|N~ҠiS;GE{#pW{](Ī>Dܑ:!|&|^ϻd'\k)^#:#]"H_WYx~ 2mm1&Di8 Džf:E_npe؉Lmlk0$JoLH 89 =8*)c)F9-Xڹ21GZbgi}yk-^ (NWLkj s碘 [6y" X&2L fٺv+bU,/ aF @xwW8M]dH3]U8;{@ x@\q$D9֯Vtiq>|yLLtGkO/Nf>y,+'lbŇPħn<-$*V)5@\1"I$ z%.[Mx4`@D\U2~=c IhBF!hBF!ӿhBF!hBF!hB\<^:01X<4w,Lգ+2W؂6k(Ф)QlZ:ƻp3%8ЭP:K9$'t\BrNl1 N&tAU&C`I$ᑂFC+AOG߱~_y'U{x|wvJU| Ğz6PVVҏت6d pnD ė{>LFIbN _ʵXҥJ{,;|E?BhI &1cRS][9sv$i10~ ӟ*6"J;f9DǼa (Ĝ&,Z=23sJeSK% VBI?f#)ZFP-Ivң&KYVWCF!{\;};唵@XJ;Jv"]Å@Cv]Ϥt@.SsYE3Y` FIql qol8^7+| /72C**aRIf>J1icv4,.- !l\MU!)8"9oQ/7EOses}0qv-E9RC&#ξrΰqɻq~i9udL6"K=;~y⿟4Ew#6%x% zΌ4!9t*pmAVϪIt7Z$ea83&*PF9[hBv]5;w6ϧ>Kw 4 }jW?BdvY_@۷(xkNLc[ƱZf{ǞEBk}a<\Q%Q7%eܶFCms pn(P%âq.#9 _k#4qZ,"82*_E)f`eysSg߷vI<9'ݎb1G/Ec4feW!+:Ho}c\$RwV=N7P\ ApR"? r9>u^ErGLN*9C= 冓|i}}w=|W8=[b;=a-1ӵ>覥\d.$O;xFuO+!A~7~h#g A:WzN,q"v6qv=JYbL^MW%uɌeZF#$eipW |P1䤰N3KZ:y YK=ߓ7/l~L+׹mD2y{U T䬟K2V2Gk+X%-7 4 dTO5TzNt,Ii8D/rkHfA g,=,\# 6h\> !ēuN# dRn },v6)q=9k"LU-L䟈"9H RnD{i`x=r?VWNQW&J H3q ~ 2h8X]Y>R_wYyh@>}JKn.iR,0!H81*x x)BO`79Bh^_WuRֿh0n#uF|QJ A,N[pw;:&mno(6^Ӧ͢IhsH" H]saZx:$+vEpyx${krji*4CVe7Veż rpzZy]K.nx*:Uޭf(`/x,~Hhټ`ݵT]2^sS*)]乃(W?C" ڝ N;2t CB_A>&o-2GQ30́)76ѐ ID0b` )RitGVWiL1{ . FsOIM\|E=|uG륐86$9obuIjΛC{Svj5꺉l= `:cD`tXN]9mX^ec B[mZ)b6XvJJA.Q=@bd^Ps$c+:#uv<^L\Ipc9Bs DGYc[7bn]Zl$`LAHrqrzVJ0ѼRN(hDž0N2YRc/ӥOU,=S#Oqs<#Ut^\T2Mr8ihBIJ9F?@7:6 {%ti|7q֐d-{פ4IK>4MI,NG aFZ08kՖQ~eF9ۀ,-.C̩vqu]iqppe8;vaq `IO`պ0exep#9.7rѠE2l.Vl4À; p[UٳBA/p]2y-`3" =P$D|S3zthBF!hBF!hB_ԿhBF!hBF!hB_T{RָrXdIWn;)w܅XwѰ&[ L8T Ɲm~ZJod aavNN;#siRvCϤ}ޝ妛v g2m i)]}vC?2>EⱝX;flRCqbV~";D<5 jTe;r@msA9 @9%[7KvƤEٍHWP< /S{kclRH{'Edr/uRױn,uE.b{Lc}WYH 䭙ͽJ uG"@pɕGJH$JSsXMŝ[Ѥ$ϓz>"!uc,"KrX\WpxƕL5RU^/NejZ`*\<Y+fa{|ג_~NzAʍǿ:OVKL=ҵNvSh|He2CZ10#1Ddgc2}JuJ\<:\ZKXP7 U1UnEP+Տ[3݂xxN>H[luk%V?|T5j&ܖ AWk!ZU!/jƠCZkpmLo[ˁ<68vԕQSxYC~Nx+pk:u.IͦKiQRCi{Z0158+l[ cxѐ6Uƾ'y ix4S%k9¡l<.sy|pptVh]9Ānb)"iUT i:ef>]v_VkAu]Jٍk\rG]Lh_H]&Un2('}:e[kS+Us@;KcsG ԰{kỶ44M[D( + ձeY>ȴC-\'$=1BK,A&"),_te1H1J> P{ϗg#KJܚje(򿑌_aa50cm㼗|0s/ g>*dn'5I{y7$8*oh4(:_@C5YYd$*17n@%7}%菱y8_GW/¬i"/ u?oݯ>AǒOԾK@ $BtXh_f~ݵWDNvT=y eܔvyme#h68=\/;3PT/9(f W|fA,C *K oC؜T/Z(nc;rC ڳnw񷷝}nJƠ-l~Zաkw>`dSâ2,X]Ȉ1ᕶϟDޯsZE9leh~S%}֝]CLJZHX_ }ha"Aj$<O BWwf楎^U\`1D$z "#<g6`evh"l3֑\Xʴ$^0H%s]YFYfՠ*=|48a;\{&_d+N[Ҹ{ꍫiPahkx<%A< BbXH0϶tD/v-גUm'9#}] .V9DHN^<`?;vPNv=|]Tah9wlAZyW; bȄ1ہA4[8v<ԥ֙VϿӋU1FIVyaJ Sa8qŷ>FP]knZoyF4{edp;+9<1 dQq:vxMU現}bpc N:6 vʶ!%@/|; HuDˎ+4hexbg|HrHrrhT)v:pdrw U:^vShB,m S~qPѬ/t ۃ8\̦@ #h &]#a1\ZCTBO(Ol6$oM XX}/.ٖ=RmKZ@DmtLmt>S^^XEv1Kq" /nerm(ܮP*akZcnlQ)[v,1C-k*Hc]PѼb2 H۟䄮6klCN]6=ۄCx$OU'QW4rXFe9et,>Hk=]&`+ {j){jv^kp &I*OB7<@AL2sRq)mF|4no@$y)墰1.`V$z܉sm"|ӭWuj[PkCǵ;A^Siү}&yw<3m 6vo99X3"BִK6Шjp;dlbKN/!=\+2cn 20 UTo*R*D7@?zBD?0@0IXRZkkmWSeSJQm"8wc@.ɂ>JB4!Є#BB4!Є#BB4!Є/տhBF!hBF!hB~un#^裒UȍXn 6 ෿eMĉAz'2<NBk0DZAGAW=pp9 돀}Uc9 "͵(LjR|R˲u|(޿O{p=2G1ԙ-$tK+ pÓYSUZʐ$7 9 qZO#jQ/~X}nYv;a] i&of?WZ &1hTXXfI"T@ȕK4Ժͦ CFְ4u"x /Ǐƙִ݊6lR[N,I L1N8f20շn{!z*:Kjgi 輟hǤxw$O 62BuK &Nd91J:íyqWz| NöP8F[݇wiF0JvHgba8pKH+u݉zf|92Y, q(@_H76 ̯ udz?u^멸S 6&^IwNxFOqXk/L/>iV^,EWanW+ôn7X("`?`za~&T \h1 Xd; /QZoBmM,ta5<6۞<;O/jYvHTKJgfb^B@TyU_@(R:6ZУeNZ cCKA$9Ü]=W5hGl̢k7eD֠W F}b?rGIW#\],A AF`;]! 9RkD~0 h{-p< =WZZY25yxjӄb}F9Js\-=$ɉ`|8^RX,qyP 05b` qm}x#<e"4CX]$m:M9I=AaΗCC} =㼱Wku:)Qv8<n}@`~_{U_S5{k2}x?2eƇ/ dts=L#e'NyNT) ' pzCߟW Qh$1(݁8oVefDw`:t< 2v"U$H鯛5HYGL8|47~,MtQF"dlv'Fׄ{!&$=ʬ?91,X٘":t5gY_Ϳ]|4:!40/5ٷuZGo6GֿXY%3#"up%Ow>I,e2wџ2פ^kbUt\u㚬DbܣƌB:?5y2> $i`3ӕA4;鈫ЋcL^J ,ؼrؒ!mFk.9u$\zȥ[]E+i{OH8mJa޾%r}aC7^\QKX{WYe(.afR;lnT`.ﯯBƙKJiջٺs*cv5ŠnM!ݣcK_S䣧ةAckR^*fvCe>t+=}KٖL=2x.p7Q}]I "1]j vNsح!=c!Bb73h7k64+y Ishni$H'vv\u I*)}b}!|V}sLUcָy`-.8$ѵ50I4B Ie^9 I{k +;E[jZt*n![QkC7ֹxIDC}r8B+َąeCe'p7Ouk{W{JM7mZX1. 8ne~_!hh<G4yyξdEY^kwL;KU񸹕>@ۉq~l!}'(H%#ͥ@DB6m֌kT5Tv5h q$au8>fJ _&Xsy-A$!'[4w,j{vjK4 *R#L@o-pu\l}@}S6bV+sFxI<`6#XWj}ww[QnC{sdvZN8O둱gZ(fr9 'T{_(jDFW-6iKW'ReG : >Nh+ћ#Q39 5By[iZͳYWmV0 %qmf8-,U*'P5'61 ġbGɋ#|- v 4iYqt;uJN;cZӓ2z2P.&BD;JF /kԪm*h$asʀLj46 fuC]VNH^쐸-Q :EAvnD[U[ $?9ST.䁨f2ˁ/se6`#N*c GPT L@%iVB*>x>Kw6_-2xT?5qTzF2VTWtΊd* OH-$~}ɼݭdc$Þ`Iv]6~ 9"g!;G0eـG\kW$$=y9b,4!Є#BB4!Є#BB4!Є#BֿhBF!hBF!hBF!*?.{54uE 'Nv4F;G\=#Q^6ZfCIӖ:K0g7GЀ M;U 2.L$vUnF;$nG ($Ω,jtW4R'Ū3q!)P"r@0cH0ĉҵG4'ԡS4h6Lss8K}<=8喻y5ۺ 9HD` 8@QZɽ\mրֵkAsqze~ǿ6+BJՄlϲ+NbK :TTPGpnNi%j:0x^68YT!6;4,\VvVմUH;'\I+bÒd{]pV:̛G#ʄƳ 5t{K-=Ʊ˞/׵qpJ峓jՁV*REL1I+l,m}8_a=ׅDU^VX"(BէN`x kKc5C2>MZ2HXQ{z[v>Ừ,oBŦ !"r=ܚYʲ#׏bDIP}pݟmJŅ*]"jKq$ oRIz;לSC'ڭ# $NIժ"D=Iϔs?#Qط2MSZܽX_Ug;0y]FNَy{7%ێa6>+gٽJ5*Uꎢ[N9Ay$`.- )F6{$eV' &ퟲu}tKWT SKZ2pn|J9/ے[f@y׌(t1 nu`/{AcWndiӊ\FD18ǃXd"YbW,1M[E/0<Γsq蕦>={٫Y><[1ů=Q9vHCAq}SrJ_ pg RAt HЖqEg "mf-lj}eC>'-vl۲UCA"@$ qK}b~fSr602MHĮ2O5(w;MB?N)q?|"GW]RItqbp3$%<cIspeOuJ_Q.%I%yUi9y;7ݡQ܀y;69ڛb\ο<BLVqSHVԸb5όc!Sj>ؑ_<+=_,6O'_1Zi)Y8HKT*l'}/=ug,9XrJ6nX('Xjr!6m~}mz?.aa!^$rTFZNԭݍMԞZ} ~r9,Wtkd+eĮ_feDeﯠLӨK '}ƟsX6Z 6#À﨎K)<2#gpuF7?^`!̧`$g}oBuARK;Ѹw<rv9$ռKj6"ec} 2cȥ&6c]iϸv].h Ҩ`gۘ&q9Yam%2c;,l 8@{XL^:R:K=I g5,gu-]nJGV&-ﶗ#+=N;װ% KWnֆD\Flm%&d)S\,%r;f;;٤XsAm pvp_Lh\]^Ϣ79-f4p We>?=54+GL",)'i 4]{kKNx_pBӴ^v?δjiuxsPM:<8exQcälߋnUD(RVA6e' y;G_)0\R֗5kL=m@|ﯦ CH*U]ͣp1ՃwѩDHkC iliO)¬4v݄$|ey959̊~0KsO ;-1QuF~U)5> 4)v ]MvZbc[Yf7)8Ȟ{+0`:յ=:5/tmkH$DGеmaDeurh4klVJ.*sT-C] l>^%q 'LS4hBF!hBF!hBF!׿hBF!hBF!hBF!|K'П\lT4s/83USj)cX吡NTs$+&oTuJ'cG3#[׷+c's$`AS]uuۑ-p" uFǣG~fh(f)_xTD]VJkS094`9W!֘!i8MB*i|oU>0m_+S-=ujEmZ9妱~t85,. |l0vM xviD,a nv 1v7;\KZӫ5:HH8+]J1֖GZ)3Gn*Fck> $i}ՎI棛sw,n Oxsڧ<;eEZ'fW8GbÌcfcҁ}]KIlmj8ը1 UK2wU;֎z%?&e7+3c6k;Z3Ͼ@ d ut2B9:LJhq Zvj ^$` *!V*H}}hO;7jU i|:jP` ䷎ עP8g4_$,G}FG$>'OPS`%@IJ~kY}\m61-&LKmJ[. X1 !`鍽H $ Ϛf׹u-Ab`xK+>S}JP!ōy.  jKsSf)$-"L}lZv+ZO=V_h }WsOˆ5gK!fce&h!{1`7S{$WSYK)4]Q7$y5v|OG3UIZy+X~ݤ)jo\oZM a}c֥GA$Xb]zg1U^d+]OOjY:Er@2w._B G <.mu]yUuwz{L{ߒcb>iL'3J㚭\ˊKWG˳u+VZnn05!}Ãmط:J1 ד];*r|jI;02X@mWӵ+nMlĀbOx]O/_X0C4iH/Imo1r0Gұ5 J`>пbu֊[Y.d' Mr6uj.#֛wBH&"e,;O ۝W߾Wylibĭn;+$хT8D5x]Y~IۊH-,[F6G)ZvcЯ̸דw!dQ}F2Rnk2 Z[/^4.Ċ%+bv$ORh.b'3IWMJ9ؒL# +W%fGUo:͎-焍v5+gVGJ{Lմr?4x.7i ,ek'I$Sr$O^Z;F+NjsEV$yGz(Y/7ff!%(mcβh̤p{ F ʅD98tac6D[-a.dʻwܟ:@l{]ڻ{O s@-DOKbo{vzpu?O:f.sv5COCdauCC\O7v9,(MyB :gkߥtYQ櫟YSlA i.6L1+6SkR}(T/ 8%N6ؽNu\[%lF{T07f={o.`/\yܗ? 2z"vf2W#Z:e($=餧b&X$kS:`}N]=uK*0T.Oas7<X =[!+[`AVS4Cꐠ!v'e`w#_Ԭ^ڭp~@Qu)?yyE:r08/k$^GnK)WULU恴ҩ-807X7Qҝ=k5I'd:y: ybYYcRYR f'WKZtu$q焕>^TJ`{KHtڟc5zvp$TmGT ̑Lol$UWC!m;VѤL `FG$$i;nqa8ȐA%?XagHcC`>e/gZ]V 7i5C\H;A3+d&ò>5l'yðFF-<[uaΥ\ThsXH<@%B2rM'Z/+2{[M5 d T :M #sYmznvOo^ߦkL <p W%#xqAicvy,βU9<`G+k ; W}Gvyve6ٌ.zczZg(zZB}oB'Tm:vT%4A%5u/љ RMI ; %w=}bVW͗g-)zCR e2F翫)0] M-1g@9>6v:|x1='Rݏō*?kCd60O- ZR4,zo&d,#{eh9"+̀Ae<>280H[ &꾭LLSA*h:Mȫqu⸬ a @l8ci[_^)AG*6&ͮTS0Xg 2"s厣6ÃɫS$:G8O]KvkILPwH/qh|"ʹtjFfTqN\۷NK lֆ5erg'¬x#>BP{."8~pԘᣒ,95*d^n<٥ZSweԭoQB7rw:N0v^C&l4x1H vI7x:~ `U7ңkvs֙080.~?.%f슿8,<@PB6/%+6c펿ڍJ5njlc02L|ӦܝzO9jb+U+!M6Y'pY/4mJ7_+律cw|ꗍP tV<W0Jr~9eOD{k.sx:Wk1`eH]%Waĕ]_:-++nCDYM>)4:#su}?%w˛$e9='ĬI/P|NȹTVI?} kzһ&>JVLL2~6fO%fo \^Uoޠ]bc)KhZִZQ2e~Otd5lv#zC3no{Yx𙀾QVeLO<zcx.G 4nB:<.ykR{[_'I.8,֕nĜVN,uћXXre h);9?od䑨H)=3OQƍů"0;$O|MpBJЇK~5[þ~]e<4atqZ{sR[alz7s$GCݵu7vX<;*e|!~a1YT#jԕ`ىweeC6Z s]YשkM<% rS-UX:? hC#A#<0Jpiv7O@E|5^0Fs9Nne^8$kXALS,b{ƌ OiZme_ngmRFI_2F=DXc!bhl&F<,>*KmeaW@qqwgsL~ f}fvʾE=RBGE6jԒR$y<@Sz^œK .Ӻ̧c~5XXZŤA"@Zkw.%#l|<>?FJA;p9zpo4hW?ak+;^aĿfqXվZy|ED^U&Tn"7 ᄒ_> NxK`#DyJsimEKZ>2LXz]sP y`T4ҷ,tycFNA5ǧht&kIҬ #KM%r7Qc.uS^憌|K>)Iǐl+!^C0׾@ qa{;-Mo :~l.KAV=:½Gb3[9Rj}hMՍ5 Ms;$c daLXWZkF*GxÌ@ <1{mWn m:NѡNaI8I'I$2e6^WKI2gz@B5F!hBF!hBF!hBF!ѿhBF!hBF!hBF!hBF!hBYe}o-_=On}{>?W vl'1ĥ۸vvLby!p߄ im'NlOv"n|jep!|6X~i,q9䰴x&:5|5"!EnҤo† V+Vi1GXX aLq-I+G/uUZ]}?]ybfa1]D xwV=yAm&9y:@H;9.“v:Ի ڇ;Rҭ pDwM$kS4r<.#kLeZ[Jz;1#vm{X#PҴCd8sr'}^QU<ր!hZLJ泫jn5*82` H5kcoQy[a6O*oߧVoCH$Zr,4QV T{l>%$e/ pRh  > z[ql3X(fyJ~R1o#k㤔yqs]Ω< 4tp+=s%O$c63uݜ#ZGΛw.#_riꮎ+ |inB*WGӪn9yDryNO;KZz*^0mevKFKw##Iv} r{)U^.c3׼f>0c-k)oJ_z[SlDzKU: ޡzfYaT؏sV*A #KѭR@ AÁ R3 ~U0> -M(xܖߟ 2l(S7`B;eBLkZ݀_jEhYҩn% \KkyoӭulPFʎo@m^ˆ $(""Xi"݉d J6${:RnkL3]:eg"֓cΈEFU{SIH,1eyPmN LY1ċ ϏFbTs>>@|}_iNjSv֣1޷ץN}W=' )Ψ9[ sdzn\<M._٪}deBZg=WI4_SY 5( NQ7:Ye'npl$0%rEmRu^Njn۬m}HtXwG/~I x~S/U뙹<,/ۙ#LJ=>_YN %>{ (w p-Wپ9@ sg\HepSYkMWep7]xC)9–vmWQn ֵ5 =|Gnp<^#&+C'bK֤id*rde$pK 6:H Dŕ- hv @r;4d2Ӗrx t3f3͜'6̳xSpɳ+C*>YY$KZF8`!vAnwVz]-2av89. }ΦQ.j;p ֮㑈c)=5IN杨ˑK7\~ Q=Fզ+X"DQRb%`Oҋ[8a;Kg3 EQ3&ENI03˷F!nݚٖs4?;`q%{; u)ٺ?7ń$J(42!1@/f=ܺvyn4u ,U4}:U`kCXh$?7U[]v6;In ꁾ0nH3o/k{:|QEq{i |L_`ɲ횂cN'uG\9q{eU`T73Ct%qkzGeFXS>=CdXL#:-=!Go40C)G,]JlMrVP#3I$IO{M{.ˏ$ $ 8rc\5kW$\I92y08M$hBF!hBF!hBF!hBF!hBF!ӿhBF!hBF!hBF!hBF!hBF!hBF!|p~HGb-CO!׶?3s~a#%6*eV (,uz.HQ  |32y2{-73  Osfm1i->a|TJ,c-R>]NH}%wxgP }O'O4j];"n;8 ψ`K.8g>ݚ꿋4E9l {<RO.dԍ*O꺯lddB*oXqu i}';InKk;b^㻏v֒E=ڍ;~jusiVXTYS $s; EL'PUɫ  n ܺ3:QYV˛~^JM 40ψu Ys+o%=<1oŘ fG#>M2X T sp)>UŊOSQ"by!Bw=fΰ 5\6MJomF#+:6zS#kL12l1YRtw`+]AU !D<mdRIԥt9?sԲk?V#}=pzק`/#f>A('۬tF1U[f!,[K;旆nD7 e:=FBe{/vUD$s/p BL( 3D #[sFLLacr a9fX{ w Al5S gecox 9u!٭"C_U}XXsݐ7U.knEJ]CHtSN.>s'ýgZF ܞ~A笘2jӻ]۫Oki2E64cA19^2u^rF>pc vjHH&xnCDJ)faD}WxkZ{HP`;DVbUHmԶA#ܲ. rEɗ2ΌO&ݤQ\N֠z06;dc6>&i4stZeRUC%\d1ΕۋI=yۉ$#(bi*k0 Hm|$ 6ZGk n~D@ĿW?~Z1qsKIsw@`Qm6y C~aϑ.ZGKĘlL+9celJ<5{DQ)CQt/Ly1=WVd.ȁBXΞwcBNj-h/sǒ w!aMGsZ |SLA~e =EVXt wQ{{j3\0$XG~L]AR~w'y'G ,%;mǰo>>Mk$;tBjBԅ!cQM9UIcqH ~|}tEfkq#h@n;m}wc*FGPqNA4LQ{ WE^뮷TɑKJ]";mJw7_axTҕ|>AmػAv7Nٽ;m7D5ox̷;s t?S]K/l4nmC>I}ΐOp5NEu몏Z.s_3WͥZ]+g%~)_6nd~3ĿF>mdrRm fcP7hvӁ-'Z+#3'Ž&8%YӶ#P"2zhO:Yg>^Ev̝cGڝeK4BQ]zξlo#_-ZוJq$輞/GuP&Z9y{tfR6;no7񠰎WwbOPjVnKI]/Ꞽ7!"Yh}Agپ~r%xpblc0xҔijRuWJmg^jLaZR,4Q`4 5yg&sHmT$RdUU, Ul\yv9_WUćӚp\MCN<;]䃰Ay/WM8_9mrM4w~I#w&%*=βPSoOʕ/|[l[?z[R-,xFɪQݮs:Ӧ(~VcҦ*(I)woE(Xq<mU NN9_:BP?rK >;Qvp =;YdA{nk'mdTN$e & 2H:*98݂m4bѡF!hBF!hBF!hBF!hBF!hBF!hBF!տhBF!hBF!hBF!hBF!hBF!hBF!q}{~JT^`i#C!-!V~4\t^=+P5J[܇6 Ødt%e^.7S]r֣\SmA5F$n9HvC6եK~Xi-#f><]w`5iթqoVox/-kh8{\90À_) UGgx'+iҸn`ܮ zoCFH1Št|=ѴcVzmE5V1;@t_:n๟gsG BZ nM xtXlDvZ=jmC,tR[/k@ H__RKtݬPs)1O$l@i|A-WƇhEﭫ^I0ohpl` 9 VögEW{Pƴ: x5^Aنg  Wә>|0֥[=Yr ~{NǏJOYA[FQuWRmըTu Ծ6M`"BIsL?ogwhli.4\jQ 8tXtoTg ~Cz>f^*WrƬ};kx׶gsyt]vWWRB7quJx32 |la]?fQ=Eѵbș#RYa"b@Wqzld9䆉#yϒO:ZmxR}J :Uy 2+[:I7>%٬%Ję&A9A^BLFڻ7N׸-Z9#G2SZOc{Mj$=b1pG=E `f^Q߸=]Hh%iӿz*NE6C3Q+]"5k+i]d$Dxi pdDDuLljX:i 0~uB[Z !aĦz|e<&EזHSYǑᆰkr i^NJ~{sw(d&u)Q]>ж>W[ZSXd3Y.I$bؑG_ŗ,RIey]٤t؟,I3ι6=fHcƸ$ւORel]oOPwswHk\@W%x&GϕIF$ѡF!hBF!hBF!hBF!hBF!hBF!hB_ֿhBF!hBF!hBF!hBF!hBF!hBF!d=]z4扩;ȒF&c&H AY),SZ 3>x 9ㄥtP94Ff`˽0[)`)y'b+\F*(UHoK1?~ciJ`I.2a6# ZLJx bFܞ;5 s x$@Rm&i4<|N>u1_G9ܨ!^eYiV7sDcrC&)aoԢ  2r1TC2,H"N0:+h#=JpMD/a C5՜!*U }hs?Hr9KWmj.4?pG8# :QM8 8Q!ຖտ m{o2O A8P*:#VU dR1. $4ݱ5ڎUkwU֒.TaC'įTvIӫ=/veNcSѸ]-|;7[($4۝-]+UR0>;ˤZL~u#JZSPGcwT;}J3$юbSSVEcmbuu|BBbIVHb@K{kwtY9wo$ɂbж $:RNͬ8WRil%>(}N;jSt_KbL O;%^~+>YOMu06W+O%?P@I۞K»$/-N~qJc-Yc_8F}k=8d %cs'࿕t:7#2bi{v5M#yvx_ PQ,._I/**نu]\*h\]!|"4[nXiju7rJC8+ڐ_mJm7M*Yk1x2":oLs#&S eKZN0WyZGN KSiZSuz톆 $\%49;*8sѭzԜ.Sm)uj~itp˂I'tX\&]{ʔT:6,oTuus')G]6 %hH7p)I?MZ] kD1 ;v6 %Βa{S G;2 I!y~+_j}+F=w㸙9]3 R ѭ*4H+ׁ85 Ɗ`;wB썭a^S#^jjk%G_ZH :ü0x"7Ǫz&^޴6B)֦iS,@befrAv 6V Hih\df5Cb[-% ۷YU֐:g?}iMhBF!hBF!hBF!hBF!hBF!hBF!׿hBF!hBF!hBF!hBF!hBF!hBF!`]1C1bBTJz(Ec pԁS *97b[rZhmQߏ¼<;h=@%==kw޾ހ=)kI3 8zrc)YGjRI*OfEy BļM:`;DAwA& y^cJy\ڤ%.4l·]Waԟ2DC$$tk[{C K.` ըiRLc&0:_ GtUdWie7gvb 7B!efj[I$$``pۮkL`z~dqqޗH/Є,I^뮛5&W 댣CI5wy{ U*nL,niqqgY,Z4I&Ec+ڎ^Z6 jIq{A!k8#[l)$RB0II5BBw']}%|\ -*8 s[ Lwx]-k1wnǕ}~GHzQS[NԦ{ۂ ?S\~.EvgG];8R\7]k1V\[/ԠH x?i]-/ ,{7qHwɼl$dpU,Hշyaܐ&t pyO4ェZ"$ddgTU|!.,eW&b9ݙ#I׺m6궭To@ "0ղF F3uJ' LrckY+Lr[,m;R/}gp2i tcŕ| F,.>{9/Cv̤ܗ\gґY4mڕ>mcc ' ӄ|F!hBF!hBF!hBF!hBF!hBF!hBF!пhBF!hBF!hBF!hBF!hBF!hB\^jJe1"W5|L*/lERlqT m]HGgI&=TlcH y_θr,Q$^ @4eEw_ɊRY۾zط#C7PHݙHП/R_#|->KS5槕% hXvUYf>D" .^%6xY|B錼*2R2¨@!o:2Жf5/߆E4˄i (˿2lq_{$ͽ8/s|@ y_~t' w.>$qۉYO{WϽ?Z¦YL|hY/Q|>jL|J^Z;"H7" ɐoͯoPԠ|.S:7hpٶ# PFgXZ\bUnJ2=iC'#}l<$KB۰7i"Q |CZCwsT~ q7(WVٮad5pgc< ⛠Ezwx#5 ;;7bbNzFZKp6̙ Ou{EVCipDøD;L&OU#BBNO1Ӗ-Q_;,P`K)2lN,4PVFb ,'2 Jxj Wk^K`H"q2"l@p`d'= KF[ۆB}o$}9L!Sp9fqkf1HԑɂVvyIHSYS2G= KLdB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BBѿhBF!hBF!hBF!hBF!hBF!hB\7SJH1$UFG2m3~ R4\Iߐێ^\m x>?B{BqCX;.Wz+xc&EQȝ:hZ6ʖoc46Jύ w OD 9 mwV6&y8 g#'޶󏂉Ij$HˈiJ1 S) 4!Є#BB:禡3 1;-Ld8؝cG1Uۙ1:Js? ~=S=v bI}t̩iF꫅:TT2vkH;`n~IyG[]"ѯow ]wMYf%j*约`C[$یs< 9g%$rcjTHՐ 0vH>ʃﯛa}O m EWc>uU:uenM4Tpij.$3üwkVR)YDbW@C17I}j/k :d'Y/DUڻ[s+Ge2b b:PS jJX׭puͅ#UJ0{o&0819NNm~&n|.JHFr@HirӦvW{{pG]Ylآ\^u-Y!O? n7ξaݰ߹)>+`W9,g$mYH2vy-!PAO|2`zG\Zt+b{8ׂrv^i`Ҥ>,*'=ջZ<׹ntiTV-I yE,JГ MJO.Mrc'S=Zҳk4  O^OcNvK[m7;5[>i?p,A#J X/]#讚Xp?_뉟+n$Hَ('eU]CLөX 4&I$8I'3+FGyI'+Ϛίw.]Wq.q]f&I4!Є,}9b7#slZRNSP7ZC䁰>wk@7p&0A]~-F+RMXb<Ϥ4h<?T^_ >2tۗTt/Ɖ8y!'39lfO/ߴQbh~o*_J+!}hVB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BBӿhBF!hBF!hBF!hBF!hBF!hB\ 4XYyVHcw,!wnj2̭{R*6:$Z@J2I* p/ZKȤ15x3Za{NAs9O[g=v=\Ԇjm惘Kiy; ll}jZd8}H%AE " }d|f%QS=R]L1h|9$+ ~0|FUI`Ca#\ԫZwLoexL&(1ӵ 뵘A-\h0ad ]t冧zH'|N-y {ٮkX9Ըa{` xx+|c5qܽ"&M<.̎۶ܶڞp~Q"3>(W߶nkQk*֚ClOurLcÏ" oSrvi#'tY ]):EB'\GкwI|a,1ַu#vܐ>}|%VPj;D#9=:,A)jt%٠s2es1d*ғH">;g~^j^i^fhhﶾx|whRUiʏ&:O\_ydD'B VKbI6UoѠB szE2]>es]q;z_ YBIShFv5 M Y#]JWLL`P纛 ,[Lu_3KV1io>@Bn9[ww5kvI##&2]ɕ>Ŗ͖ò}vYEa8ဳ§&jժھ{M64#v@q $ )-cZĖf$ vZW")\ u&F#*J-hB\G|q^r%)iHS-Zr9-Pș{-ggE=3(eN|@mX+OGJ:$Sڋ"үBFl:<=TkAG?78]&4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4! ԿhBF!hBF!hBF!hBF!hBF!hBY5<Xks/ZhX2eu.G:F3HHy~ :p[w,&K3#fa_/fNh#7FHpvefwwun.%pSԩ.T7h൰^ r\ [,+kv Zj2Luʎ5v:z=?txIifO9rVGNښkNƨm-GLqתյMrXd;d/hvSګk mhsCik!$0&W#%[ FbJ5*T:"|lZ7chvwvt^ئh{::`C@{GDm!us'6/18?:ڽ&W{sC$a,O5>B}ta-/C+Ylv~K<vps^+Mn:[ ~c kJ@kB>NuA&N(vl.{`46;ǴGx 8fNfkC^cW0E}h!@'b~fXI.ɿQҨhUo|yND_ ZIbv喴{3eʰR[}?a}m=vO[s)Tswk۸TcZ->h> We:'|ԓB^敤v2#_\a6TzMyh׶9x{|gYu5:͛6تPIl;rk>kkEoދ@ gk];w8dJgV2x!55Y"@aB#I9f~Ȫt>3)"[B:g،`-L)Uςmc}qeQ)صN̒1N_VnxL>i,5Ž;.OebL-Ej 39ru}¾Wc=}W]}M%I$2y{*졕6ooz'~rNw0*(f)%o_CZ n*8Dp .>dZg_ƀtgQtr_F!hBF!hBF!hBF!hBF!hBF!hB_տhBF!hBF!hBF!hBF!hBF!hBYr{% +pHF*@ îY)GL#_N64+6K#i&YkwG-+"}O./u`5'a+1l+QrHrI0l>NFj4_^*})42gnj&I# m8Zٺs$y8!+Bi9 tǟS{NÙ2Om_(9-$їZ%x1@|;fvLnApӜ?Zյn[E:;d?OZn}SV0Q X\qݙ :%g*- {8>}u#U܂ 15g+2MjצtS/c<-7|nysQcB%#mom`^4'k}ie-.U5Qsq$5G f\QT}EMv4fE Rxwg_ [Z++ju]Zm,E2`pk:Drgkf/ 2lBXn$v{k0{% KKjvm*ȩnӴ`L`񂞟f\v.f/'$NebHsW}T)+~_@Qz]j,ϯgT8uhUr\%t ̭P.D3IHIS$c\BU +zuB$x0ƒd-ߧ:P=nrԉ_j+V LX>|}IN)դ2 ӵkvu;;I2 I:ahqӡC xT3[o|ݠ 8?0/xzT1 OG{|}AY_P› y{[_JT1s2P_بm m@`+*ݜkBZ'_̼})X䧒3f`}|VNi'dI_uU1!g`ƨֆIJUG C(m񾾵T0tu8I0IjkY,\MK#^ Jf~{FSnNVOZXСǸ}PorO\pp+PჍGx'n{F1}"s'$p]Z0}J_EG67qT0ꏊuZvȀxTg_덣BB4!Є,B#s QAb Ll>'_ZZw|gX>|F]Yz|SjVlI/,eUJZH^;֦ ,+ʎx`G7-Ͼ>.=x.% #o({4N2Z$ʥbG1?:1IBB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BֿhBF!hBF!hBF!hBF!hBF!hB\V_Gyi&}7z>U2qp6 ܹzw!bBKkZ yXOQ_W/ĝ_zZ$)j_ fZ94y4ViSS @ޭ$I-uenUֻXtpnАؙƱNڸ]$9u7U@$d;k2ʘ(䛍;J%9dn[`0&Aƒ)$3 wm.q0H;}\۶CP4 բ@|C]RG_9b c#MspxƐFX;mYP"RfaJkێK-S#Zڛj\l&>/tA2 ;{׎2Z]ogHRL p !D.IYIB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4! ׿hBF!hBF!hBF!hBF!hBF!hB_ZkXvVۉ IH :0! 6#XԦʌ-pDr ΕWx{ A#B0=rbt*Hy]`VyP S=I$I''S. wK ̞&Wӄ ;|5:ZRds#׳6*H.ʨmEbfE^*㲒P+30^}9 Fy"G1 vBm t| Ȝ.Ulh fr2-qPN·Yg"Ec73؃EٱcxTn\rۭ2i%3D00$O^rkB)Dh򌿑'?V۝sMYW42c=Hiq _4? :X1Gy5&0%w>7,I>I'Κ즍FXf@qԒ 'ԙ'$㴚gήH I:$.5p }޾F#,ca?.K@*bԈ7(W^!]dU͛C;d.2If$6u 3R{yLOxѵ'KA9 dW-Uq*d &Hqu=Roo:_rGtoQ!7r6(e $)"wj醣k;qkj4KF)H<L}c/-Kef47qcpLz29:Egy٭@i7 :lT{[Fi#n <:j͌od%`I ; jIx$T>.328w>Y(6^nm%vT<>#~uV$8U óλqM)Eh}v3UV qm:,|%L lҸ]9"a!V%N߲qLtNZkmvN3k< ڼƇ8}+b[%2??0qܱ%|.侶~$]uV{yo`#>aq'|J|`AVTtFVE-F61B} }D}+LnJZd繌h~ Ib鯉^Ym`rC'1!}kv)`ë;?R##bLա@Ȋ<HP6$Wʼ@CejbX~!O:$ʊ׿ 9(@}~7fz!`Q51VQ5ޗ No>Zt>Pw'vFK79c*`itzG{XFd3g`W/rSEFOM:٨]l0rhp[ m#z-Ιfg7OA$B9*>{}RxO1P݀LେJnu$ւB4!Є/f{S^;U-F9#pUсH$FkQ A*2pBs_)y䱭Z@3*@)H,bvQ#t= @[;ɉq$Jk铘Io'9#$}p &$Ɍ@5(SthBF!hBF!hBF!hBF!hBF!hBF!hB_пhBF!hBF!hBF!hBF!hBF!hBF!hBF!hB?:_!=WH^n[iv%$SʐYK=WK[U$ui4Џ2 敪;^Dr4RMFBʬ2AA$)&|8_Gjٺ=K'>aD +ڐ)%QhXXVVlVQ-C'::A1=,Yݙ"KsݗCI zǜ^QҬ-=(V;)9'FQ:v YwC%ɓeqQz- Z(I§c mJ!f׬Jɞ|KG\FV3M4ڴD#믹# sTAkL@ s5=C*Jl*EhGʿv[+oO_|_ϸOuǵժb[ h gBxXI(]z'ݯ<_Zx :eWLsÚ1˄5*K[`._U_3u]G4:*)`vZ8 -'._iH=xzyy|Ot/f=CVīfmJPVfX]QR[}Nƶқ4 t=g )~~*IK/4zAIdH7WDm蹏̍32Qd< pMQ[Xo#ip8i+W6#;]nHF:ޝ4J歎M$Sefc7CDMu:G )`IS$k0c_2moDP,9y ]G2q9i #oN7%*!O3uCMo |@蹇o=-Oj!GG)I01 x_CG/.ݦN<6۵TX$_Rpa _?l ?~#jVWpI{,#MlmB~n~j0`rdLO+C֕=# ɍ:ͱc;n@;i*糴EFYass>M|VtZP:dүe.0&x\FT~t膵|/{ϒ6^XH/#i';f|:ַjlwOU&s%t:8w ]ֵEAѮp;N╱N:N>9=% ڇOkpkYNNpk &:y[碫|;Fս&N<4R*,m4$8wI[JhzPӬGyq8Թ>\`tO+bu? W`h407L4IfskS~ֺpQyE.v~hЄ#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4! ҿhBF!hBF!hBF!hBF!hBF!hBF!hBF!hBF!MO£"ŚL><<iHYjeǪ L!FwFpK*ѯ*!c^]2y}h32HֲBw8sZ-$2Hwi[7SY+QnCaan"=A1J?(7I"Y ]8F;vԆӪWk tPzw+ӧRTyR u3=;Y\DBѿ5GQ6C,S b"P7AY΄-~u_8 l< #=%~ _0uba%O]o>c>Kp',.ޕ<C+gjgr$IYHƎn[H8U|cL*K]A8*OM^5R+\J?Nn}NCv1;:D=.lhiC dn0GmhCCݟ>:ZȆS^IHy>^k,l_=nenfIR2BkK"ŴAHQK/}Jc7U"6o y{rh&[_Sռx"8XKKn\Ⴢ9>?چZsfR]w2JGVq80٭z\=hBF!hBF!hBF!hBF!hBF!hBF!hBF!hBF!ӿhBF!hBF!hBF!hBF!hBF!hBF!hBF!hBF!c~A_RA{2!;7܂(oyA s#sٝ:#L '65e`M7D$rq1%m^v+u*@Ǵ Y@% HOu&C:g/YY5ӗe/bHqG-IbvՅ#Q$`PwZk\s$8xi۹8[go;mnV5mn|Tnce3' 3ՖR.B*L2 rI8_mdtr Hu> Bڽ q`z?+jIg8Cb$EV%YGq@A} ,O|m v6]Ĵ85 CA85[d5exUX/XH?|N l/edd-? i8|8|F7yUy w!Y)b .^ uH5]Al_>&և-ιX_r,ejfRM{)Tiy$!}s z@߲gҠ 'cvqQM=d-`Qkp~<tUu=b;F$Y[n#RTFRy 7:I-(Z[.w"\9 Bcַlm.N^]Q2,c\`S(Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є/ԿhBF!hBF!hBF!hBF!hBF!hBF!hBF!hBF!|az;,W1u-!XC K#Yۖ㊎|e^ƻ궕;qp18pS)յ6vk1s2G;/Yʴ_Ѫ7SpsH#0Ϗ])&>;lW_n#/ G 3El_M7qӺΠ\^MqȩǔnMn;'Sp;[8qn`nHI1=}NV(WjCD2MZ{EZ,{f>egK:T[Nk&լ:Bs@l"w CWiKNN N G솫p?e!G=B5PGdl\r6ss\}nj<~P~ٮf׽-yQ%$8}yuLPk= #Dk4k굀H J֪~M'h pi`TgtoU`0yΪ\Ng }XC1xa~jY^!V1rҨ*XZKLAST;TJl"dy_]Y\_:j8Ó;37ei]( ~/).s^BJ(a>+BfzC\;Ǎ$5ϼR64t!CÉp;#õ.p''{MٿOѪ<YyE0FIs-O+#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB4!Є#BB endstream endobj 237 0 obj <>/Filter/FlateDecode/Height 432/Intent/RelativeColorimetric/Length 5438/Name/X/Subtype/Image/Type/XObject/Width 594>>stream H/XH4D#L&DL$d2l&f2L6d39:seog͚)wEB1_`&47<מ<]k/-$[,ݰ3-o2Zػcڎ.͸~+08Ҳ6}oDt0]n  q^4kƷCFբVw_/q'-Kh_o%:g؎ZK~VonX,=wT#40<|˴NUm?mӛs[U+N.gL/lSi?./niW{**0YU`.w[z:++"p ݖFNpd3 J}~N k%mtOبVa s7l*Ry A{ƪ }d^_f;w5h 1ky0,:b9nDͤfYvi'I4㸕$rrdt,AGSmh*C^۝blY])DJ?6:̐ACs 5\pz[Tq3#a&saSbK,:|R}jj s2u *;-euHNvkޜ2,'^4X7-%R ƥWrxcT%zE*W\lP8&QFqAM)a,MERT,ER? JՓTR z}ΗY z4R҄(˹T=)rzQ-X,ZPz*RZQ]TkEg"A3:ߠjsLoQ}Dz[D8wQ6zRzRWR=)/8/ԗEOCe!8?E%YHg_{s,(('!= O$^tq7AArc6&_E1H_E x, A!H'b }Q}  #V斃R' (K^>zҋ9DO@z1& H/b¢H.1@O@z G H/)zҋ' lLG Eb=iEzBE23NZB3N!zGf!bxS6v֡(=ic, s&wQzD_uѓSQ|"!"y48+J4ӐRK =)-'"]%5z&RԸ(J8L^kA DE׸t3L=)^OL (aE=#)Wޑ\$U +*S+/gP{5T}iIMRO%ɤݓ=BL})zl?0fkA퓊[T5AUJ՛z 35"`Rt -(!b.Tmi=1)'9(@ChԢ1z! ]A 2Jz';Z"YDP#BPQb)6W_ސJeXWGHYFA12($F/JHio^P^P^%TYbQ"DKs J#TUjQBx荩XAA1)͕KT @P^()Ǥ%"T((U@oN`E ѫS! XQ5T.(@/OppAzyo t ۓt+䗞I!4(BOآ\6(/@rb>ɴ@$FY_+4wށЗ )6!Gw!}z< ]2r> `VCsZC^}#o{ɣ>հѱä5ѥe%[QBL*nI{Ţ*nic.Z==D}3C>݁%8^>ݶA ltSK-+Kj-1Ї2Ƌ5)7ǣ+to02@շ/kFGij:?*/!.MB>c.}omcG\}s  Tq>{Df?S)pH@I;2/k@(X1T(zҺҔ{I5}}{;~uJYV}5V\LĮ뵤_+WDIڒ)|y+0m۲*j?F%ԹɅB@OnarKdqOF@1/-"qln]DhqW [uE N@+bD9s"]' Ȇ[Q\J!]* D[aܥBE]+ @[ Fp["ÆX )yX5nIs fB]Vy܎qVDb !+9r".ȢռaE:w@{ޡ:Wt^/[58c: ɦcfR8HL7oנTv|~U, axV!OρgLUjZu/t 302jSi^Zo!*Ƒg)JjMkn`3DLX䁍 * zK>CU2ݘر S 꺀,R;K PT\(Ø'6{{LX*IMꫪ(fzRyv4`wލ^du$fVVuVbT'n+((LmRnt!m! fmr¨962࢙}^X]PYx 7ed$oQޔwe-N8'5wG4fηJHIN nInT#sABCS@۩@ eΜ/鶗nՓԨcM *){>'ajHm[(El2g>'2(~@Xb|Sz>LAutm:wORXȺ=xgG5Zfyc!Rk*3+ڞԨϜf,\n@Ɩ .6o=1&ޤD4QҞNGS}.`m$Fr'b+jE[ԖuʝЁQcG;{:ӱu4.rzCMh=J9Qӈ4,u]VnT.4iܱġj?]9PC?+)Caf"$iyE7UcF2ܚS%t$Z(Hу}E2Q1 G:$4&4cuSFfQzK 5Jl2`Δ!42rr 5!8c7%tAU>Xd?ĨV(P /_6x:^g?g3儂$uT4sWCR׷Q2V 9- rϯ̽YE'e*x3BUf?_ 1>Ph`T[I]@Q&ϖLNHMzj(gj?UF/I7֋8wWыp҃@Qaq@_{Bܨn j6?w0=z!F+5TWPןo k`#t=(,(}G/č^A'Epi_?|rd.+H1"=g + (H5FWN"3JUY@aFm%~uVUPGoןG<.HivԮ?dF4j,0܌rS] WQmUeEuアM70U|4Ծ}1*UĨ<>*tr絷||dSʑ䧂rҸaLB}|7j@_ @@(ccP&OM] @֜)G)[ۏQ>u% [wf/XJ(uvs>7(lQҾg`T]&oUt8z2k bK;UB}^؛K'x[ޠf_ʌI{m@/l/UifȨT$X6߬fS%F r@o*Z9ء~Qfks 0x;jkԌ6Q;JW43jƽ6R -?ZshC^zCc(IT{@|:@T{@ G.Q."N K յt,mýB4Z3{@;6Q(䁆,a -cŝ=АyqܹhY/nǝ<P:w@KE3zRtܙMJސ;m/"Fոj4ЙyZ9Y hA(|@(@'#Ԇ;[?ŅroAs%&ԬƝ)xIOwuGLvS$ +](;;]@U'Pq: endstream endobj 234 0 obj <> endobj 235 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 65.7002 -158.4893 cm 0 0 m -2.825 2.744 l 580.704 589.983 l 583.51 587.197 l h f Q q 1 0 0 1 53.019 -145.8457 cm 0 0 m -2.803 2.701 l 580.704 589.921 l 583.488 587.154 l h f Q q 1 0 0 1 40.2949 -133.2861 cm 0 0 m -2.741 2.786 l 580.769 589.94 l 583.573 587.217 l h f Q q 1 0 0 1 27.5922 -120.6855 cm 0 0 m -2.76 2.765 l 580.748 589.984 l 583.553 587.198 l h f Q q 1 0 0 1 14.9541 -108.043 cm 0 0 m -2.804 2.701 l 580.726 589.964 l 583.508 587.176 l h f Q q 1 0 0 1 2.2094 -95.4619 cm 0 0 m -2.762 2.765 l 580.79 590.003 l 583.552 587.217 l h f Q q 1 0 0 1 -10.4502 -82.8828 cm 0 0 m -2.783 2.765 l 580.747 590.005 l 583.531 587.219 l h f Q q 1 0 0 1 -23.1529 -70.2607 cm 0 0 m -2.761 2.743 l 580.747 589.984 l 583.551 587.218 l h f Q q 1 0 0 1 -35.834 -57.6592 cm 0 0 m -2.783 2.765 l 580.747 590.005 l 583.531 587.219 l h f Q q 1 0 0 1 -48.4937 -45.0586 cm 0 0 m -2.783 2.743 l 580.704 589.983 l 583.51 587.197 l h f Q q 1 0 0 1 -61.1958 -32.458 cm 0 0 m -2.762 2.745 l 580.747 589.984 l 583.529 587.239 l h f Q q 1 0 0 1 -73.8775 -19.835 cm 0 0 m -2.782 2.742 l 580.726 589.983 l 583.51 587.197 l h f Q q 1 0 0 1 -86.5161 -7.1934 cm 0 0 m -2.804 2.724 l 580.684 589.942 l 583.487 587.156 l h f Q q 1 0 0 1 -99.2393 5.3662 cm 0 0 m -2.741 2.786 l 580.748 589.962 l 583.508 587.219 l h f Q q 1 0 0 1 -111.9419 17.9668 cm 0 0 m -2.761 2.765 l 580.726 589.984 l 583.53 587.198 l h f Q q 1 0 0 1 -124.5806 30.6113 cm 0 0 m -2.804 2.722 l 580.706 589.94 l 583.487 587.176 l h f Q q 1 0 0 1 -137.3038 43.1904 cm 0 0 m -2.741 2.786 l 580.726 590.005 l 583.53 587.219 l h f Q q 1 0 0 1 -149.9849 55.7695 cm 0 0 m -2.783 2.767 l 580.726 590.027 l 583.508 587.241 l h f Q q 1 0 0 1 -175.3477 80.9932 cm 0 0 m -2.74 2.786 l 580.727 590.027 l 583.509 587.241 l h f Q q 1 0 0 1 -188.0284 93.5938 cm 0 0 m -2.783 2.745 l 580.705 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -200.6885 106.2168 cm 0 0 m -2.804 2.744 l 580.706 589.983 l 583.447 587.24 l h f Q q 1 0 0 1 -213.4122 118.8174 cm 0 0 m -2.719 2.786 l 580.727 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -226.0933 131.3984 cm 0 0 m -2.761 2.786 l 580.727 590.003 l 583.531 587.217 l h f Q q 1 0 0 1 -238.7955 144.041 cm 0 0 m -2.719 2.808 l 580.789 590.027 l 583.508 587.219 l h f Q q 1 0 0 1 -251.4766 156.6201 cm 0 0 m -2.804 2.788 l 580.727 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -264.1363 169.2012 cm 0 0 m -2.804 2.786 l 580.727 590.025 l 583.487 587.238 l h f Q q 1 0 0 1 -289.5201 194.4248 cm 0 0 m -2.804 2.786 l 580.727 590.024 l 583.488 587.238 l h f Q q 1 0 0 1 -302.1797 207.0254 cm 0 0 m -2.804 2.786 l 580.706 590.005 l 583.488 587.217 l h f Q q 1 0 0 1 -314.9034 219.6475 cm 0 0 m -2.74 2.806 l 580.727 590.025 l 583.509 587.261 l h f Q q 1 0 0 1 -327.5635 232.249 cm 0 0 m -2.804 2.786 l 580.706 590.002 l 583.488 587.238 l h f Q q 1 0 0 1 -340.2232 244.8711 cm 0 0 m -2.825 2.743 l 580.705 589.983 l 583.445 587.239 l h f Q q 1 0 0 1 -352.9468 257.4717 cm 0 0 m -2.804 2.786 l 580.706 590.003 l 583.488 587.239 l h f Q q 1 0 0 1 -365.628 270.0508 cm 0 0 m -2.783 2.786 l 580.726 590.005 l 583.51 587.261 l h f Q q 1 0 0 1 -378.2881 282.6953 cm 0 0 m -2.825 2.743 l 580.705 589.983 l 583.467 587.239 l h f Q q 1 0 0 1 -391.0113 295.2744 cm 0 0 m -2.783 2.808 l 580.728 590.005 l 583.531 587.26 l h f Q q 1 0 0 1 -403.6714 307.8975 cm 0 0 m -2.804 2.785 l 580.726 590.002 l 583.51 587.216 l h f Q q 1 0 0 1 -416.3326 320.5195 cm 0 0 m -2.823 2.786 l 580.707 589.962 l 583.469 587.239 l h f Q q 1 0 0 1 -429.0547 333.1201 cm 0 0 m -2.825 2.765 l 580.726 590.003 l 583.488 587.217 l h f Q q 1 0 0 1 -441.7354 345.6992 cm 0 0 m -2.804 2.786 l 580.726 589.984 l 583.51 587.219 l h f Q q 1 0 0 1 -454.438 358.2998 cm 0 0 m -2.741 2.83 l 580.769 589.984 l 583.51 587.239 l h f Q q 1 0 0 1 -467.0972 370.9229 cm 0 0 m -2.804 2.786 l 580.704 589.983 l 583.488 587.219 l h f Q q 1 0 0 1 -479.7588 383.5654 cm 0 0 m -2.845 2.723 l 580.706 589.942 l 583.51 587.219 l h f Q q 1 0 0 1 -492.5025 396.146 cm 0 0 m -2.804 2.786 l 580.791 590.005 l 583.51 587.217 l h f Q endstream endobj 236 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 71.971 -164.659 m 69.145 -161.915 l 652.675 425.324 l 655.481 422.538 l h W n q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 404.5610657 -104.9278564 cm BX /Sh0 sh EX Q Q q 59.29 -152.016 m 56.486 -149.313 l 639.994 437.905 l 642.778 435.139 l h W n q 0 g /GS1 gs -84.491539 470.4542847 470.4542847 84.491539 391.8725586 -92.2849808 cm BX /Sh0 sh EX Q Q q 46.565 -139.456 m 43.825 -136.67 l 627.335 450.484 l 630.138 447.761 l h W n q 0 g /GS2 gs -84.4929352 470.4620667 470.4620667 84.4929352 379.2324524 -79.7103729 cm BX /Sh0 sh EX Q Q q 33.863 -126.855 m 31.102 -124.091 l 614.61 463.128 l 617.416 460.342 l h W n q 0 g /GS3 gs -84.501152 470.5078125 470.5078125 84.501152 366.5073853 -67.1136322 cm BX /Sh0 sh EX Q Q q 21.225 -114.213 m 18.421 -111.512 l 601.951 475.751 l 604.733 472.963 l h W n q 0 g /GS4 gs -84.4984055 470.4925232 470.4925232 84.4984055 353.8190308 -54.4804687 cm BX /Sh0 sh EX Q Q q 8.48 -101.632 m 5.719 -98.867 l 589.27 488.372 l 592.033 485.585 l h W n q 0 g /GS5 gs -84.5032425 470.5194702 470.5194702 84.5032425 341.1252441 -41.890213 cm BX /Sh0 sh EX Q Q q -4.18 -89.053 m -6.962 -86.288 l 576.567 500.953 l 579.352 498.167 l h W n q 0 g /GS6 gs -84.5049362 470.5288696 470.5288696 84.5049362 328.4451904 -29.3146133 cm BX /Sh0 sh EX Q Q q -16.882 -76.43 m -19.644 -73.688 l 563.865 513.553 l 566.668 510.787 l h W n q 0 g /GS7 gs -84.5011673 470.5079041 470.5079041 84.5011673 315.7603149 -16.6889935 cm BX /Sh0 sh EX Q Q q -29.564 -63.829 m -32.346 -61.064 l 551.184 526.176 l 553.968 523.39 l h W n q 0 g /GS8 gs -84.5049362 470.5288696 470.5288696 84.5049362 303.061554 -4.0913134 cm BX /Sh0 sh EX Q Q q -42.223 -51.229 m -45.006 -48.485 l 538.481 538.755 l 541.287 535.969 l h W n q 0 g /GS9 gs -84.5024719 470.5151367 470.5151367 84.5024719 290.3877258 8.5071011 cm BX /Sh0 sh EX Q Q q -54.925 -38.628 m -57.687 -35.883 l 525.822 551.356 l 528.604 548.611 l h W n q 0 g /GS10 gs -84.501152 470.5078125 470.5078125 84.501152 277.7088013 21.1120529 cm BX /Sh0 sh EX Q Q q -67.606 -26.005 m -70.389 -23.263 l 513.119 563.979 l 515.903 561.192 l h W n q 0 g /GS11 gs -84.5018082 470.5114746 470.5114746 84.5018082 265.0042114 33.7303848 cm BX /Sh0 sh EX Q Q q -80.246 -13.363 m -83.049 -10.64 l 500.438 576.579 l 503.242 573.793 l h W n q 0 g /GS12 gs -84.4959335 470.4787598 470.4787598 84.4959335 252.3388977 46.367794 cm BX /Sh0 sh EX Q Q q -92.969 -0.804 m -95.709 1.982 l 487.779 589.159 l 490.54 586.416 l h W n q 0 g /GS13 gs -84.4973679 470.4867249 470.4867249 84.4973679 239.6672058 58.9365807 cm BX /Sh0 sh EX Q Q q -105.671 11.798 m -108.433 14.562 l 475.055 601.781 l 477.858 598.995 l h W n q 0 g /GS14 gs -84.5018082 470.5114746 470.5114746 84.5018082 226.9613037 71.5367279 cm BX /Sh0 sh EX Q Q q -118.31 24.441 m -121.114 27.163 l 462.395 614.382 l 465.177 611.617 l h W n q 0 g /GS15 gs -84.4948959 470.4729614 470.4729614 84.4948959 214.2758484 84.1726913 cm BX /Sh0 sh EX Q Q q -131.033 37.021 m -133.774 39.807 l 449.693 627.026 l 452.497 624.24 l h W n q 0 g /GS16 gs -84.5055847 470.5324707 470.5324707 84.5055847 201.6131287 96.7626114 cm BX /Sh0 sh EX Q Q q -143.714 49.6 m -146.497 52.366 l 437.012 639.627 l 439.794 636.841 l h W n q 0 g /GS17 gs -84.509346 470.5534363 470.5534363 84.509346 188.9013214 109.3362579 cm BX /Sh0 sh EX Q Q q -156.354 62.244 m -159.157 64.968 l 424.353 652.228 l 427.156 649.483 l h W n q 0 g /GS18 gs -84.5024261 470.5148926 470.5148926 84.5024261 176.2488556 121.9781799 cm BX /Sh0 sh EX Q Q q -169.077 74.823 m -171.817 77.609 l 411.65 664.85 l 414.432 662.064 l h W n q 0 g /GS19 gs -84.5093384 470.5533752 470.5533752 84.5093384 163.5613556 134.5636444 cm BX /Sh0 sh EX Q Q q -181.758 87.424 m -184.541 90.169 l 398.947 677.429 l 401.751 674.643 l h W n q 0 g /GS20 gs -84.5062256 470.5360413 470.5360413 84.5062256 150.8544312 147.1598511 cm BX /Sh0 sh EX Q Q q -194.418 100.047 m -197.222 102.792 l 386.288 690.03 l 389.029 687.287 l h W n q 0 g /GS21 gs -84.5024261 470.5148926 470.5148926 84.5024261 138.1558533 159.775528 cm BX /Sh0 sh EX Q Q q -207.142 112.647 m -209.86 115.434 l 373.585 702.653 l 376.367 699.867 l h W n q 0 g /GS22 gs -84.5055618 470.5323486 470.5323486 84.5055618 125.505188 172.3892975 cm BX /Sh0 sh EX Q Q q -219.822 125.229 m -222.584 128.015 l 360.904 715.232 l 363.708 712.446 l h W n q 0 g /GS23 gs -84.5051804 470.5302124 470.5302124 84.5051804 112.814003 184.9688263 cm BX /Sh0 sh EX Q Q q -232.525 137.871 m -235.244 140.679 l 348.265 727.898 l 350.984 725.09 l h W n q 0 g /GS24 gs -84.5074081 470.5426636 470.5426636 84.5074081 100.1234894 197.612915 cm BX /Sh0 sh EX Q Q q -245.206 150.45 m -248.01 153.238 l 335.521 740.455 l 338.303 737.669 l h W n q 0 g /GS25 gs -84.5055618 470.5323486 470.5323486 84.5055618 87.3998489 210.184433 cm BX /Sh0 sh EX Q Q q -257.866 163.031 m -260.67 165.817 l 322.861 753.056 l 325.622 750.27 l h W n q 0 g /GS26 gs -84.508934 470.5511475 470.5511475 84.508934 74.7311783 222.7642517 cm BX /Sh0 sh EX Q Q q -270.589 175.673 m -273.33 178.481 l 310.2 765.7 l 312.941 762.893 l h W n q 0 g /GS27 gs -84.5074081 470.5426636 470.5426636 84.5074081 62.0591812 235.4154205 cm BX /Sh0 sh EX Q Q q -283.249 188.255 m -286.053 191.041 l 297.478 778.279 l 300.238 775.493 l h W n q 0 g /GS28 gs -84.5089417 470.551178 470.551178 84.5089417 49.3476524 247.9875336 cm BX /Sh0 sh EX Q Q q -295.909 200.855 m -298.713 203.642 l 284.797 790.861 l 287.579 788.072 l h W n q 0 g /GS29 gs -84.5061874 470.5358582 470.5358582 84.5061874 36.686203 260.5881653 cm BX /Sh0 sh EX Q Q q -308.633 213.478 m -311.373 216.283 l 272.094 803.502 l 274.876 800.738 l h W n q 0 g /GS30 gs -84.5089493 470.551239 470.551239 84.5089493 24.0089436 273.2188721 cm BX /Sh0 sh EX Q Q q -321.293 226.079 m -324.097 228.865 l 259.414 816.082 l 262.195 813.317 l h W n q 0 g /GS31 gs -84.5058136 470.5337524 470.5337524 84.5058136 11.3045206 285.8118286 cm BX /Sh0 sh EX Q Q q -333.953 238.701 m -336.777 241.444 l 246.752 828.685 l 249.493 825.94 l h W n q 0 g /GS32 gs -84.5024643 470.5151062 470.5151062 84.5024643 -1.3901668 298.4281921 cm BX /Sh0 sh EX Q Q q -346.676 251.302 m -349.48 254.088 l 234.03 841.305 l 236.811 838.541 l h W n q 0 g /GS33 gs -84.5058212 470.5338135 470.5338135 84.5058212 -14.0790081 311.0350952 cm BX /Sh0 sh EX Q Q q -359.357 263.881 m -362.14 266.667 l 221.368 853.886 l 224.152 851.142 l h W n q 0 g /GS34 gs -84.5055923 470.5325317 470.5325317 84.5055923 -26.737442 323.6183472 cm BX /Sh0 sh EX Q Q q -372.017 276.525 m -374.842 279.269 l 208.687 866.509 l 211.45 863.764 l h W n q 0 g /GS35 gs -84.5024643 470.5151062 470.5151062 84.5024643 -39.4442444 336.2542114 cm BX /Sh0 sh EX Q Q q -384.741 289.104 m -387.523 291.912 l 195.987 879.11 l 198.79 876.365 l h W n q 0 g /GS36 gs -84.5055313 470.532196 470.532196 84.5055313 -52.1086082 348.8438416 cm BX /Sh0 sh EX Q Q q -397.401 301.728 m -400.205 304.513 l 183.325 891.73 l 186.109 888.944 l h W n q 0 g /GS37 gs -84.5052032 470.530365 470.530365 84.5052032 -64.7946396 361.4617615 cm BX /Sh0 sh EX Q Q q -410.062 314.35 m -412.885 317.136 l 170.645 904.312 l 173.407 901.588 l h W n q 0 g /GS38 gs -84.498642 470.4938354 470.4938354 84.498642 -77.4833832 374.0793762 cm BX /Sh0 sh EX Q Q q -422.784 326.95 m -425.609 329.715 l 157.942 916.954 l 160.704 914.167 l h W n q 0 g /GS39 gs -84.5052109 470.530426 470.530426 84.5052109 -90.2008209 386.6809387 cm BX /Sh0 sh EX Q Q q -435.465 339.529 m -438.269 342.315 l 145.261 929.513 l 148.045 926.749 l h W n q 0 g /GS40 gs -84.5018234 470.5115356 470.5115356 84.5018234 -102.8586426 399.2642212 cm BX /Sh0 sh EX Q Q q -448.168 352.131 m -450.908 354.96 l 132.602 942.114 l 135.342 939.369 l h W n q 0 g /GS41 gs -84.5004883 470.5041199 470.5041199 84.5004883 -115.5254211 411.8714294 cm BX /Sh0 sh EX Q Q q -460.827 364.753 m -463.63 367.539 l 119.877 954.736 l 122.662 951.972 l h W n q 0 g /GS42 gs -84.5024872 470.5152283 470.5152283 84.5024872 -128.2311096 424.4857178 cm BX /Sh0 sh EX Q Q q -473.488 377.396 m -476.333 380.118 l 107.218 967.337 l 110.021 964.614 l h W n q 0 g /GS43 gs -84.4952469 470.4749146 470.4749146 84.4952469 -140.9075012 437.1251526 cm BX /Sh0 sh EX Q Q q -486.232 389.977 m -489.036 392.763 l 94.559 979.981 l 97.278 977.193 l h W n q 0 g /GS44 gs -84.5035934 470.5214233 470.5214233 84.5035934 -153.6261139 449.7107849 cm BX /Sh0 sh EX Q Q endstream endobj 239 0 obj <> endobj 240 0 obj <> endobj 241 0 obj <> endobj 242 0 obj <> endobj 243 0 obj <> endobj 244 0 obj <> endobj 245 0 obj <> endobj 246 0 obj <> endobj 247 0 obj <> endobj 248 0 obj <> endobj 249 0 obj <> endobj 250 0 obj <> endobj 251 0 obj <> endobj 252 0 obj <> endobj 253 0 obj <> endobj 254 0 obj <> endobj 255 0 obj <> endobj 256 0 obj <> endobj 257 0 obj <> endobj 258 0 obj <> endobj 259 0 obj <> endobj 260 0 obj <> endobj 261 0 obj <> endobj 262 0 obj <> endobj 263 0 obj <> endobj 264 0 obj <> endobj 265 0 obj <> endobj 266 0 obj <> endobj 267 0 obj <> endobj 268 0 obj <> endobj 269 0 obj <> endobj 270 0 obj <> endobj 271 0 obj <> endobj 272 0 obj <> endobj 273 0 obj <> endobj 274 0 obj <> endobj 275 0 obj <> endobj 276 0 obj <> endobj 277 0 obj <> endobj 278 0 obj <> endobj 279 0 obj <> endobj 280 0 obj <> endobj 281 0 obj <> endobj 282 0 obj <> endobj 283 0 obj <> endobj 284 0 obj <> endobj 329 0 obj <> endobj 330 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024719 470.5151367 470.5151367 84.5024719 290.3877258 8.5071011 cm BX /Sh0 sh EX Q endstream endobj 331 0 obj <> endobj 328 0 obj <> endobj 332 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5049362 470.5288696 470.5288696 84.5049362 303.061554 -4.0913134 cm BX /Sh0 sh EX Q endstream endobj 333 0 obj <> endobj 327 0 obj <> endobj 334 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5011673 470.5079041 470.5079041 84.5011673 315.7603149 -16.6889935 cm BX /Sh0 sh EX Q endstream endobj 335 0 obj <> endobj 326 0 obj <> endobj 336 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5049362 470.5288696 470.5288696 84.5049362 328.4451904 -29.3146133 cm BX /Sh0 sh EX Q endstream endobj 337 0 obj <> endobj 325 0 obj <> endobj 338 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5032425 470.5194702 470.5194702 84.5032425 341.1252441 -41.890213 cm BX /Sh0 sh EX Q endstream endobj 339 0 obj <> endobj 324 0 obj <> endobj 340 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5035934 470.5214233 470.5214233 84.5035934 -153.6261139 449.7107849 cm BX /Sh0 sh EX Q endstream endobj 341 0 obj <> endobj 323 0 obj <> endobj 342 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4952469 470.4749146 470.4749146 84.4952469 -140.9075012 437.1251526 cm BX /Sh0 sh EX Q endstream endobj 343 0 obj <> endobj 322 0 obj <> endobj 344 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 -128.2311096 424.4857178 cm BX /Sh0 sh EX Q endstream endobj 345 0 obj <> endobj 321 0 obj <> endobj 346 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5004883 470.5041199 470.5041199 84.5004883 -115.5254211 411.8714294 cm BX /Sh0 sh EX Q endstream endobj 347 0 obj <> endobj 320 0 obj <> endobj 348 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018234 470.5115356 470.5115356 84.5018234 -102.8586426 399.2642212 cm BX /Sh0 sh EX Q endstream endobj 349 0 obj <> endobj 319 0 obj <> endobj 350 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4984055 470.4925232 470.4925232 84.4984055 353.8190308 -54.4804687 cm BX /Sh0 sh EX Q endstream endobj 351 0 obj <> endobj 318 0 obj <> endobj 352 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5052109 470.530426 470.530426 84.5052109 -90.2008209 386.6809387 cm BX /Sh0 sh EX Q endstream endobj 353 0 obj <> endobj 317 0 obj <> endobj 354 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.498642 470.4938354 470.4938354 84.498642 -77.4833832 374.0793762 cm BX /Sh0 sh EX Q endstream endobj 355 0 obj <> endobj 316 0 obj <> endobj 356 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5052032 470.530365 470.530365 84.5052032 -64.7946396 361.4617615 cm BX /Sh0 sh EX Q endstream endobj 357 0 obj <> endobj 315 0 obj <> endobj 358 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055313 470.532196 470.532196 84.5055313 -52.1086082 348.8438416 cm BX /Sh0 sh EX Q endstream endobj 359 0 obj <> endobj 314 0 obj <> endobj 360 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024643 470.5151062 470.5151062 84.5024643 -39.4442444 336.2542114 cm BX /Sh0 sh EX Q endstream endobj 361 0 obj <> endobj 313 0 obj <> endobj 362 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055923 470.5325317 470.5325317 84.5055923 -26.737442 323.6183472 cm BX /Sh0 sh EX Q endstream endobj 363 0 obj <> endobj 312 0 obj <> endobj 364 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5058212 470.5338135 470.5338135 84.5058212 -14.0790081 311.0350952 cm BX /Sh0 sh EX Q endstream endobj 365 0 obj <> endobj 311 0 obj <> endobj 366 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024643 470.5151062 470.5151062 84.5024643 -1.3901668 298.4281921 cm BX /Sh0 sh EX Q endstream endobj 367 0 obj <> endobj 310 0 obj <> endobj 368 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5058136 470.5337524 470.5337524 84.5058136 11.3045206 285.8118286 cm BX /Sh0 sh EX Q endstream endobj 369 0 obj <> endobj 309 0 obj <> endobj 370 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5089493 470.551239 470.551239 84.5089493 24.0089436 273.2188721 cm BX /Sh0 sh EX Q endstream endobj 371 0 obj <> endobj 308 0 obj <> endobj 372 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.501152 470.5078125 470.5078125 84.501152 366.5073853 -67.1136322 cm BX /Sh0 sh EX Q endstream endobj 373 0 obj <> endobj 307 0 obj <> endobj 374 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5061874 470.5358582 470.5358582 84.5061874 36.686203 260.5881653 cm BX /Sh0 sh EX Q endstream endobj 375 0 obj <> endobj 306 0 obj <> endobj 376 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5089417 470.551178 470.551178 84.5089417 49.3476524 247.9875336 cm BX /Sh0 sh EX Q endstream endobj 377 0 obj <> endobj 305 0 obj <> endobj 378 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5074081 470.5426636 470.5426636 84.5074081 62.0591812 235.4154205 cm BX /Sh0 sh EX Q endstream endobj 379 0 obj <> endobj 304 0 obj <> endobj 380 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.508934 470.5511475 470.5511475 84.508934 74.7311783 222.7642517 cm BX /Sh0 sh EX Q endstream endobj 381 0 obj <> endobj 303 0 obj <> endobj 382 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055618 470.5323486 470.5323486 84.5055618 87.3998489 210.184433 cm BX /Sh0 sh EX Q endstream endobj 383 0 obj <> endobj 302 0 obj <> endobj 384 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5074081 470.5426636 470.5426636 84.5074081 100.1234894 197.612915 cm BX /Sh0 sh EX Q endstream endobj 385 0 obj <> endobj 301 0 obj <> endobj 386 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5051804 470.5302124 470.5302124 84.5051804 112.814003 184.9688263 cm BX /Sh0 sh EX Q endstream endobj 387 0 obj <> endobj 300 0 obj <> endobj 388 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055618 470.5323486 470.5323486 84.5055618 125.505188 172.3892975 cm BX /Sh0 sh EX Q endstream endobj 389 0 obj <> endobj 299 0 obj <> endobj 390 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024261 470.5148926 470.5148926 84.5024261 138.1558533 159.775528 cm BX /Sh0 sh EX Q endstream endobj 391 0 obj <> endobj 298 0 obj <> endobj 392 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5062256 470.5360413 470.5360413 84.5062256 150.8544312 147.1598511 cm BX /Sh0 sh EX Q endstream endobj 393 0 obj <> endobj 297 0 obj <> endobj 394 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4929352 470.4620667 470.4620667 84.4929352 379.2324524 -79.7103729 cm BX /Sh0 sh EX Q endstream endobj 395 0 obj <> endobj 296 0 obj <> endobj 396 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5093384 470.5533752 470.5533752 84.5093384 163.5613556 134.5636444 cm BX /Sh0 sh EX Q endstream endobj 397 0 obj <> endobj 295 0 obj <> endobj 398 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024261 470.5148926 470.5148926 84.5024261 176.2488556 121.9781799 cm BX /Sh0 sh EX Q endstream endobj 399 0 obj <> endobj 294 0 obj <> endobj 400 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.509346 470.5534363 470.5534363 84.509346 188.9013214 109.3362579 cm BX /Sh0 sh EX Q endstream endobj 401 0 obj <> endobj 293 0 obj <> endobj 402 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055847 470.5324707 470.5324707 84.5055847 201.6131287 96.7626114 cm BX /Sh0 sh EX Q endstream endobj 403 0 obj <> endobj 292 0 obj <> endobj 404 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4948959 470.4729614 470.4729614 84.4948959 214.2758484 84.1726913 cm BX /Sh0 sh EX Q endstream endobj 405 0 obj <> endobj 291 0 obj <> endobj 406 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018082 470.5114746 470.5114746 84.5018082 226.9613037 71.5367279 cm BX /Sh0 sh EX Q endstream endobj 407 0 obj <> endobj 290 0 obj <> endobj 408 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4973679 470.4867249 470.4867249 84.4973679 239.6672058 58.9365807 cm BX /Sh0 sh EX Q endstream endobj 409 0 obj <> endobj 289 0 obj <> endobj 410 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4959335 470.4787598 470.4787598 84.4959335 252.3388977 46.367794 cm BX /Sh0 sh EX Q endstream endobj 411 0 obj <> endobj 288 0 obj <> endobj 412 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018082 470.5114746 470.5114746 84.5018082 265.0042114 33.7303848 cm BX /Sh0 sh EX Q endstream endobj 413 0 obj <> endobj 287 0 obj <> endobj 414 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.501152 470.5078125 470.5078125 84.501152 277.7088013 21.1120529 cm BX /Sh0 sh EX Q endstream endobj 415 0 obj <> endobj 286 0 obj <> endobj 416 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.491539 470.4542847 470.4542847 84.491539 391.8725586 -92.2849808 cm BX /Sh0 sh EX Q endstream endobj 417 0 obj <> endobj 285 0 obj <> endobj 418 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 404.5610657 -104.9278564 cm BX /Sh0 sh EX Q endstream endobj 419 0 obj <> endobj 238 0 obj <> endobj 233 0 obj <> endobj 12 0 obj <> endobj 420 0 obj [422 0 R] endobj 421 0 obj <>stream H\݊0}\j`u kh/|9҅ (|df2gyud0]͕U4ѽ뱶o̿ɲuu*ٍV3C_΋Z!m-Mzygzd1M?4\ÒB/ZlvZ}/IE|1ϰfyR;$,.I,{?@ڭkk]]Cc(A(0仠$@ Q%8\!^QG8"(!OCCg9qJAgP ES^=SrԦ/AО hȠV@ChPS@C=} hgo0߷@==<26Kz~'`ϓʧ endstream endobj 422 0 obj <> endobj 423 0 obj <> endobj 424 0 obj <> endobj 425 0 obj <>stream HԢl $ fQ`P0Y7 endstream endobj 426 0 obj <>stream HWo?gfgח]k{ׅ6]\xׅ%a}0A !iJ/&iHUCC#z$PcTZ/c*v̮1S"n|rȮ1]w^"!߂ǙŋUo3:b_> 0c^(/K4t>?y,U?eL={a_|=eLqt︊8_>19//T!<~gtLї|s/Bl/`~dL~Ŷ"ƿ+ʟ*cEՠrg7~jxWOIfɎXy[4^iKJ(*G,t_ܜ>H&%%3eƙҒR8ib^{%^\^VR1+'KR SY;!0a.혪#}1,o*e!JABCcvBm뒕NK']gYdP![r'-ļi=ڛQOFSJ'lKI V!Cfj)~9se.J>/֛!Cܝ:6QQ:c9|7zZ4\0#LuS)p%G},]XB[(lx-76(vBOڽɴ|y4- a -shFiٌmZd`ve鈊#d-Fqrv,Ki5VqҟL$1ͷ.k6Xns)y9'Stfqsn<$jwr)y6WA}loRDzNzZ@36"c}TeMGL-sνZeJ~ʒzNe#_rrSTijGlm.'GIvJk p5 7H2a![ Ví'kyAEFtAҲw2+S=k˾HY dD|$uG F|${mvG0ĈwLFaWϠ1d:%Ӹ;qU:uħ2}Ziy\u5[hdgqu!=Ǎv>8ͳ[bt> Ov {ot A;RDݞxVj\-ZO5RwM%<}A#TQ0 )+#F%䀘 ؍сowxO:Jt_Y+C<r(2łl1RL1bg o}!D6ĵO[ߐérO|! (hFfBY K%{:WH_׹(EBNHҮGoNPhO*W3Qd-1/8]n]`mr!wC)oy$X.eAGX_4Ѭ^ܛ)x3L$qL6~@C/?gs68iy$7!!ѿU5{>$}~mx#C6VV ?!~C"cܮ(?Vs)Y ծR=?]|Y= f֜ 7E u`3/ţɨݽ;Ա-_Ono_*wW?_QV|'` e`CL} W7Qxdkڦ"SIlVEol 6X<wX=>?48 =o9>=e_*]ʝS//~stj?~x,kŘݡqU'8nQ  C1ϏY֣(1/ ׎~{ǔ[wg 3;^ \8[8s 9 !س-*WB*f+x5EP<Mv${V(Uil^UT}"G#kEP PnQezrU&}ҨZi1G_6Fl!0E[m.OMjm㸢3]R()&V|E%.cE$q [GA[@+ $ҏp WܯZ~YR5`Dps=hPLW5ꋑ\n|[Oc,MSuІ sjkHgHAȴ#Rf1UhL|ѥ*ϡ[/Z.ۍ g0D,vIQ$̔PC$>)J'jg˫:O>/ܭ|O:yw{rPڽcƒb 7yOi s O׾vu=O*j, V Y;ON˳wnܸkxUme$??%ooGc#~G5\mMg5M^Xv9} TqP!T)"Qt(8 \nG!abB4NHĸE lDgNCL#u|(*^  4cl N2oE2@'#->M]i>!-+o\[V/Oܻ^8<#Z@+B.+)b؀S3`01,H6.RLO̪ H*$gc$\ƴȤTf,<|=TxִD"Q2vis {Lϯ՟ó;[pel6Ww<{I4 ,:Bjt0ӟiw'jaE F99=&πV8'AAB /Dw3~g`~@b@Q>VV˗pTX[ӑC8)x~8phd㏬Q|/`D:.V-++c|<`qx 7l t;a"UC;j:_fgH 4}rn|[_{CdhؽjѯiCX !߃?09>qA7..g0X5p׭ʼng**mXR;3$Xw:9v2P7smE'icßhHW׈|.3W1%c"=Pf9ohMHLDžD#@,m9B>-,.&FsHm!3C/oڿ8[X魫oQWʛ`Wk~F;j #Gd@cUo4$Gm>DN7q!F  Rjwe$?%ˀk@h`ӦT{`jrj|; eU:m/A} <V aNYژ(XO1.{71@\W_/_ dm6FiQ#3<A ]L0bAj}{\SdEƏr|@DgY,"'BJ * YH!$ 'ѐ'%;kWֳ%(ι̥L!By!U4}1Al)P^` PCSc52կh(1lhjki4F?|&Zm}0( 6~ʚ>s.,~5 :D WE=u\Gа+[w F}~K_ӲӰ3-fvy]!o;tХwՙS7qT(rPB*5⣬}]M_ h2c! Md0 ;9|<{eO];6S>->ϞZ/<~}d=^tӳ:H|FԌE/ÆI!NMwU\a [צUoOzd%=협lE_b\fKg2CշNZ'nd޺eNǺZu6MeT̹ N^Kc` endstream endobj 6 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 428 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000071495 00000 n 0000000000 00000 f 0000071552 00000 n 0000374281 00000 n 0000071938 00000 n 0000148936 00000 n 0000155828 00000 n 0000148813 00000 n 0000101611 00000 n 0000366445 00000 n 0000123414 00000 n 0000122904 00000 n 0000122501 00000 n 0000121944 00000 n 0000155893 00000 n 0000156138 00000 n 0000156515 00000 n 0000072296 00000 n 0000080005 00000 n 0000080071 00000 n 0000080307 00000 n 0000121881 00000 n 0000080678 00000 n 0000121634 00000 n 0000121758 00000 n 0000080741 00000 n 0000085253 00000 n 0000121571 00000 n 0000094448 00000 n 0000094654 00000 n 0000095524 00000 n 0000095639 00000 n 0000095754 00000 n 0000095869 00000 n 0000095984 00000 n 0000096099 00000 n 0000096214 00000 n 0000096329 00000 n 0000096444 00000 n 0000096559 00000 n 0000096674 00000 n 0000096789 00000 n 0000096904 00000 n 0000097019 00000 n 0000097134 00000 n 0000097249 00000 n 0000097365 00000 n 0000097481 00000 n 0000097597 00000 n 0000097713 00000 n 0000097829 00000 n 0000097945 00000 n 0000098061 00000 n 0000098177 00000 n 0000098293 00000 n 0000098409 00000 n 0000098525 00000 n 0000098641 00000 n 0000098757 00000 n 0000098873 00000 n 0000098989 00000 n 0000099105 00000 n 0000099221 00000 n 0000099337 00000 n 0000099453 00000 n 0000099569 00000 n 0000099685 00000 n 0000099801 00000 n 0000099917 00000 n 0000100033 00000 n 0000100149 00000 n 0000100265 00000 n 0000100381 00000 n 0000100497 00000 n 0000100613 00000 n 0000094511 00000 n 0000094714 00000 n 0000095002 00000 n 0000095389 00000 n 0000094832 00000 n 0000094914 00000 n 0000095442 00000 n 0000121120 00000 n 0000120669 00000 n 0000120217 00000 n 0000119765 00000 n 0000119316 00000 n 0000118867 00000 n 0000118417 00000 n 0000117966 00000 n 0000117515 00000 n 0000117064 00000 n 0000116613 00000 n 0000116164 00000 n 0000115717 00000 n 0000115267 00000 n 0000114816 00000 n 0000114364 00000 n 0000113912 00000 n 0000113461 00000 n 0000113010 00000 n 0000112558 00000 n 0000112107 00000 n 0000111655 00000 n 0000111205 00000 n 0000110752 00000 n 0000110301 00000 n 0000109849 00000 n 0000109397 00000 n 0000108945 00000 n 0000108493 00000 n 0000108041 00000 n 0000107591 00000 n 0000107139 00000 n 0000106689 00000 n 0000106237 00000 n 0000105786 00000 n 0000105334 00000 n 0000104882 00000 n 0000104431 00000 n 0000103979 00000 n 0000103527 00000 n 0000103078 00000 n 0000102627 00000 n 0000102175 00000 n 0000101724 00000 n 0000100729 00000 n 0000100784 00000 n 0000101104 00000 n 0000101182 00000 n 0000101331 00000 n 0000101452 00000 n 0000101531 00000 n 0000101779 00000 n 0000102097 00000 n 0000102230 00000 n 0000102549 00000 n 0000102682 00000 n 0000103000 00000 n 0000103133 00000 n 0000103449 00000 n 0000103582 00000 n 0000103901 00000 n 0000104034 00000 n 0000104353 00000 n 0000104486 00000 n 0000104804 00000 n 0000104937 00000 n 0000105256 00000 n 0000105389 00000 n 0000105708 00000 n 0000105841 00000 n 0000106159 00000 n 0000106292 00000 n 0000106611 00000 n 0000106744 00000 n 0000107061 00000 n 0000107194 00000 n 0000107513 00000 n 0000107646 00000 n 0000107963 00000 n 0000108096 00000 n 0000108415 00000 n 0000108548 00000 n 0000108867 00000 n 0000109000 00000 n 0000109319 00000 n 0000109452 00000 n 0000109771 00000 n 0000109904 00000 n 0000110223 00000 n 0000110356 00000 n 0000110674 00000 n 0000110807 00000 n 0000111127 00000 n 0000111260 00000 n 0000111577 00000 n 0000111710 00000 n 0000112029 00000 n 0000112162 00000 n 0000112480 00000 n 0000112613 00000 n 0000112932 00000 n 0000113065 00000 n 0000113383 00000 n 0000113516 00000 n 0000113834 00000 n 0000113967 00000 n 0000114286 00000 n 0000114419 00000 n 0000114738 00000 n 0000114870 00000 n 0000115189 00000 n 0000115321 00000 n 0000115639 00000 n 0000115771 00000 n 0000116086 00000 n 0000116218 00000 n 0000116535 00000 n 0000116667 00000 n 0000116986 00000 n 0000117118 00000 n 0000117437 00000 n 0000117569 00000 n 0000117888 00000 n 0000118020 00000 n 0000118339 00000 n 0000118471 00000 n 0000118789 00000 n 0000118921 00000 n 0000119238 00000 n 0000119370 00000 n 0000119687 00000 n 0000119819 00000 n 0000120139 00000 n 0000120271 00000 n 0000120591 00000 n 0000120723 00000 n 0000121042 00000 n 0000121174 00000 n 0000121493 00000 n 0000122092 00000 n 0000122213 00000 n 0000122360 00000 n 0000141182 00000 n 0000131970 00000 n 0000123827 00000 n 0000124090 00000 n 0000132223 00000 n 0000141438 00000 n 0000366381 00000 n 0000327321 00000 n 0000327385 00000 n 0000331621 00000 n 0000321632 00000 n 0000366317 00000 n 0000340782 00000 n 0000340846 00000 n 0000340963 00000 n 0000341080 00000 n 0000341197 00000 n 0000341314 00000 n 0000341431 00000 n 0000341548 00000 n 0000341665 00000 n 0000341782 00000 n 0000341899 00000 n 0000342016 00000 n 0000342133 00000 n 0000342250 00000 n 0000342367 00000 n 0000342484 00000 n 0000342601 00000 n 0000342718 00000 n 0000342835 00000 n 0000342952 00000 n 0000343069 00000 n 0000343186 00000 n 0000343303 00000 n 0000343420 00000 n 0000343537 00000 n 0000343654 00000 n 0000343771 00000 n 0000343888 00000 n 0000344005 00000 n 0000344122 00000 n 0000344239 00000 n 0000344356 00000 n 0000344473 00000 n 0000344590 00000 n 0000344707 00000 n 0000344824 00000 n 0000344941 00000 n 0000345058 00000 n 0000345175 00000 n 0000345292 00000 n 0000345409 00000 n 0000345526 00000 n 0000345643 00000 n 0000345760 00000 n 0000345877 00000 n 0000345994 00000 n 0000365866 00000 n 0000365418 00000 n 0000364971 00000 n 0000364522 00000 n 0000364074 00000 n 0000363625 00000 n 0000363176 00000 n 0000362727 00000 n 0000362278 00000 n 0000361830 00000 n 0000361380 00000 n 0000360930 00000 n 0000360480 00000 n 0000360030 00000 n 0000359581 00000 n 0000359132 00000 n 0000358683 00000 n 0000358234 00000 n 0000357786 00000 n 0000357339 00000 n 0000356890 00000 n 0000356443 00000 n 0000355995 00000 n 0000355547 00000 n 0000355100 00000 n 0000354651 00000 n 0000354202 00000 n 0000353752 00000 n 0000353303 00000 n 0000352853 00000 n 0000352405 00000 n 0000351957 00000 n 0000351509 00000 n 0000351061 00000 n 0000350611 00000 n 0000350160 00000 n 0000349709 00000 n 0000349258 00000 n 0000348807 00000 n 0000348356 00000 n 0000347907 00000 n 0000347457 00000 n 0000347007 00000 n 0000346559 00000 n 0000346111 00000 n 0000346166 00000 n 0000346481 00000 n 0000346614 00000 n 0000346929 00000 n 0000347062 00000 n 0000347379 00000 n 0000347512 00000 n 0000347829 00000 n 0000347962 00000 n 0000348278 00000 n 0000348411 00000 n 0000348729 00000 n 0000348862 00000 n 0000349180 00000 n 0000349313 00000 n 0000349631 00000 n 0000349764 00000 n 0000350082 00000 n 0000350215 00000 n 0000350533 00000 n 0000350666 00000 n 0000350983 00000 n 0000351116 00000 n 0000351431 00000 n 0000351564 00000 n 0000351879 00000 n 0000352012 00000 n 0000352327 00000 n 0000352460 00000 n 0000352775 00000 n 0000352908 00000 n 0000353225 00000 n 0000353358 00000 n 0000353674 00000 n 0000353807 00000 n 0000354124 00000 n 0000354257 00000 n 0000354573 00000 n 0000354706 00000 n 0000355022 00000 n 0000355155 00000 n 0000355469 00000 n 0000355602 00000 n 0000355917 00000 n 0000356050 00000 n 0000356365 00000 n 0000356498 00000 n 0000356812 00000 n 0000356945 00000 n 0000357261 00000 n 0000357394 00000 n 0000357708 00000 n 0000357841 00000 n 0000358156 00000 n 0000358289 00000 n 0000358605 00000 n 0000358738 00000 n 0000359054 00000 n 0000359187 00000 n 0000359503 00000 n 0000359636 00000 n 0000359952 00000 n 0000360085 00000 n 0000360402 00000 n 0000360535 00000 n 0000360852 00000 n 0000360985 00000 n 0000361302 00000 n 0000361435 00000 n 0000361752 00000 n 0000361885 00000 n 0000362200 00000 n 0000362333 00000 n 0000362649 00000 n 0000362782 00000 n 0000363098 00000 n 0000363231 00000 n 0000363547 00000 n 0000363680 00000 n 0000363996 00000 n 0000364129 00000 n 0000364444 00000 n 0000364577 00000 n 0000364893 00000 n 0000365026 00000 n 0000365340 00000 n 0000365473 00000 n 0000365788 00000 n 0000365921 00000 n 0000366239 00000 n 0000366582 00000 n 0000366609 00000 n 0000367068 00000 n 0000367475 00000 n 0000367545 00000 n 0000367812 00000 n 0000367923 00000 n 0001028689 00000 n trailer <<2F369D592DF44B2DBCBDF18CE496748F>]>> startxref 1028950 %%EOF