%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf Kubernetes for XtraDB 2019-05-29T15:22:09-03:00 2019-05-29T15:22:09-03:00 2019-05-29T15:22:09-03:00 Adobe Illustrator CC 23.0 (Macintosh) 256 148 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAlAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A7u/lnXWdmHmO7AJNAK/c PjzVHQZf9Vl+Pi7Ia3H/AKnH8fBb/hfXv+plvPx6/wDB4/yfl/1WX4+K/nsf+pR/Hwd/hfXv+plv Pfr/AM14/wAn5f8AVZfj4r+ex/6lH8fB3+F9e/6mW89+vT/g8f5Py/6rL8fFfz2P/Uo/j4K0flDX nUN/ia8H0H/mvH+T8v8Aqsvx8V/PY/8AUo/j4Lv8G69/1M959x/5rx/k/L/qsvx8V/PY/wDUo/j4 O/wbr3/Uz3n3H/mvH+T8v+qy/HxX89j/ANSj+Pg7/Buvf9TPefcf+a8f5Py/6rL8fFfz2P8A1KP4 +Dv8G69/1M959x/5rx/k/L/qsvx8V/PY/wDUo/j4O/wbr3/Uz3n3H/mvH+T8v+qy/HxX89j/ANSj +Pg7/Buvf9TPefcf+a8f5Py/6rL8fFfz2P8A1KP4+Dv8G69/1M959x/5rx/k/L/qsvx8V/PY/wDU o/j4O/wbr3/Uz3n3H/mvH+T8v+qy/HxX89j/ANSj+Pgn2jafc2FkLe5vJL6UMWNxL9og9urdMztP ilCNSkZHvLh58gnKwOHyR2XtLsVdirsVY1rWhajf3SzW2rT2EaoEMMQqpIYnl9obmtMwtTpZ5JXG ZhtyH9rl6fUwhGjAS96X/wCEtb/6mO7+4/8ANeY/8n5f9Vl+Pi3/AJ7H/qUfx8Hf4S1r/qY7v7j/ AM14/wAn5f8AVZfj4r+ex/6lH8fB3+Etb/6mO7+4/wDNeP8AJ+X/AFWX4+K/nsf+pR/HwQ97oN9Y wrNd+aLmGJpI4ldgd3lYJGv2upZgMjLQ5BzzS/HxZQ1cJGhij+PgiP8ACWt/9THdfcf+a8l/J+X/ AFWX4+LH89j/ANSj+Pg1/hLW/wDqY7v7v+b8f5Py/wCqy/HxX89j/wBSj+Pg7/Cetf8AUx3X3H/m vH+T8v8Aqsvx8V/PY/8AUo/j4O/wnrf/AFMd393/ADfj/J+X/VZfj4r+ex/6lH8fB3+Etap/ykd1 T5H/AJrx/k/L/qsvx8V/PY/9Sj+Pg7/Cet/9TFd/d3/4PH+T8v8Aqsvx8V/PY/8AUo/j4O/wnrX/ AFMV39x/5rx/k/L/AKrL8fFfz2P/AFKP4+Dv8J63/wBTFdfd/wA34/yfl/1WX4+K/nsf+pR/HwRu kaFqNjdma41ae+j4lRDKPhBJBDfaO/hl+n0s8crlMyHcf7WnPqYTjQgIpvPI8cMkkcZlkRSVjUgF iBUIpNBU9N8zTycQCyxlPzL8qRaWl7qV1+jZ+Rin06cE3UUqmjRmFAzk+/GlN8pGphVnZy/yOQyq I4vPp80n/Lv8wfK8nl+3s7vWR+kIBNJN9eZo34eq7g85fheifysaDKtPnjw0Tu363R5BMkR9O3L3 Mv8AL2tHWdOF+tpNaQyu31ZbgBXkiB+GYr1UP1AO+ZOOfELpwc2Lglw2D7l3m0acfK1z+kdXn0Oz rH6mq2031eWImVQtJKHiHYhTUdDk2phmn3flSS3igh/M64nL8GUve2vqlS0YCN8KuGPAr2b4z7Yq padP5TktJoofzSu5jMPUike9tfViVBTo6V+yRy5D3674q0IvL1hd2nq/mlfM6ycfSlvLZxIvxLwY cOvKEjk3y6nFUx0PUvKFrqEV2/5hy6oLVmpazXtuY3PpOD6ixhfUovxeFRWlcVZTJ598mRqzyaza oiGjsZAAN1Xc+B5ih7jfpiqiPzK/L8sFTzFp8jMQFVLiN2JIBAAUkkmvQYq3b/mP5CuKiDX7GQgc mCzoSFALEtvsKL3xVkeKuxV2KuxV2KuxVBnrirsVaxVSu4mmtZolma3Z0ZVnSnJCRs61qKr1FdvH ARYZRNG+bx3UPN/mfWtOgjub+102yFxaPYXktsWfUFiv44zdgMwjjWMqsrxjen+Sa5rzmlIbmh9+ 7u4abHjkaBkaNi/p9PL9F/pZR5Q80eYNZ1+Ox1SZIIreB7u0e2jZE1KEuYRN+8JaNU2PEfaqG+z1 uxZZSlR/tcTU6eEIXHezRv8Ah61+PvTjzLP5qTzHoEOkTwQabIZ21Y3HEqyIYuCIKeoWKmTjxI33 JoKHKJAdeIk8mJyar+bL6XqElqpe+F+TpwcWgjkswk7JwIXfkViG5rvsRUkNhTEjonEuqefW1PWz bopsY9PL6UWSAQG6FuCA0hl9QN9YDhlYFeI6jGwvCeVJOmsfm1Joel3NtGs00k1z9baZLaOVrYyR CB+KM8ayBWdqA0KjxpjYUxINUyry7qvme68y6zHqNqI9DPA6JMpjaqxExyFuJLH1TSRK9sQQUGJH Nk+FDsVdiqV6z5hj0qe3iewvrv1w37yytnuEj40/vCn2Sa7ZXPJw9Cfc3YsPGCbiK7zTyC31gtf6 z56jtL1tatr6ZIlktJHtUs4ECejM3H91JwG79VPXqc1/HuZ0bvu2d2cXpjhscBiOu9nqO8IOJ08x eXriy1KCeW20SGdrCbToTcr9ZkrP6k1xGvEKgcL6a+5PQZAeqNH+HubCPCmDEi5kXxGtuWw/S9P8 neen1XTdHS403UTd3sCevefVXFqZFX4nMv2QjEVHzzOxZ+IDYuo1Ok4JSoxoHle/yRX5qz+j+Xmo OZFjHqWwZmcx7G6jHwuJ7ShHX+9XMlwXiK6pqFvLaQWd8xZY1MUbX3qfuoDzLgLrLRUcoW4Dbt/l FS39fkto7WJNUdI/RHqTnUKgNcQKWIprKrs/EleG/fkKAqq0mvwlg4vm+stBwdJ51RkkiYo1VOso 0b8VFDyLfaPdiFVhvIZAA2pFBc0eKVdREQKITxFJ9Yckc3kj+F6Ar3rXFXJrumRPNJ9alN36a8pG 1Biv74U4KV1pv3YpQEsxUmrbbBV1vqphSNY7p2u445HkR70SQmFVXjsuscPTUAV+E1Hfaiquk1OG w1WA3E4iuIXEVJrsMUU1Zgaa0aqa1+OvXqwAGKvaPy11jyzqK38uk3E/1iST95aXWonUJBFGT6cy gzXHpLIJOlR+AxQzfFXYq7FXYq7FUIcVaxV1MVSDzbo1je2RupbKa/urdGS2ghnmgqZiFbl6TD4f 5iVag6DKc0ARZFuRp8piaBoHyB+94Zqmhea7GKy06/0SWW1taxhrY3LSSRuChXnOslvz4OwX04ww JqBmslCQoEPQ482ORMoy3PfX6N/mU/8AJkVlrPmG0jv9K1ALbWjWpVTdozyPIOc8zNJxgQIN0WQ1 J+QyzCBKVEFxtUTCB4ZR3N9PkNt/k9D82aDq5sLC00HT7W8itI3QLfTThl3jRQkiuHJ4FiSx7eOb GWGJABHJ00NTOJJB3PuSGHyv5piKNF5e0mOT0nErO8rrzVpjEFJlqF/u+1alvAZAaaA6NstfmPOR WWvl/wA7Q3kHo+W9JhhWkDP9YmPG3KyLSgk3KpKVb4TuSRXsRggOiJa3LLnLrf3fqCk3lrzlInH/ AAzpnOQMs8stxKSRMwWSgWbl/dhafF1B8a4Py0O5P5/N/O7vsZJ5O0zzHZ6tdnUtLsrO0KMsNzau 7SOUcKvwvJJwVolU7dxk4Yox5BpyaicxUjbL8saXYq7FUPqSX72E6ae6RXrIRbyS7ojHozbN0+Ry MrrbmzgY8Q4uTx/Wvye83n1bi21Oa7nnZpJR9bKMXc8mYIYo0bc93XNfPST583d4u0sXIxA+H7Ut /wADfm3aQPbQ2STQ3MD2s0tvNbW87W7sSY5SW4NUknlRm3+1kBgyjkPubfzemkbJ5G9wSL/Hu9z1 /wAn22tW2iQW2qW9tZmBEhtrO1ZpPTjjUKoeRjRjt2H0nNhhEhGi6TUygZkxJN9Su8/XWmWvkq9m 1SN5bJWh9SOG5WzkP79OPCdnhClTv9sVpTvlrjvL9N1/8tBDZTmx1K2j2SOSTXoGiV0cRsBy1D7K rsfhHwdqHdVTtte/Li7mSZrPVbe7KAOItcgJPooq0HG+DmqjduIHf5KWUWn5o+RNPtodPtrBZoLS N05Ne6ZI6iElByee75sW4jcnvihGwfnP5NcqfRRCCeA+t6WWALA12utuTb9fnTFUJd/nj5Xgt/VO lmSLihPG60twGZHdVPC5ehohp/XbFWoPzo8pD97Do5ImlMUskc+mir8qNUm4TnQHlUbUIJI3oqiJ Pzg8rTQm6/R8cwRTLODdaczj0pFA4lZ3RiDwI+MdsVej29GiSQxei7qC0Z48lJFSp4kio9jiqpir sVdirsVdiqz0Y/DFWO+Z/MGpaLcwC30OXUbCSN2mvIp4o/SlDKsURSQrX1GagNdj9NFUpHnfzC9n BcR+UbgGZ1RklvbVeAYrV2Ks9FCtXf4vam+Kufzn5sjBV/JN2ZAeKlL2yKOQ3E8GaRGIP7Pw1Phi rJtK1O3vLKGa5jFjdSRiSWxkljeSNSxUcjGzLvTqDiqJN3pQ51uYh6YBk/eL8INQC2+32TircNzp c6hobiKVWoFKSKwNaUpQ9+Q+/FV/Ox4c/VThWnLmKV6da4qt9bTuAf1o/TJChuYpyYhVWte7GmKu 9XTqr+/jq4JX4xv3JG+Krg1iV5iRClK8gwpQAnx9jiq2aTT4ATNMkQAJJdwtAOp3OKtRz6bKVEc8 blmZFCupq6V5KKHqtDUYqrCCFlBG6kbEHqDirGfNmiJqkemM1q95+j7+K+SFJRCeUSSKHLGleJf7 PIfOmxhMkchbZijEn1GmG6d+Xctm1ndRafeJc2rXDhRfwISb2MrOvOOJWov7JDA1oa0GV8c/5v2t 5xYr+vb+qURN5BdoIbQ6dcy262D6cWF7DF+6kcuwKpEq1q5+yOOwqKqhDxz/AJv2oGPFX1/7FNPK HlKfStUivZUu4zFp66f+/uop0KROHQcUjQl6s558upbbpk4SkeYphlhAD0yv4UnHn6fU4PJd5Lpj yx3qNCY/QjaVyPXTmvFYLw7pXf0jljQ8t0/WfPQhRpp7+gUkyx2zgp6Cln4h9DouzcwvLqAK4q6x 1Xz6HjS7lvmkQes/C2YliYgyqVOiNQMhYbE9aHfYqVqar51EE9nJNqqRSyHlcR27szI3p9eGjlUH p/vKK9anfc4quTWfPMhmLreyojhZILi0meEoTSSoGjoQeg4oP2i3GgIxVUOr+era1SC4n1AiSOTn MsHJfVQKYwvHRXqlNuR7Fv5d1XX+o+fIYOTSX9DAodEtpCgcClOX6CcEsqAsKjc02AxQyDyjP53v 9Qa8KTXPp0W606/klgtuEi/DKgn0y2Z3LxFvhegr70xV6jZPePaQtexpDdsoM8UTmRFfuFcqhYf7 EYqrYq7FXYq7FXYq7FWN+fhYt5du0uLVLlnWJeEllLqCFTPHTlBGULgNRvtbfaoaUKry6x0fSvRL XGlWTwSssaN/hm+C/CnwR8Wk9SpLoeQSlF+0eylfAbZjDG1lYxJCzNBbyeVNQBRlJdd/WNGBYftU +fdVD3DaJNAqx6BaiVUpxbypdScUTl0IlovIcSACQprU9aqphYaLptz9at30/TZkjLemp8r3kXog fFRKs54iV/s07n4tqYqu0FfI0NxcprnlyK+maL1LWG38s3VuyJCKsrrIJ+RPwAb0Hc74oTx/+VP/ AARv5SIEgVgf0FcV+I0ptb8ifEe2KoqF/wArhOqp5VdJIz6yONCuaK0kfqMwZbcgNRAD3rt44qh7 SD8qJr5Y4vKUqNaMeE36GuFTkwcFQoh5Nsrfs0r74q61l/KaGAxQ+VJY42U8l/QV1VgEdTyJgq3w sw+nFWjD+UssPJ/KDKlOSj9CT8iBUfZWEsPsGladNu2KpxpOgfl1rdxdCLyxHE9pKzyG90xrZXea qs6CeNA/L0tyOm3fFWW2dna2VpDZ2kaw2tuixQQoKKiIOKqPYAYqohQRViAp2FerGlaAd8VSrW/M +gaI9suq30doL0MbZ5CQjhAC3xgcVHxDqd64qgl/MHyM5AGvWNWAp+/QdakAVPtiqaaVrGl6rbNc 6dcpcwo5id4zUI60JQjqG3GxxVR83SJH5WuWee/tQGiIn0pDJeKRMhHpoqvyBOzjifhrXFXn7aro 8t5On+L/ADUDIHR7VbKasXrFgo+G05I3++679MUqMl3YBpI5fOPm9WeiRyGxmjDs5ZSsYNorFh1o BXw9lCJS8sDJKD5w8zosEPoT1spQWdJOQdK2p+OjlTxXkR/q4pbjnsdNdhdeafNsxRo5OTWkzo6P GZCFItXUA8qGvxKRQUpihAv+joYbWP8AxT5zkP1jigEU5c/EHJesIZoyCBvX5dRilG6dfaYl1BfN 5q81zxWQV2sZbK4KukbIGSTja/vKkjkalqV374oZg/5oeWU4Vh1OjsEQ/ou/3cry4bw/apvT6emK sntLuK6h9WJZFUkiksUkLVBp9iVUb8MVVsVdirsVdirsVdirGfzEjFx5Wu7b1poCWgkaWCC5uHVU uI2JVLR4pe2/FwaV7Yq840NdGhnkTXJtc1OV2pElrb69EqusisCJJrmcfaUAMpHzxVMLj/lX8Z/S P1TzULi7L0MR1cSh4VA4bOKGj8V3p70xVMre2/L69tI5Uj8wFbUy+nLy1syj1hxkXmrM9Pgpwr1r tu1VUJaN5AvCTFb+ZzcQF4aM2tBwCn85fitVjBUMwPTbFUVK3kmznW4WHzRLLRmCL+nHXoVIo54b DkQPu7YqheH5fSPcc4vNKRwOI2lY67Q1qfhWpkptvVdsVVIovIVsttNHb+ZqwuGhHHWg7GMqvEoa OyqAG6cetN+QxVXg/wACX8caRt5mEaHijE68qsUZVqznY7kfaO3tiqEvE8gMsjyxeaJAJDWEjW3L uByBUyVIKlftBhv1NMVcH8gtLta+aJSZCCJDrXFfTKzcw8rinHh1B5feMVZb5IsfLsL6jcaOuohp XjS5bUvrpJ4BnT0/rm9KSn7P04qynFUpv9Otr+OJZ5JYjC5eKWBvTcEihAYb0phEqQQlHmHyp+k7 WytbS+ewisY2iXiiSBwQvHmrUDUaMGhqp8K0ISbSEluPyymnikEutP8AWGdXSZbS0AXiZCAycKN/ efT37UCbTby95V1LSLr1H1mW5tmEjS2ZhhjjMkhU+p8I5Ajj0rihF+edEv8AW/KF1pthDDPdTPCy R3Hp8CI5kkb++huY68VNOUZxV53a/k95jE1w7W1naiSRJYxDNZniUaNgq/7ilIUcfskkHjuDscVW 6h+UPmqaJ7dLXTJBFGi2t1ILN5D6TUAYPpxK81qzDky16d8Ur0/KjzT617NJp9gGuJWkRY57MgMz 1D/FpQHwLy4sRXfp3VQhZfyd83TQ85rPTnuYoVRH52TNKQVFJC+lsSfTJXly6qDiqb6Z+SktzqN3 LrhihidWWOW3Gn3EkhlRkYsTplqVpyr38MVRy/kF5XQuY7yUFxQ8rTTHFNv2WtCv0gV98VV7L8kd DtJLeSO/lrBKk5X6rp4V5ImYxuQLbZlD0+GmKs00bSL/AE+S5a61i61RZuBjW6W3X0uNa8PQihry qPtV6YqmeKuxV2KuxV2KuxVjX5iOq+Vb0zGCO2UwO81zdyWMYK3MZoZ4gXjr2I70FN8VeT2Gr2AW S3bUNMRIWMsZHmq+HxEoS3qUDKHfrvWvbeuKq9xeaZHJcW95qOmhIpI2ihfzTqSvwVecLUYFXqjV +HvTcHopUbjWLGFg0uoaeLeJ5C0f+J9UWQ+uiNzqEZ2Up2oR88VXvquneuFhvrAoaeoz+bNRjb1I jx4upoVNKnYN7EVpihDTalb/AFSGOfUtKnUOssciear4N6j8SxYOTXiyVHJh3+hSyPRdI8z6taNe 6XFbXdtcj0frcXmTU5owFXg9RGi8yFHHc15Hl4nFCNt/I/m6PSpYprFJbqaZW4p5h1ZVVEU0qWRi fi6iu/hsMVTLS9F89aJcXU1hplrcvMeCNda3qNwPSQ/u6R3EMoRqHcqfoAxVPBffmHX/AI4+l8eK nfUJweRUFloLRujVFa7+GKtJqH5iGVwdF0zgJnVC2oTKDEFBR6raSGpJIIKjFWjf/mNwkP6G0zkE BiH6QmNX5AEN/ogoONTtXp77Kp7prai9hbtqUcUV+yA3McDF4lcjcIzBSQPlirEfNXnCXQtRSJp9 LSBrf1mS8vGt7n4XIcpEsUxZAu9fY9twqxqT82L4sywXHl1pEfiQupyPGFA5M3qiBR9n2p1NdqFV XP5nag5ZYLjy0WD8Y1/TDMTXcAj6um5H+1scVTbyx53vtc1M2cB0e4SEFrv6rqLyzoAeJb0fq45A Nt9oD38VUb+Z0oh8hX0/1j6v6LwSCUSGJqrOh+FhcWW/h+9HtU0GKvFV1qaGIXFzq09u19apJE8d +fgkMjQyF45NYJb4YmB35V3+EimKUXNfO16VuddCh4IKXEt8WMqlVBq36cRivV9xTr07qqZ1xJbh mudTl9RT65mjvPSVF9VOBKtrMqhWcoU4qoNQeXHcKtT65+j717U6nKtvau1ssX6RkUBVmdUJI1p1 4rwHIcB8u+KqMGrS2sN7JJdEGJFMT298Wf054ZIluXj/AEwRsXjPLtUb98VVpdRvbCRHfXeNvJwW XhqDswYxRlDtrMT8JCGKk0O3xEL8WKql3r1rLqSz3tzLJpqOkFzEdRUevHH6blWJ1n7SSsxFVagY Er2xV6/+WcOgS6fd6po0t68dzO8cwvL0XwLxsSXV45riKrBxUq1TTfepKhmeKuxV2KuxV2KuxVIf O1nrN15duo9HuvquoH0vq7tIkKhlnjYn1HinoSqld1INae+KvNz5c/MsxxyHWLM39AVkjvrSJgwD rxAXS/iHF+hagxVfP5f/ADSeIhPMNt64Yoed/blQqhDE3BdOAB4dv8qu29VKPXy9+YlY2GqL9XiI +sRve2sihkcKVPLT+jIftcgxGxAxVCR6B+aHqXEC6rDIrLBGhiv7cShlVX5MTp9XdwT1pyUmvuqq Pov5kStaXi6zE0aL6qqNRtUh9VjzdRTTHV1YEHfufDFCIstO/Nv6jd2SaxbSXCKZI7j6/A7Rs2yB lXTB8JKnrSprviqpJpX5pNI0v6cW2DRqzP8AX7aRUb4iq8DpiLSritDuB1PZVCwaH+b8Ulzy1pjG i8oZDfWzcXjCsySB9Pb37bDrXqVVf9Gfm9dOrR6qsMbRxtOq39rRHNVZQRpcp2K9fxOKqh0b80pD MTrfOGaMKJFv7ZWRiisx+HTAtVJNOIXanjUKvSWu7RSA00YJIAqwFSaEDr3qMVVQQwDKag7gjoRi rD/OcvmeG2tJNAh+sTeuqXEXoQz/ALkq3KomubMU5cej1xVjFlqf5l3NrcG40gQTvFMEBsbclZ1j Qc6tf0YO/LjVTX9aqdWWl/mG62slxf6VEAVaWE6e/qBCRyjJW7dAeIA+E0qOpG+Ksnsrd4YEE3pP csB68sMfopI46kIWkKip6Fj88VS3z/cm38jalMJRCyqgWUyCIBmmRR+8NxY8dz19Zf8AZfZKrwWL XZpKtNeNcQwoweBdQ/vI41WR131pzQIrCqq1D40AClVhvrzUmUHVTWNldEh1AuG5yBVDhtaBD1O1 CKfzEbhVStdXmlDPcaxx9RZLoytebepRvhoNbVSx4emtRWlK4qiE1LjDLNNqfG2imdLwC6c7xL6i iq661TJyKjj+0PEVxVXGqxi7mSXWx6iXMvqsL+QI8YdBGVji1sEADmeKn7I+WKoZr94HZDrBjPqA BZb5iFiliSZC/wDucoyj1CPhRq07nbFWR+TtIbWfNMVjJJPcafxM0stvfyFkiKloZS0erXTfEyIm 8TA+21FXuWn2UNjZQWcBYxW8axI0jGRyEUKC7tVmbbcnFCvirsVdirsVdirsVYz+YNhpN95bvbfU Ybl4XWL1JLO2F1OFW4jYcY2jmVqMAWXifhqe2KvKpvKX5dfWWaUa5cGQq/qNoMK7tMKnkbCPlTgQ 3IFaE++KqV75Q/LeGeSWSbWIwVR0UaFC0SKUqq0NiV/b39+u++KppB5R8grptyTLrH1aV4lvEfQ4 wCRIJVLcNPWgWnxNWnjXYYpZE9z+UenvKR5WeLg3puU0K54sUIA3FvxPse+KF01n+UsNsbtfKkgE Sqx9PRLuNys37kjeBOa8XPJakU+jFVBG/J6zLOPK0sJjZZRKdDvAQ8cg4gMbeqnkQKGleh60xVHG 0/K2dGlbyszqUVjy0W5LUh/doOJg5BlHQU6e2Ko7QfLX5aarFPLY+WoIo2T05Rcaa1srozBh8M0a BqNED4r7V3VTOL8vfIkSssfl7TlDUr/osJ6Ar3XwYjFWj+XXkEsHby7pzMFChmtYSeKqFA3XsoAx VbJ+XHkGQqW8v2FVZHUi3jFGjAC9AOyivj3xVkEEENvBHBAixQxKEijQBVVVFFVQOgAxVivmy6S2 Wxc3l/Z1uo0L2EBuAQySiky+nKBGf2jTYhemKsQTzBbrFGw8xeYxzV1ELaajvVg8YlZfqbSf3icg B0qNgMVXDzDaiyEieZfMLhYgWmXSufKkki/EPqRC/E1D0NFG/iqyKxspr9LW+g81XxiQiaWB1tEJ SRwwilT0FdOPEpQ/ENwd8VR/n7WL3R/KE+oWcsUM8MtvSSdYWjUGdAdp5raOtOlZBv8AfirzKL84 dTubPnDcaeLiP1Y5YXj02NXIibjIA+qlqJxI8CDTeoxVUu/zU1qCx02SG406OWZFE/KKw9MhhyTh x1Oq8GDV5EDfxxS1Y/mzerbQrdS2LSl40eWKPTQJK8uZf/clxBZCuwpv022xVCQfm7rL2qcbrT2j QcmdrbT4WYlmVnpJqigt/qrTFCtF+aPmZZLuGWXTpbiCST15Ta2JHUKAzDVUQkSFF2O21a4pWx/m prLXDrcX+jPGJykcj29kzCMCqvUamicFLKAQS23SooVCZz/mzrRuLiK0kt7a4ieaKYywWSoqxSKA zhtSR14cjUseO/zxS9A/L3zRFr3l+GSXUIL7VIR/uQEL25ZC7MYy6W0twiclG3x/OhqAoZPirsVd irsVdirsVYj571XRogml6pZatcw3cRm9TS47lwDbyI6qXtiHVy1Ke3UjFWG3DeS4A0Elp5vuZa+k 0qjUlICyhOQIaOOneqivHb2xVSbU/IAu5rQWXm8zqn2Q2rc2iHEBwnq8+IK8aso3BxVFmfyZbGSZ dN82yS2/KP6qG1Ni/wAFG4hpQhoG+1y964pXaBF5JnurW3gtvNCyah8MU1y+pCNVMhdecnPgo7gn t13xQzFvy70E3Yujc6mZPV9fj+k77hy5cqcPWpSvbFXf8q60CqH6xqlYySh/Suo7VoD/ALv9sVXt 5A0M8f8ASNTBVWUV1TUG+2pUmjTsAaHqO+/XFWl/L/RFpW61Q0Xif9ymoCtGDV2nHE1H7NMVUYPy 10GGERLeatxDOx/3KXy15gihCTKNuXWlfEnfFW3/AC08tsXIl1JDI5kkK6nfjkxFKt++322xVUtf y+0S1YvDdaoGJBPLU75lO4JqjSlDWlOnypirJsVYr5t8vS65Z29tGlg/pSmVhqVp9dj/ALtlBROc XFqt9quKpJpn5cW4v5H1uy0PULImR4o49LSKUyOy/G7s7ofhWjUTf2xVPT5I8nG1a1OiWJtn484/ q8dG4BVX9nsEX7sVUl/L/wAiqsir5f05RIKScbWIbcg/EUX+ZQcVTHzPYT3/AJaubS3v00yaUxiO 9kBKoRMjUIDxH46cftd+/TFWO6X+W/lfTtPSHUdSuZL2vK7nXUbyBJHUEH92bhqfB8Jqa0r4nFUz byR5SVWmN1dxxiMpVNTvIkRG+IUCTKopSoxVDw/ln5RA4wXWoAMtAqaneEFWWgFPVp0SoxVbN5D8 ixCSVry5tkUCNyuqXUaJsCdvWCgsrb+Na9d8Vbf8vfJE0BlN1dskbPcC5OqXbMlSzswlaYkL8RJ3 oep33xVVk/LryrLK8rXeotLNWjfpW+r8TV2/f/If24q6fyJ5QmdQ97eh4qzGmqXgbi9E5N++rxrH QduoxVk2nJYQ2y2tm4eO2VY6eoZXAVQF5uxZ2biBuxqcVROKuxV2KuxV2KuxVi35i6lLpvl24vFu Lm0SMwVuLaa0gKk3EY+3dEJUjbfYjbFXmN157YSCWPzHrMVmzLEtx9Z0Jo2elA3JmqOXBidqV9ji lObXUvPV7Z2bpH5l9K5QSRXdu+jSI4kBdH5gcSnBxQ0FaDFCe3MnnRp50hg8whWUQrMH0RVUHcyK G5nkpXj06N8jiqXGf8wvSinW38zM6SJyt2fQVRgVXnVlUSda/s08OOKrbz/lYKXhWE+Z2VkZlp+g /TJjBWgfiSobanJOR60NMVXyp54uWAMXmaN7RCUJm0iJZmASPi3pFh+yz9+v3qr5LLzxHboFuPMz zlHZyH0epIAKpurIN60O1fHFW7f/AB9Mri4/xLBwkjRSP0ETw9L4mPEDlR1NaVqG2FcVReh3nnS0 vhdXNj5h1KAxmJra8bRo1DUVhIqwPE1diNz377kKp3J5s8wrLKF8pai0cQJ5erZBn224D1yD3rVh t4nbFU30PUdQv7R5r7TZdKlWQotvO8UjMoUHmDEzrQkkda7YqmGKvK/zI1FbPWI3is5prkWYYTx3 GqRLX1T6cfpWMTxuSa9X5camlBuqwa81Nl1A2U2lXbBpj6bJfa/KxYbxqJWtxJR2FRxU1602GKUX PqMIhklutLv1jY+tJ/uS8xFk5EAjjJa/bDV+7r05Ko3Q9d1WHV7VodHvUdrmGKFprrXzAYpSVJdJ LcRcl+AnkOB3PhRV6J+Z0UkvkDUY44TOW9L9yI/W5ATId4/q97XpX+6PzHXFDxoeXpAIZ7XSzPLI ha6Qae0KLGoHqIQmkRswap5CoZv2etMUqi6Bc3N3FE+grHLLwjkkmsgjeo05UMZBoXp1fkBUj7O/ XFWS/wDKnvNLXEU722myyRuGeS5NlKXVVUUcfourVoRXnXFCyb8m/M9y9vHPZ6eqoqq90rWEj/DG AKqdJjJ+yFpyNPfclVqD8nfNcV40qWenJCGERjDWRMsIEiszt+jKBmVwvwoOQ6774qov+S3m+JGN tbafWeH0Zo2ltCgo4IIC6VGKHiDSnia1OKq97+TXmGRHkt9PsIJgzmCASWUkSrIi1Xk+lhvhYUGx NB9rvir0b8vvKB8u6UTOFXULxITeRolsFQxJwVA9tb2ocKNviX5eJVZVirsVdirsVdirsVSLzlaa ldaNJFp199SuneIRuZY4B8MquxEjw3HxcFO3GhxpWCReVfzSuLKWMawkoDVikgvrdQHVyRxKaWCh C06Hv9yqpbeV/wA44IJYU1igDIIQ97C6+mEYEchpqOKcVpSnWvtiqsnlz83ZLxb2fU2R2mAeziv4 hB6FAG2/R32jwXp4kilaYq0/l785YrBUg1flcRPSNnvLdy6kA1ctpg+yV6bk8jvtuqsn8u/nMHuP S1ZvQdma2jW+t+aV/mZ9MJK1Gw5bDbfriqtaeWvzX/Tlq0+sTwabKpN40V7bXHpHkx4okunJy+1t X/gthiqft5J10ytIPOWrLVgwULZUAViwUA25Heh8e+Kq1p5Q1mAUfzZqswIcHmtkTVyDUH6t1Hbt irrbyfrECFf8WatIxXjycWTnYEVHK2bfp93zqqs/wXrPp8f8XasGLcnf/Q6sACFH+89Fp/kgA/tA 9lVW28qa1DcwyN5r1OaGIAG3dLHi1DX4m+rcz99fftirJcVYP5straa/WO58pfp+3nhRJrtRasy8 ZTxiKzshovMvUHFUgh0jRJb5km/LNo0kaCJpymnsgAqofj6uwRe438emKso/5V15B5Bv8OaaCDX/ AHkhoN69OOKshVQoCqAABsOwGKpJ5/vLuz8m3dxaTT286vCFmtS4mXlMinjwguzuDT+7P0dcVeUf 4486PMxXVdUhto29ALJBJ6skjs5pyGjsqloqMg67dN/hUq8/mjz/AHElvYzX2pRW8jKRdwpLDJIj SvUVfSk4uq/skjltQmuKrX81+fJZIlXVr2rOIZUg50ieOKIq0xbSWePmWPOqU5VHiAqirnzX5/mu 2+r6ldwyTIoihKP6auWZm4udHZXISm32qVNPBVD6T5l/MS5vbVbq+1WNbmOP96I3HEbpJ8H6IZOQ ahA41puXp8WKqJ81/mBNBPaxajftcvGz+pSdZAqlCVjH6JRWqK0ZF5b+A3VRNt5w86xOWfUNRZYU iKwBZnDcvTYGRn0TkFcK5Jr12+EdVD2LyxcLcaFaTLd3N8GVqXV7EsFw9HI+ONY4AtOg+AbePXFU 0xV2KuxV2KuxV5v+ZHmHWtN1yCCxvJLeJrVHZEIoWMkgr9wGc92tqsmPKBGRA4f0l3vZemxzxkyF ni/QEj0DzDrV/rESXt29wiQ3TBXIptbu3h/kjB2Vq8s83DKRIpn2lpccMVxjRR2u6nqdjELnTdSE I4IJ7aEksGJNC5KKKitM2PaoyRh4kZGIHTvsuB2b4cp8Eo3awa1qJAP+L1FUDEGOaobuv2Kfjmm/ MT/1b/dfqdn4Ef8AUftH61p1zUPTLr5u+IRh/TMUwPOm6fYp12Brj+ZnX9907j+pP5eN/wB19o/W u/Td9UL/AIv35cSfSl4048uVeNaV26Y/mJf6t9h/UjwI/wCo/aFNte1QK5HmsNxDFAI5atxGw3TY t2yJ1OT/AFX7/wBTIaeH+pfd+tWOsXwkkX/GK8Vr6TelMeQpUVolB4HfJ+PKz+++w/qY+BGh+5+0 frWw67esU9TzcyAllfjDKxHGtCKhaq23WnXpgjqZdc32FMtPHpi+0L11q69MFvOLCQg1UQSkCgqK khT122GEaiVf332FicAv+5+0NDWb2iF/OPVgHCQzGgJpUVVa069sfzEv9W+w/qT4Ef8AUftCn+nN T9J2/wAXLzUMVQRzVbj0oTGOuR/MTr+++/8AUnwIX/dfd+tqXXdTWJmTzYHdVYiP05gWKj4QDwp8 Xv8A7SdTOv777/1JGnhf919360x/LvzFreo6+1ve3kk8IgdgjkU5BlAPT3zI7K1WSeWpSJFNHaWm xwxXEUbTfz1MI7GAPfarYI8vH19HgM8tfSl+FgsU7BTtU8eoXcdc6N0DGX1dpYovR1/zOKigkTSN iahgTyse4fttQb9uSqaaB5ttrO3vGu5dc1ImQzq15pk0UkUZUfABHBEjhSP2VrvirMNOv4NQsLe+ twwguo1liEilH4uKjkrbr8jiqXefY9Ll8l3yaqJ2sCYfWFrDFczEidCnGGZJUergbFDtirze18qe Q3uCn6Q1L61I8SWvq6JCGjYGP0+PKxrVQ9AK7DltsSFKFt7D8uLhWlbUtVacRtHFy0WAGEoalARY 8VasnFhy4tWhrtiqJm8tflykzXDzaqEv44+RXRIgo9TgVduFgA7MxUlKH4m+z0xVY2gflrcS3Lh9 SW2jeO7uYDocC7IZHQEPY+owYEitD7mmKt22mfl3BCjtLq8FwzGaFpNEj9SNuBSMskNj6fJaVWor 0P2TiqnJ5Q/Lu1uYFFzqkdzbSSn1k0CMk8SCoWunsPhMfwNQ9cUJtoUP5RWWnxfWtOn1SOQhYbi6 0Fhw5cQOAgs4x8fIEHdj41xV6P5RutAuNEjGgWpstMheSKK2+rtaBWDEvSF1Rl+NjWq7nFU5xV2K uxV2KuxV5T+a0Mr+YrcojMPqiCoBP+7ZM5jtoHxh/V/SXo+yCBiP9b9AYlZvqFncCeBHWQK6VKE/ DIpRhuO6sc1+mzTwz44jdz8+KGWPDI7J3rfmKXU9OSzXT2gKLGC43qYxQk0Vdzm01naYy4jARNmv vt1ml7POLIJmQoIxfOD+mivpskjoFX1HFuxIVSve2P68xhrtvp/3P/EN50W/1f7r/ilieZbQQvGd Kmo8Zjb4batCApo31ao2X/M7gDVxquA8v6P/ABCTpZXfEP8AZf8AFKv+MP37Sfo2XgRTgVt26E0I /wBHABFfD51yX57e+H/c/wDEsfyW1cQ/2X/FNnzgnBk/RkvCRm5IVtuIVjXZfq1OW/U4/nhy4T/s f+IX8kf5w/2X/FKZ81QeorLpcygApIoFtRkrzAIFqAfjUHevfxwfnBf0n/Y/8R3p/KGvqH+y/wCK 7m4/NVssplbSpuTOWPH6uBSpoP8AeYnpTviNZG74D/sf+IU6Q1XEP9l/xS1fNMCRJGmlzAJUCptz s5HLrbdwKeGAayIFcJ/2P/EJOkJN8Q+3/ikFqGoaTen1JdKuRMAVRlkjRQNyKrHboDud+/vlWXLj nuYSv3j9EQ248c4bCUa9x/TJDodA5HnpV6EqCCLgFh0qP7mhyAOL+ZL/AE3/AB1mfF/nR+X7Usnt 2aZzBbyxwliY0erMF7AsFWv3ZjyjvsDTfGW25Fss/K2GZPMrl0ZR9Wk3II/aXNp2MD43+aXXdrSB xfFnet+XtP1iONLtp09Fucb21xNbODwdPtQsjHaQ7Z1LzSWH8vdBMccYm1FVijMSBdSvlopUJXaY CtB/XFVsP5eaDGiqLjU2IVFZjqd8Ofp0ALBZgvbwpiqJ0ryVo2l3qXlrLfNKhJVJ7+7njNVZN45Z XQ0DGlRtiqn+Zp07/AGojUuf1MtAJWi+rVB+sx8D/phEFOdK8+2KvGwnkC2kubhQ8lqwMXNh5WJq ZkUOFX4SnJGUGhB60ABqpXSSfl+LFLQJSKWQMC0nlsmEzGhZuI7RRVqA+zbmtBiqItv8I6xbwpKZ Sxd4WnJ8tPGBGVQMxejcePpLsnYbHaqqXQ2vlS5lWSRbhrYQCRFWTyw6IUk9NuBlCIqseCjitSx3 5HYqoieb8vbqW0mHO4T0Wab1B5aEoCqyp1dQpjjQbFWAAXavVVTvv8CTlEd5i1SRB/zqxZeLJCkR oyt8PHbwU+HI4qqQyeRLaUpcW7SypLT6lP8A4aX4UWNnikl+GMJycn4Arcq1HwnFXtX5fa9ouq6O 0ei6cmnadZP6SQwNbPAHf946obZ3Sq86v/lHqeuKGUYq7FXYq7FXYqhvWk8f1Yq0bhwCSwAG5JpT ASBuVUF1WBn4LOpboOn66UyiOrxE0JBmccu5q91e1sYllvbuK1idgiSTOkal26KC1Kk02GZDBDy+ adEhVXl1W0jViVVnniUFl6gEnqO+Ko6O7MsayxSB43AZHWhVlYVBBHUHtiq715f5v1Yq168v834D FXevL/N+rFXevL/N+AxV31iX+b8BirvXl8fwGKu9eb+b8BirvXl/m/AYqk+teadF0aWKG+mZZ5ka SOGNGkfglOTkIDRRXqcxdTq4Ya4r3cjBpZ5QTHkG181eWWjikOq2iLOkcsQkmjRmSYFo24sQw5BT TbsfDMiMhIWGmcDEmJ5hcfM/lr0/U/S1n6ZXnz+sRUK+l6/KvLp6Xx/6u/TJMUZa31jdq7WlxFcK hVZDC6uAWRZFB4k0qjqw9iD3xVLvPN7ptl5QurnUkkltI3h9SKG6Fi7VnQAC4MkAWla05ivTFXlj +dvy+WF7iOx1Z/XDtIx10GpdjEyki/ccuIZ05bnjscUq6eaPy9uLtJ4rHVZ5Ld44YP8Ac1CyN6RM Mbn/AHIEfaXiGOzV674qojzN5GleEXGmatDcuSIoY/MEbh2Z/THDlqCsQzVpxFNttqnFDI9P/Nry bolktpZW080Cs/pSSajp08rmRyw5PNetLvyqOfbFUQ/5xeUrewgvY9NAku7j0ViS60urEBSz80uW U8RIoIrUd6DfFWovzi0B7ySyfRWW5iWVpIxdaU3FVbk3Ii6oKk1I/Xirpvzu8roI2NhylI5gC+0c hdwtef1ynSmKsv8AKHmvQfMWnmfS3iSRKNdWSS28skJdmVfV+rSTIOfpkr8XTFU+xV2KuxV2KuxV BnriqS+ZrmeK3RIiFMhA5OCVBLKoZgCKheVSKj55rtaOOcMd1GV38G7HsCXnNtqOqltPjXXdPuLh JboXhiZn+sLaiT+7UyFaScKkgClRTbL5abFOUsfhmIAFS/b/AG31axOQAPFaffmNfWcflCzk1CO1 mi+vwxBL6GCeJuSuPszz2i1Ck/EJKj5VIh2fkMsQvpszyipPMf01pUkwnXSNBSC84LDyttPaRQzA TS8FvyzJXkpHb6GrmtbJNP8AzW1OLT5Leyl0+2t7QILSJEsCkcCEKIiv6WjPVlQMPuHXFCpb/mx5 nis5Lq8uLJ1Blt1KfUAqTqvNCwOogNUHoH2odjtirdv+aHm+VZZfrFoxgiLmERWQDRtbpJ61f0nt 6TNV6OdmFVXspU/+Vo+cFvliuL6xhjgd/rEwisvQZUZkX4pNTjILMjfDyBqNu+KFkX5qebr2Sb0N R02L0vUkSApZmV1iTm6cBqT/AM2x5fs798VRVt+b+rLdvb3l3ZAKf3hC2UDIay/BybU5k5/Co3+z 37nFUOPzP81NcI/6VsPqSu8QKpZKZvTFeSk38i/GwCdVozAkUxS9I8lz+b7ixlm8yIsMxcLBB9XS BwAoLMTHdXisCTQV4kUO24xQyHFUm8yeUtO19U+sTXFrMiNELm0cRSmJ2VnjLFW+FjGv8MozaeOT 6nK02rli5AEdxVofKvluK0gtBpttJDbpFHEJYkkbjApSOrOGJ4q7AE+J8cujEAUGjJkM5GR5ld/h jy3w9P8ARNnwC8OP1eKnH0vQ4gcenpfB/q7dMLBE2OlaXp4cWFnBZiTj6gt40iDcV4rXgBWiig9s VUvM2hz655cn0uCdbWSdoyJmEpC+nKsm3oS28lfg7OMVYKfyb1oQxBdaBljIJ/e6oEbZ1Pwm+cii stKHx7bYq0fye8z9V8yhWLrLX/ck3FkG32r886sF+3Wm9MVRCflN5j+tx3EvmLk6SmSqnUV4ipYB Ab9koD0UrQDxxV0P5Ra3SMT6+3GIKUEb6gCCY1SWha9PVkBU02xS0Pyi1xrppJNepDvwVG1OtTF6 dTyv2HXrQV8DihXu/wAq9ckhvBb64ILi6uJZllH6QHBZ6NIopfCv7xAw7dRShOKpvaflpYtARql7 d3Fz8SrNbXl/bj0ywZAQbmUllpTlX6Biqc+XfKml+X/rX1B7lxdsrSC5uJbjjwFAEMrOR133qcVT nFXYq7FXYq7FUIeuKoXULCK9tzFIBShG4qKHYgg9Qcx9TpxlHOpDkWcJ8LHovI1qsdjbOkRs9NYv YQEBlhY1qyAqN9+5679cx5Q1UxwykADzI5sh4Y5BNtV8u6bqmmjTrsSfVxUgxyPE9WRkJ5IVPRzm ZixCEREcg1ylZtJYvyu8qxmL/e1xDE0CK99dEcH58qj1Nz+9bLEKi/lr5VS1ntUjukt5yrOiXl0t GHH4lpJsTwX54qpSfld5TkLs63jSyV5Sm/uy244mh9XYEdcVVIvy18sRWL2SG99F+tb67JB5K1RW WgP7sU22+k4qt/5Vp5b5Sv62ol5ldZHOo3pYrIQWBYy1IqO9d9+uKrYfyx8uQzXEqzagxuV4SK1/ dMa0cFuRk51YSGtWI6GlcVVYvy58uxywTCS/L28ouELX94wMg4btylPIfuxscVZF9Utag+ilQ3IH iKhq1r061FcVVcVdiqK+rr4nFXfV18Tirvq6+JxV31ZfE4qqIgReIxVvFXYq7FXYq7FXYq7FXYq7 FXYq7FXYq7FUGTirq4q6uKtYq7FXYq7FXUxV2KtUxV1MVdTFXUxV1MVR2KuxV2KuxV2KuxV2KuxV 2KuxV2KuxV2KuxV2KuxV2KuxVS/0f2xV3+j+2Ku/0f2xV3+j+2Ku/wBH9sVd/o/tirv9H9sVd/o/ tirv9H9sVd/o/tirv9H9sVd/o/tirv8AR/bFXf6P7Yq//9k= uuid:202d19e5-6a87-be43-af52-e46a2fec472a xmp.did:18d95579-f83b-418a-ba70-33bab9c08d46 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:4de50672-b33e-dd4c-8990-1523adc05c5c xmp.did:da8dadbc-e447-495c-84a7-2850076dff6d uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:ab17be08-b65f-453f-ae7f-4fe23b51a1d3 2019-02-13T16:27:05-03:00 Adobe Illustrator CC 23.0 (Macintosh) / saved xmp.iid:18d95579-f83b-418a-ba70-33bab9c08d46 2019-05-29T15:22:05-03:00 Adobe Illustrator CC 23.0 (Macintosh) / Print False True 1 215.900000 279.400000 Millimeters Chivo-Bold Chivo Bold Open Type Version 1.007 False Chivo-Bold.ttf Chivo-Light Chivo Light Open Type Version 1.007 False Chivo-Light.ttf Chivo-Regular Chivo Regular Open Type Version 1.007 False Chivo-Regular.ttf Chivo-Italic Chivo Italic Open Type Version 1.007 False Chivo-Italic.ttf Cyan Magenta Yellow Black Grupo de muestras por defecto 0 Blanco CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Negro CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 Rojo CMYK CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 Amarillo CMYK CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 Verde CMYK CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 Cian CMYK CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 Azul CMYK CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 Magenta CMYK CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 P Charcoal CMYK PROCESS 100.000000 CMYK 65.792322 56.157774 58.059049 62.648964 P Citron CMYK PROCESS 100.000000 CMYK 13.846035 14.843976 94.692910 0.973526 P Cardinal CMYK PROCESS 100.000000 CMYK 24.188600 100.000000 95.858699 21.084915 P Charcoal CMYK 2 PROCESS 100.000000 CMYK 65.493244 58.352023 54.680699 61.406881 P Citron CMYK 3 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 Grises 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brillantes 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 5 0 obj <>/Font<>/ProcSet[/PDF/Text]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 7 0 obj <>/Font<>/ProcSet[/PDF/Text]/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 20 0 obj <>stream HW%; ܟ5Rv= 0`4Ue'ܹF︓8]_g:ZLGﯟ~ۿ?oqQu*|X`n]eB^':y"ۉ>mL313FY]5sԛzuDR="awƿx+y-||&㾽u3]gq#=9+{0\iqCgXPWyvdjGh,)s;ڑʐH\Vұ= ]F*gOMbAR:g}Z3om㑞/Mg ǎZ<-p{ A:D2p+ /_JԺvr++)"@:\/ex.C`ۛy_Z9x7aO?-$囍OjlPPJ*ڄ ?3%~rlQ  >gMBp̳NOK?_^.FD~SsDc?̊aڿNCx Tnj4)| w. jy;#(3M0T| \i9Ի=Hȶ$mYV 04~L)l(^L|kc>{#|k@"߿?˷Os>}Ȼ; -o2ֱ 2a˼ϯQvqQ#$18fئdxI,9[wݱp4[ lxb? m ^QR> 5PX˾Ϳ N!bSYS9[i2YBmEYq9!*CB"$Rni\jƫ%* s__5.}L~$ا'vsӏO'Ȣ',FRRR(6ȟ9L.G:P4 c{HblŒh|yyf;Ʊk=OOYOຩGA8Q#l qڜ5f4䄐&IrUlr(Ek#"5w(+vWL̢j"ASJ-j7$Rn2"%aE 1E-@@5$,TI+.GX%"DEhYD_ce[pJm:ӎv%D<ܒmŴ%A/ˇޙ% ^duW.F2 U5 ? "^kEJ4H!,`VUC:(xRPOQ8y 効1XZ{7V4"/WPXqE0eL nٰ$=;?-,e%^tjJn:-S% 2ZMeVݤ []bUOXGY~Wmj|[\9 j[V[Ezy߫ޛY⛲ս&8VV֦:J 2/4VNJ~W ֍u.i_dfl+oi?^h5_5! x%TE"F4d:njǴ]hL$#=Gs ҝJ|'TR%7ĝ<;22$ة lm^kݽN 3< hxI^Wxխо{SOʽ0|.,E7 / 9 | +J)^JeI Jtۄ~v#^>. Ck ,<3k$65;4|:G3h<{< ktomH Ugyln~Xezene2. Sd L6;d="KVOǝπ-;R݄"d.L=Kv.FLo{J#Nےjs,-n{z%m>cҁlu"{)7{b!R-%w'6( #2 |ZKzAi05&G7[0qfpO_YyӢvގ?WI#ؗ_ef RLA0ff,fViS2Q[qVE(tT߸u8.6H2'놦n0!nM.!A8kD6*Jia %>t49"JᡦBUI\$ZnV')JHY lh-`”DH.`U4Š.!K {kL*(ۤҕQbZtdSdt3ySG;OF SL8LߑPH# p6\ YI$-'jSK Տb6 #!5ڑ!7DFuOYV|97-qɄ :~h\`{CQTk Mlz=+粿{EErE(E0|:Nu߅{ nc[E)q]|?;}X92((5Gctd]~N!)ejhDvPY[1@Ո1uFCcYkƵDȢ,,XG%g0EQSyvzA2{5Dmp5X0|<%Xv&EyGVqHALT} W24'hUOl⡑{f86wz=,%a+,DzI1|淚F;:9agh#pl_ - &!@`9]{šy!@IxQ?НSKfxPyfM҃](cAr1=5|[4ϽMMc :z2) >ⰼ#DJH8H&ҕ#+Csn ^.nSP'](VՎ:bYG Dez2I$E=g:bJu)"2COL*bV +0\A'wJ]@!ԡNaiѻUT YUJh (FWYwՑmB9itg8,*#OYW)D쬮ȱTAv|Di,3HBA}L4%FՎg 4`_)w9CUE@&MP`8[tnE'mY{ltm fsPJ)c'9bp7s[l,HE&"y-Fuub-`>C0ޕ'U<䶒l\Y45?E5K WF@\ !?_" x-Xѣ̴#zVaJwhuCt*ZiX䣨WQ; QKVWa/lL &K<2 Cj).@e!$GS`v`#A]h/ M"9ng7xYBP tY(re* -yسu8 v)j1c oKRБj-+dz}11Xg##JBCݽH,+K"׳Cr(ءQ06kfZpA`l8ΧΗ.oJ}C%Z*`";*okV'v~h^10M+oxq^྘mTjK4F}T@ m?'|>]>}'!k]2ބoZ{@t\I4"t![j1]Q(qGw f#5RC:RSfC.Qh($Ec1%`bdy7ԯoa "ҪNN;1u CAJ;cF1O,Z o RJ”EVi2nT/( kF@q}*7ȜSFAT+rSnfvK3]& Ȟ12dRʀM&wVm ] ,Yd>3M^z1q0spUTyr0>M(A/9Z{F/xL#89q60V uV5{mas{ێXswJH~dMO] nCŢjUP&P֒d-C:T~,/;% YΒFأHz81+~+.V:q|iڋ^g8S3mҍW$!WO_ Z5^JFlf띫Ǽ#@vM.ڀg/ll=ocۃ}UU呻6`T-h,w7cGKvL3\¢HOuL $v֞|44_} 7o/R&:<7Ms0laͳd|f3enCF#RWW+F5 W Y. ~ZC[ܑxL3\EFu=!e}UNb;l #j(jf>ĖгB [ʥ};2E_cJ>z8eHk+l҇!cl };yZ 6$*ɑ~| Lg_KJUx`64cJ\""e#4,e DJ] ;˼/hmεM:xnNx9ǡȣJL'zm#YeT/)LqPm"Bԉx~>: ty/ mX2],C/9~?-އy;%̢]G/`&k9|f^AY D83eg#G=%c)2,"1Hw*"[rkC1YbB@_> =~ūܿ+[Uxl^TG>*Ŧ-67D}atR#dT\LלnݣMc:peu @Nfw8jQ+|X2W=N;l | {KT58"ᕕ[фS/d:V8DB5N^Za}X P "l{vŞN Ju>G,Bb|v{ f<pguR"42m\ӚQI?7Oʮ])i˻>Tۗk0 GX+V zvM S-MxB"fxaA_"E\װR酺ER93H0H)%jw긁劯pfܖbj=FGp}YvXUoRjهX$2QwCk/qOU拳ib}M,r }7et f}I\A#%_)9>Pr%<%J^JC#%JSrW)y$[eB{Ѥrm'nܺ'bwq2v9MK='. ٬1o(_xe<ځĝ#߄FѬfj'N^yDa@ `|df£5?oSJP Of XXIJ_FlZBs6l5ۏH%DMcFkӽ/ij_~-tF۶u=%guPk&`[h_ SG/U@kU]ikmg)/@ǍxKNMᲶl)̣47fGޟ@$|\_0uFUhLݮ4t҂ z i ߀ }bʚ{VPX.yJKn{>zCbC\^ϋۼ1!0b_}peFl(vF69'š`SpݙKmMBe Mfaׯ#Yo)Q6B|}I4Vi]ϻFdМ+E.ۅ1C>f]ftP{9Y,辏:vz_a="x:ý/LK~@o:E(g &ݢ"bj7GuܑԢߊ6(_`W6VJd.VV/>oKUAA WNq۞t!/~ AjjA#є9rCjp'SK_?,o]Ly%Ƞ̧PcIհ+=}mv^kӫ s3tuz8T^Ң[wGR\Xu˒/<cj>XuT,:UV:LiTvMː@ (Pzp'1[bjw;]ҲTe%ﳋ,Or)fEsIiTKczĈtS&˵{,q>_t0"xjKL>p,l(V'W!_ ㄝ=G.2>K6i/hihz94Q[̃\jU Ђgd]VC[֬`ǜQ@UH -R,;>WV qb'Fmd 1&/&d"0T91ꙹ dJo 3WkaiO،HpGLk; 2=Q$&6`?tCd:VUն7rD|d?;(AHFd;ޯO3`_fwuuSX?)^52Cx#sz5ᆹBH@Dd.LRY!M%m#g*f:"!jX˙35"DUҿ]({g yKm$tg@X7w??[-'خ\Hs(a,>},tHYu:^Po);wt3Esj*}EdEu]Q^9Qp0JOنee>6fW~)zNdfikLWXiPVQ'?lht؍nG49zǪgj~VC74zy)_>t4S8CgYOlt{e{'~6mh {=?O 2FP0ضo;UWjmmlxX.AtF#xOÆ|ʸG9fz8>QtlZ1}nCqkeL?>x"h&;C:F.0BsS dBJF !GAg^ŨA !Mΐl?]5^&m9?Iƌ1D1+ItQ97%Hq(;{d&Z!1Ae@/+&kzlȅf%&`/drDɞN5X?qcN\VOʻ܁fI(H÷O8]ŚȝvVWy9gm734+P[`^"1>l\z>h\ͧ`T.6x>\D&n`PP#zswET8쳌׷ 2=Ɏ2RcR#} rQ(k4EйZ) 2W>m<ӸҬTY#( 7CYvQEnuV 򕢠] 6G!Pb{H8PWc12{ m:Ξ3@Pf Fs,2݃*ݛvӘmc@ e#%jYG`A&:P k@% e;C9qu.OV%n10jyAy*tx-b,IX`VN<"o^̵YQ ֔& z#vQatZSH G| )-.Y,#%زCts e6QC\PcS-}Ha^k XŒBd~Vcz kËGKy`N_"xUvr;7<cQ ;owW(粝Ύ9i~m'~rQ%i: gY&CsIoӲ }tщTxgbiq7\tb! {`SJ wn`@ÚI=(oK ΐz5|̺ >^E,;~ :!z[J]QH+-U|UȑdJK3omh}"f<&;6#ޘ@[@VHUFJkh>HI -eHV.&H=QM~6}0&6$ΒaehzCGi{hCT8-[ h Z]FcK&aJL QL*UwMzƼ"N`g'Vc4:`t4.4C/U|β)hJ+#^]$m76uoVCV"Ah~Z)$#4Ѷ/E\r?@'!2GwkZQ$A!v?Hx5#Όۣ7JEpzCԱ4[ԍcISUͨkpZ6w;P<ā= IZT{0*.D=9&a:Fwt)SarKc^v(moA5!?BڊZ^֤u-:?vנ6̈́yg:iVuR')PZOI;`on5: h4hhm3Igz2YP;{q*- <hJ kq5ZFE [P- jl*7~l5xޑVn7:N6IS;uvc/S_f6#5?(?_?c}29{;$MJ1y*6{։!d!yVsTc*V5nZ/JB52T#b6`. ~gGKtD hѴT?rS^V ]RڜU1j["]Tƈy^*Iq@P$VK㽄0E0g[Wn;0h5 ش ЀfnɄ䅰Ƅ jxSo/ X82= R쟬SU5^+‹TY#hdq:QqVq `b DG&Z@`5XmAqk\Ǐ[[#O_+ғf0R/R168ZWTshH{~"NݵΜI!<04IKDvF(4@-XϙeCc}/KVYeeh쓳;(|!S3f;'+=@>U= @ m"w6OM7{_9?_bJ⅝4))C9o~{EBUɖEUvGUDq5+Q5}d쯖^1z%1|>YPn2;;tɉ_2i:Omqu]MÅUf  XQQ. $xRed3>DQŤ&R\`EXԘJF~{.{51c^\O=$ڏ',ڭl%B_o_;RW)NW<$NhSQUVH2U}(Ѵa[r]E׆3&`BXv甘ͮĎLήz@i"*v$~J%W6u׈GmKNwCD$ ]r l0YD!M?^=mH8 P._fj%aukH?Gʾ/M.²k|x"2}CFSs7zxQUV!+U9D!pX$%Ks9go 1JTZ W2/u*xIc/$G itXMV7.<vڠQtIbvV5XU咀v7cX57/:)iy V7ϯLjlWpF"5Tnn\/tFʋ(Lݾ +I-MutՐ< ۽oU%]|)^٦J[QkV҂0fÙ2i{a6b\Gz0jtBziYo2w?OojVy&_ԯ GHlS+ ʎ"AQ;_H2,u,r>tu=Pm"LMtӘ11U:<=&l%R6[-g( y<\f,:.T ; (uSsb(Na0r ,Y2tHcgp=e%LIp /30Pc8C3\8+8 0v=S!*db@G~7S7 h 14 8!F =]Fwi$C61- /ЖaCӆONhAa Q r 1.h4Ȥ&jJG &cށ!iR=cm|McCzq:iH5?M~։l=Q85-&fOT8.G=j0f&lb9:B"iA"GU8IqC:2e :y(,\RcY oS6qeB}cF &y0J%P}-FV P%W y# 2Ƶ'h\>#@WpsdY}ؑXpIe1H2({8Um}Ϫ96HM < _N4m|_.v΃ueeY%DSAi2b=Hc7Xŀ$_̽>G)cc\}'VPQ9Q %Hx5ZVmN:[A&06ir&ߕ @ 'p@Xf(c 989enq=yI\A0FdRnp/ρ 9) yr%f_ mH] gg L]j{Z,. ?7WD`/a 93R^-mYtϯ襸 S0 ^,`rX3G~9lZlȾ]uo9mK  v F,zJwAB/L QmQcDU8ɈVmGF*@")*-} O(0%`p= R:F 9'1Z˲e Hqdǃu0NJ4 q43ᙩ)b#(DxB wݴmYpgu|G@(!]'GvC*D]h4BePC_kƫ\yyɜx#`ч,dWD9Bmme00 ܯBȆ.Q{>95+$v/berROb o 8W NaSfmLVn1D#Dgv$oVHFW,vl*P"A>E9y@$.]^X)d5ZxW`ǁwU=ZQNMwh^R 6Yφ8yβL+gG()E˦_99Tu1 YӤ"ъQ@͚E^ QHnAeix@J>Y; TGt $0K9afd\%?äDuD1%kI߬$kj›ŴUOHD$xd'C-AϑsCkaL 7 D)AfS> FRBsB53EfuF yZ 0Tه53#bߜ0Ȅ k%nH9>:Gr6-ͳ'1WAr;>sJ(Mka@Ů"*C2 kb`Y);W^hcMMhc9iF_!L[%Eo1JyP^&j CQt?^%U`&\+ł20~[`HI+V+hjQ&d2M2ce6# c,t"d͘eHu]rJ0NSGmYrRMu*-iL)W &Y{^pacZ#&]愁ۼ`z|:/w䈍6 -pfv.97x\%;'"p\Ya5*B#|7rЎ,QȐW?\L f my#DᚺUH!:!`gixs0L'W?F {8A*'RS#;pڳӄ-ETP1 ji\ ʩ x^+&b'rTs6.3FXskG;;`Ih%l'ڤ N9+d  *jx- '?z:LWV>.X @SSS]`2*UA' oQGD1 T C}mnLn`X!"00VA|NVdj߮Q@`m028tTڴ}o]^LעxxFjNx+L֜\C=Zc~3{~%eHjP|߇z{o^>t t89c?9>\fk_otqo5{ʙTOͻm%;[73Z qzöS"=?_~TD4ty7tt+n`V8)ӌVF%vBwp:`m$Y" ňX0;0\Lx ]> 1IqN JJP@-N-8hٯsklhpbakw{( z3lqs !epPX}\ ,/. /V: 7棜1v\QD0ЯI(7ʡA\Yw&AX@\ 0y + a aot|b q5/VmBqXD5} 3 CpS8Ba۞ɱ%D*>Qщʰ㈛B-#_g(sDv,(@&Vh9YF#p ʺ=?6n (3I3P8F$i2!253'8ƹ&=5ⅇ#pgaJC<ʧ$5x}n:Wqc`I˴N EΙ?\& tфNWQ .mh3[tmD)(*V\#BJ j 39 H\i16L8#z\F" <8s s61ܠ5`ݔZ HMI*+pVH ,.n[R_- endstream endobj 21 0 obj <> endobj 26 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs 629.656 648.785 -647.312 151.908 re f endstream endobj 27 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 323.4297 301.7949 cm 0 0 m -2.039 1.987 l 419.253 427.315 l 421.279 425.297 l h f Q q 1 0 0 1 314.2744 310.9521 cm 0 0 m -2.023 1.957 l 419.253 427.271 l 421.264 425.267 l h f Q q 1 0 0 1 305.0879 320.0488 cm 0 0 m -1.979 2.019 l 419.3 427.285 l 421.324 425.312 l h f Q q 1 0 0 1 295.917 329.1758 cm 0 0 m -1.993 2.002 l 419.284 427.316 l 421.311 425.298 l h f Q q 1 0 0 1 286.793 338.332 cm 0 0 m -2.024 1.957 l 419.269 427.302 l 421.277 425.282 l h f Q q 1 0 0 1 277.5913 347.4443 cm 0 0 m -1.994 2.002 l 419.315 427.331 l 421.309 425.312 l h f Q q 1 0 0 1 268.4512 356.5557 cm 0 0 m -2.009 2.002 l 419.284 427.332 l 421.294 425.313 l h f Q q 1 0 0 1 259.2808 365.6973 cm 0 0 m -1.994 1.987 l 419.284 427.316 l 421.308 425.312 l h f Q q 1 0 0 1 250.125 374.8242 cm 0 0 m -2.009 2.002 l 419.284 427.332 l 421.294 425.314 l h f Q q 1 0 0 1 240.9849 383.9512 cm 0 0 m -2.009 1.986 l 419.253 427.315 l 421.279 425.298 l h f Q q 1 0 0 1 231.8145 393.0771 cm 0 0 m -1.994 1.988 l 419.284 427.316 l 421.292 425.328 l h f Q q 1 0 0 1 222.6587 402.2197 cm 0 0 m -2.009 1.986 l 419.269 427.316 l 421.279 425.298 l h f Q q 1 0 0 1 213.5337 411.3765 cm 0 0 m -2.024 1.972 l 419.239 427.286 l 421.262 425.268 l h f Q q 1 0 0 1 204.3481 420.4731 cm 0 0 m -1.979 2.018 l 419.285 427.3 l 421.277 425.313 l h f Q q 1 0 0 1 195.1772 429.5996 cm 0 0 m -1.994 2.002 l 419.269 427.316 l 421.292 425.298 l h f Q q 1 0 0 1 186.0522 438.7578 cm 0 0 m -2.024 1.971 l 419.254 427.284 l 421.262 425.282 l h f Q q 1 0 0 1 176.8662 447.8687 cm 0 0 m -1.979 2.018 l 419.269 427.332 l 421.293 425.313 l h f Q q 1 0 0 1 167.7109 456.9795 cm 0 0 m -2.009 2.003 l 419.269 427.347 l 421.277 425.329 l h f Q q 1 0 0 1 158.5859 466.1372 cm 0 0 m -2.024 1.973 l 419.254 427.316 l 421.278 425.328 l h f Q q 1 0 0 1 149.3999 475.248 cm 0 0 m -1.979 2.018 l 419.269 427.348 l 421.278 425.33 l h f Q q 1 0 0 1 140.2446 484.375 cm 0 0 m -2.009 1.988 l 419.253 427.332 l 421.278 425.313 l h f Q q 1 0 0 1 131.1045 493.5171 cm 0 0 m -2.024 1.988 l 419.254 427.316 l 421.232 425.329 l h f Q q 1 0 0 1 121.9185 502.6436 cm 0 0 m -1.963 2.018 l 419.269 427.332 l 421.278 425.314 l h f Q q 1 0 0 1 112.7632 511.7563 cm 0 0 m -1.994 2.018 l 419.269 427.33 l 421.293 425.312 l h f Q q 1 0 0 1 103.5923 520.9126 cm 0 0 m -1.963 2.034 l 419.314 427.347 l 421.278 425.313 l h f Q q 1 0 0 1 94.437 530.0234 cm 0 0 m -2.024 2.02 l 419.269 427.332 l 421.278 425.313 l h f Q q 1 0 0 1 85.2969 539.1357 cm 0 0 m -2.024 2.018 l 419.27 427.346 l 421.263 425.328 l h f Q q 1 0 0 1 76.1108 548.292 cm 0 0 m -1.979 2.034 l 419.314 427.348 l 421.293 425.314 l h f Q q 1 0 0 1 66.9707 557.4048 cm 0 0 m -2.024 2.018 l 419.27 427.346 l 421.263 425.328 l h f Q q 1 0 0 1 57.8306 566.5312 cm 0 0 m -2.024 2.018 l 419.254 427.332 l 421.263 425.312 l h f Q q 1 0 0 1 48.6445 575.6733 cm 0 0 m -1.979 2.032 l 419.27 427.346 l 421.277 425.344 l h f Q q 1 0 0 1 39.5044 584.8003 cm 0 0 m -2.024 2.018 l 419.254 427.33 l 421.262 425.328 l h f Q q 1 0 0 1 30.3643 593.9424 cm 0 0 m -2.04 1.987 l 419.253 427.316 l 421.231 425.328 l h f Q q 1 0 0 1 21.1782 603.0688 cm 0 0 m -2.024 2.018 l 419.254 427.33 l 421.262 425.328 l h f Q q 1 0 0 1 12.0225 612.1802 cm 0 0 m -2.009 2.018 l 419.269 427.332 l 421.278 425.343 l h f Q q 1 0 0 1 2.8823 621.3379 cm 0 0 m -2.04 1.986 l 419.253 427.316 l 421.248 425.328 l h f Q q 1 0 0 1 -6.3037 630.4487 cm 0 0 m -2.009 2.034 l 419.271 427.332 l 421.294 425.344 l h f Q q 1 0 0 1 -15.4438 639.5913 cm 0 0 m -2.024 2.018 l 419.269 427.33 l 421.279 425.312 l h f Q q 1 0 0 1 -24.5845 648.7334 cm 0 0 m -2.039 2.018 l 419.254 427.3 l 421.249 425.328 l h f Q q 1 0 0 1 -33.7695 657.8599 cm 0 0 m -2.04 2.002 l 419.269 427.33 l 421.263 425.312 l h f Q q 1 0 0 1 -42.9248 666.9707 cm 0 0 m -2.024 2.018 l 419.269 427.316 l 421.278 425.314 l h f Q q 1 0 0 1 -52.0957 676.0977 cm 0 0 m -1.979 2.049 l 419.3 427.316 l 421.278 425.328 l h f Q q 1 0 0 1 -61.2358 685.2397 cm 0 0 m -2.024 2.018 l 419.253 427.316 l 421.263 425.313 l h f Q q 1 0 0 1 -70.377 694.3965 cm 0 0 m -2.054 1.972 l 419.255 427.286 l 421.278 425.313 l h f Q q 1 0 0 1 -79.5776 703.5088 cm 0 0 m -2.024 2.018 l 419.316 427.332 l 421.279 425.312 l h f Q endstream endobj 28 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 327.957 297.326 m 325.917 299.313 l 747.21 724.642 l 749.236 722.624 l h W n q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 568.1971436 340.4717712 cm BX /Sh0 sh EX Q Q q 318.802 306.483 m 316.777 308.44 l 738.055 733.754 l 740.064 731.75 l h W n q 0 g /GS1 gs -61.2378426 340.9762268 340.9762268 61.2378426 559.036377 349.6287842 cm BX /Sh0 sh EX Q Q q 309.615 315.58 m 307.637 317.599 l 728.915 742.865 l 730.939 740.893 l h W n q 0 g /GS2 gs -61.2388649 340.9819031 340.9819031 61.2388649 549.9105835 358.7363586 cm BX /Sh0 sh EX Q Q q 300.444 324.707 m 298.452 326.709 l 719.729 752.023 l 721.754 750.005 l h W n q 0 g /GS3 gs -61.2448082 341.0150146 341.0150146 61.2448082 540.7234497 367.8599854 cm BX /Sh0 sh EX Q Q q 291.32 333.863 m 289.296 335.82 l 710.589 761.165 l 712.598 759.146 l h W n q 0 g /GS4 gs -61.2428246 341.0039368 341.0039368 61.2428246 531.5627441 377.0100098 cm BX /Sh0 sh EX Q Q q 282.119 342.976 m 280.125 344.979 l 701.434 770.306 l 703.428 768.288 l h W n q 0 g /GS5 gs -61.2463303 341.023468 341.023468 61.2463303 522.3981934 386.1289368 cm BX /Sh0 sh EX Q Q q 272.979 352.087 m 270.97 354.089 l 692.263 779.418 l 694.272 777.4 l h W n q 0 g /GS6 gs -61.2475471 341.0302734 341.0302734 61.2475471 513.2435303 395.2372437 cm BX /Sh0 sh EX Q Q q 263.808 361.229 m 261.814 363.216 l 683.092 788.545 l 685.116 786.541 l h W n q 0 g /GS7 gs -61.2448196 341.0150757 341.0150757 61.2448196 504.0853882 404.3817749 cm BX /Sh0 sh EX Q Q q 254.652 370.355 m 252.644 372.357 l 673.937 797.687 l 675.946 795.669 l h W n q 0 g /GS8 gs -61.2475471 341.0302734 341.0302734 61.2475471 494.9172363 413.506073 cm BX /Sh0 sh EX Q Q q 245.512 379.482 m 243.503 381.469 l 664.766 806.798 l 666.791 804.78 l h W n q 0 g /GS9 gs -61.2457619 341.0203247 341.0203247 61.2457619 485.7670593 422.6309204 cm BX /Sh0 sh EX Q Q q 236.341 388.608 m 234.348 390.597 l 655.626 815.925 l 657.634 813.937 l h W n q 0 g /GS10 gs -61.2448082 341.0150146 341.0150146 61.2448082 476.6132202 431.760498 cm BX /Sh0 sh EX Q Q q 227.186 397.751 m 225.177 399.738 l 646.455 825.067 l 648.465 823.049 l h W n q 0 g /GS11 gs -61.2452888 341.0176697 341.0176697 61.2452888 467.4408264 440.8997498 cm BX /Sh0 sh EX Q Q q 218.061 406.908 m 216.037 408.88 l 637.3 834.193 l 639.323 832.176 l h W n q 0 g /GS12 gs -61.2410278 340.9939575 340.9939575 61.2410278 458.296814 450.0528564 cm BX /Sh0 sh EX Q Q q 208.875 416.004 m 206.897 418.022 l 628.16 843.305 l 630.152 841.318 l h W n q 0 g /GS13 gs -61.2420692 340.9997559 340.9997559 61.2420692 449.1481934 459.1562195 cm BX /Sh0 sh EX Q Q q 199.705 425.131 m 197.711 427.133 l 618.973 852.447 l 620.997 850.429 l h W n q 0 g /GS14 gs -61.2452888 341.0176697 341.0176697 61.2452888 439.974884 468.2822876 cm BX /Sh0 sh EX Q Q q 190.58 434.289 m 188.555 436.26 l 609.833 861.573 l 611.842 859.571 l h W n q 0 g /GS15 gs -61.2402763 340.9897766 340.9897766 61.2402763 430.8163147 477.4343567 cm BX /Sh0 sh EX Q Q q 181.394 443.4 m 179.415 445.417 l 600.662 870.731 l 602.687 868.713 l h W n q 0 g /GS16 gs -61.2480164 341.0328674 341.0328674 61.2480164 421.6741638 486.553009 cm BX /Sh0 sh EX Q Q q 172.238 452.511 m 170.229 454.514 l 591.507 879.858 l 593.516 877.84 l h W n q 0 g /GS17 gs -61.2507439 341.0480347 341.0480347 61.2507439 412.496582 495.6599121 cm BX /Sh0 sh EX Q Q q 163.113 461.668 m 161.089 463.641 l 582.367 888.984 l 584.392 886.997 l h W n q 0 g /GS18 gs -61.2457314 341.0201416 341.0201416 61.2457314 403.3618469 504.8162842 cm BX /Sh0 sh EX Q Q q 153.927 470.779 m 151.949 472.797 l 573.196 898.127 l 575.205 896.109 l h W n q 0 g /GS19 gs -61.2507362 341.0480042 341.0480042 61.2507362 394.2018127 513.9317017 cm BX /Sh0 sh EX Q Q q 144.772 479.906 m 142.763 481.894 l 564.025 907.238 l 566.05 905.22 l h W n q 0 g /GS20 gs -61.2484779 341.0354309 341.0354309 61.2484779 385.0277405 523.0549316 cm BX /Sh0 sh EX Q Q q 135.632 489.048 m 133.607 491.037 l 554.886 916.364 l 556.864 914.377 l h W n q 0 g /GS21 gs -61.2457314 341.0201416 341.0201416 61.2457314 375.8597107 532.1923218 cm BX /Sh0 sh EX Q Q q 126.446 498.175 m 124.482 500.193 l 545.715 925.506 l 547.724 923.489 l h W n q 0 g /GS22 gs -61.2480011 341.0327759 341.0327759 61.2480011 366.7262573 541.3282471 cm BX /Sh0 sh EX Q Q q 117.29 507.288 m 115.296 509.305 l 536.56 934.617 l 538.584 932.6 l h W n q 0 g /GS23 gs -61.2477226 341.0312195 341.0312195 61.2477226 357.5635681 550.4393921 cm BX /Sh0 sh EX Q Q q 108.12 516.444 m 106.156 518.478 l 527.434 943.791 l 529.397 941.757 l h W n q 0 g /GS24 gs -61.2493439 341.0402527 341.0402527 61.2493439 348.4013672 559.5973511 cm BX /Sh0 sh EX Q Q q 98.964 525.555 m 96.94 527.574 l 518.233 952.886 l 520.242 950.868 l h W n q 0 g /GS25 gs -61.2480011 341.0327759 341.0327759 61.2480011 339.2152405 568.7026978 cm BX /Sh0 sh EX Q Q q 89.824 534.667 m 87.8 536.685 l 509.094 962.013 l 511.087 959.995 l h W n q 0 g /GS26 gs -61.2504463 341.0463867 341.0463867 61.2504463 330.0687866 577.8140869 cm BX /Sh0 sh EX Q Q q 80.638 543.823 m 78.659 545.857 l 499.952 971.171 l 501.932 969.137 l h W n q 0 g /GS27 gs -61.2493439 341.0402527 341.0402527 61.2493439 320.9199524 586.9771118 cm BX /Sh0 sh EX Q Q q 71.498 552.936 m 69.474 554.954 l 490.768 980.282 l 492.76 978.264 l h W n q 0 g /GS28 gs -61.2504501 341.0464172 341.0464172 61.2504501 311.7425537 596.0828857 cm BX /Sh0 sh EX Q Q q 62.358 562.062 m 60.333 564.081 l 481.612 989.394 l 483.621 987.375 l h W n q 0 g /GS29 gs -61.248455 341.0353088 341.0353088 61.248455 302.6013184 605.2093506 cm BX /Sh0 sh EX Q Q q 53.172 571.205 m 51.193 573.237 l 472.441 998.551 l 474.449 996.548 l h W n q 0 g /GS30 gs -61.2504578 341.0464478 341.0464478 61.2504578 293.4487 614.3575439 cm BX /Sh0 sh EX Q Q q 44.031 580.332 m 42.007 582.349 l 463.286 1007.662 l 465.294 1005.659 l h W n q 0 g /GS31 gs -61.2481842 341.0338135 341.0338135 61.2481842 284.2764282 623.4784546 cm BX /Sh0 sh EX Q Q q 34.891 589.474 m 32.852 591.46 l 454.145 1016.79 l 456.123 1014.801 l h W n q 0 g /GS32 gs -61.2457581 341.0202942 341.0202942 61.2457581 275.1112061 632.616272 cm BX /Sh0 sh EX Q Q q 25.705 598.6 m 23.681 600.618 l 444.959 1025.93 l 446.968 1023.928 l h W n q 0 g /GS33 gs -61.2481918 341.033844 341.033844 61.2481918 265.9501953 641.7472534 cm BX /Sh0 sh EX Q Q q 16.55 607.711 m 14.541 609.729 l 435.818 1035.043 l 437.828 1033.055 l h W n q 0 g /GS34 gs -61.248024 341.0328979 341.0328979 61.248024 256.8111572 650.861084 cm BX /Sh0 sh EX Q Q q 7.41 616.869 m 5.37 618.855 l 426.663 1044.185 l 428.657 1042.197 l h W n q 0 g /GS35 gs -61.2457581 341.0202942 341.0202942 61.2457581 247.6371613 660.0130615 cm BX /Sh0 sh EX Q Q q -1.776 625.98 m -3.786 628.014 l 417.493 1053.312 l 419.518 1051.324 l h W n q 0 g /GS36 gs -61.247982 341.0326538 341.0326538 61.247982 238.4938507 669.1315308 cm BX /Sh0 sh EX Q Q q -10.917 635.123 m -12.941 637.14 l 408.353 1062.453 l 410.362 1060.435 l h W n q 0 g /GS37 gs -61.2477417 341.0313416 341.0313416 61.2477417 229.3348541 678.2705078 cm BX /Sh0 sh EX Q Q q -20.058 644.265 m -22.096 646.283 l 399.197 1071.565 l 401.191 1069.592 l h W n q 0 g /GS38 gs -61.2429886 341.0048828 341.0048828 61.2429886 220.1739349 687.4092407 cm BX /Sh0 sh EX Q Q q -29.243 653.391 m -31.282 655.394 l 390.026 1080.721 l 392.021 1078.703 l h W n q 0 g /GS39 gs -61.2477531 341.0314026 341.0314026 61.2477531 210.9922638 696.536377 cm BX /Sh0 sh EX Q Q q -38.398 662.502 m -40.422 664.52 l 380.871 1089.818 l 382.881 1087.816 l h W n q 0 g /GS40 gs -61.2452927 341.0177002 341.0177002 61.2452927 201.8536682 705.6502686 cm BX /Sh0 sh EX Q Q q -47.569 671.629 m -49.548 673.678 l 371.731 1098.945 l 373.71 1096.957 l h W n q 0 g /GS41 gs -61.2443275 341.0123291 341.0123291 61.2443275 192.7086029 714.7814331 cm BX /Sh0 sh EX Q Q q -56.708 680.771 m -58.732 682.789 l 362.545 1108.087 l 364.555 1106.084 l h W n q 0 g /GS42 gs -61.2457733 341.0203857 341.0203857 61.2457733 183.5354156 723.9177856 cm BX /Sh0 sh EX Q Q q -65.85 689.928 m -67.903 691.9 l 353.404 1117.213 l 355.429 1115.241 l h W n q 0 g /GS43 gs -61.2405319 340.9911804 340.9911804 61.2405319 174.3833923 733.0723267 cm BX /Sh0 sh EX Q Q q -75.05 699.04 m -77.075 701.058 l 344.265 1126.372 l 346.229 1124.352 l h W n q 0 g /GS44 gs -61.246582 341.0248718 341.0248718 61.246582 165.2008972 742.1879272 cm BX /Sh0 sh EX Q Q endstream endobj 29 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs 629.656 -41.738 -647.312 180.593 re f endstream endobj 30 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 323.4297 -360.0439 cm 0 0 m -2.039 1.987 l 419.253 427.315 l 421.279 425.298 l h f Q q 1 0 0 1 314.2744 -350.8867 cm 0 0 m -2.023 1.957 l 419.253 427.271 l 421.264 425.267 l h f Q q 1 0 0 1 305.0879 -341.79 cm 0 0 m -1.979 2.019 l 419.3 427.285 l 421.324 425.312 l h f Q q 1 0 0 1 295.917 -332.6631 cm 0 0 m -1.993 2.002 l 419.284 427.315 l 421.311 425.298 l h f Q q 1 0 0 1 286.793 -323.5068 cm 0 0 m -2.024 1.957 l 419.269 427.302 l 421.277 425.282 l h f Q q 1 0 0 1 277.5913 -314.3945 cm 0 0 m -1.994 2.002 l 419.315 427.33 l 421.309 425.312 l h f Q q 1 0 0 1 268.4512 -305.2832 cm 0 0 m -2.009 2.002 l 419.284 427.331 l 421.294 425.313 l h f Q q 1 0 0 1 259.2808 -296.1416 cm 0 0 m -1.994 1.987 l 419.284 427.316 l 421.308 425.312 l h f Q q 1 0 0 1 250.125 -287.0146 cm 0 0 m -2.009 2.002 l 419.284 427.332 l 421.294 425.313 l h f Q q 1 0 0 1 240.9849 -277.8877 cm 0 0 m -2.009 1.986 l 419.253 427.315 l 421.279 425.298 l h f Q q 1 0 0 1 231.8145 -268.7617 cm 0 0 m -1.994 1.988 l 419.284 427.316 l 421.292 425.328 l h f Q q 1 0 0 1 222.6587 -259.6191 cm 0 0 m -2.009 1.986 l 419.269 427.316 l 421.279 425.298 l h f Q q 1 0 0 1 213.5337 -250.4629 cm 0 0 m -2.024 1.973 l 419.239 427.286 l 421.262 425.269 l h f Q q 1 0 0 1 204.3481 -241.3662 cm 0 0 m -1.979 2.019 l 419.285 427.301 l 421.277 425.314 l h f Q q 1 0 0 1 195.1772 -232.2393 cm 0 0 m -1.994 2.002 l 419.269 427.315 l 421.292 425.298 l h f Q q 1 0 0 1 186.0522 -223.0811 cm 0 0 m -2.024 1.971 l 419.254 427.284 l 421.262 425.282 l h f Q q 1 0 0 1 176.8662 -213.9707 cm 0 0 m -1.979 2.019 l 419.269 427.332 l 421.293 425.313 l h f Q q 1 0 0 1 167.7109 -204.8594 cm 0 0 m -2.009 2.004 l 419.269 427.347 l 421.277 425.329 l h f Q q 1 0 0 1 158.5859 -195.7012 cm 0 0 m -2.024 1.972 l 419.254 427.315 l 421.278 425.327 l h f Q q 1 0 0 1 149.3999 -186.5908 cm 0 0 m -1.979 2.019 l 419.269 427.348 l 421.278 425.329 l h f Q q 1 0 0 1 140.2446 -177.4639 cm 0 0 m -2.009 1.988 l 419.253 427.331 l 421.278 425.313 l h f Q q 1 0 0 1 131.1045 -168.3213 cm 0 0 m -2.024 1.987 l 419.254 427.315 l 421.232 425.329 l h f Q q 1 0 0 1 121.9185 -159.1953 cm 0 0 m -1.963 2.019 l 419.269 427.332 l 421.278 425.313 l h f Q q 1 0 0 1 112.7632 -150.083 cm 0 0 m -1.994 2.019 l 419.269 427.33 l 421.293 425.312 l h f Q q 1 0 0 1 103.5923 -140.9268 cm 0 0 m -1.963 2.034 l 419.314 427.348 l 421.278 425.314 l h f Q q 1 0 0 1 94.437 -131.8154 cm 0 0 m -2.024 2.02 l 419.269 427.331 l 421.278 425.313 l h f Q q 1 0 0 1 85.2969 -122.7031 cm 0 0 m -2.024 2.018 l 419.27 427.346 l 421.263 425.328 l h f Q q 1 0 0 1 76.1108 -113.5469 cm 0 0 m -1.979 2.034 l 419.314 427.348 l 421.293 425.313 l h f Q q 1 0 0 1 66.9707 -104.4346 cm 0 0 m -2.024 2.019 l 419.27 427.346 l 421.263 425.328 l h f Q q 1 0 0 1 57.8306 -95.3076 cm 0 0 m -2.024 2.018 l 419.254 427.332 l 421.263 425.312 l h f Q q 1 0 0 1 48.6445 -86.165 cm 0 0 m -1.979 2.032 l 419.27 427.346 l 421.277 425.343 l h f Q q 1 0 0 1 39.5044 -77.0391 cm 0 0 m -2.024 2.019 l 419.254 427.33 l 421.262 425.328 l h f Q q 1 0 0 1 30.3643 -67.8965 cm 0 0 m -2.04 1.986 l 419.253 427.316 l 421.231 425.328 l h f Q q 1 0 0 1 21.1782 -58.7695 cm 0 0 m -2.024 2.018 l 419.254 427.33 l 421.262 425.327 l h f Q q 1 0 0 1 12.0225 -49.6592 cm 0 0 m -2.009 2.019 l 419.269 427.332 l 421.278 425.344 l h f Q q 1 0 0 1 2.8823 -40.501 cm 0 0 m -2.04 1.986 l 419.253 427.316 l 421.248 425.328 l h f Q q 1 0 0 1 -6.3037 -31.3896 cm 0 0 m -2.009 2.033 l 419.271 427.331 l 421.294 425.343 l h f Q q 1 0 0 1 -15.4438 -22.248 cm 0 0 m -2.024 2.019 l 419.269 427.331 l 421.279 425.312 l h f Q q 1 0 0 1 -24.5845 -13.1055 cm 0 0 m -2.039 2.018 l 419.254 427.3 l 421.249 425.328 l h f Q q 1 0 0 1 -33.7695 -3.9785 cm 0 0 m -2.04 2.002 l 419.269 427.33 l 421.263 425.312 l h f Q q 1 0 0 1 -42.9248 5.1318 cm 0 0 m -2.024 2.018 l 419.269 427.316 l 421.278 425.314 l h f Q q 1 0 0 1 -52.0957 14.2588 cm 0 0 m -1.979 2.049 l 419.3 427.316 l 421.278 425.328 l h f Q q 1 0 0 1 -61.2358 23.4014 cm 0 0 m -2.024 2.018 l 419.253 427.315 l 421.263 425.313 l h f Q q 1 0 0 1 -70.377 32.5576 cm 0 0 m -2.054 1.972 l 419.255 427.286 l 421.278 425.313 l h f Q q 1 0 0 1 -79.5776 41.6699 cm 0 0 m -2.024 2.018 l 419.316 427.332 l 421.279 425.312 l h f Q endstream endobj 31 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 327.957 -364.513 m 325.917 -362.525 l 747.21 62.803 l 749.236 60.785 l h W n q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 568.1971436 -321.3670959 cm BX /Sh0 sh EX Q Q q 318.802 -355.355 m 316.777 -353.398 l 738.055 71.915 l 740.064 69.911 l h W n q 0 g /GS1 gs -61.2378426 340.9762268 340.9762268 61.2378426 559.036377 -312.210083 cm BX /Sh0 sh EX Q Q q 309.615 -346.259 m 307.637 -344.24 l 728.915 81.026 l 730.939 79.054 l h W n q 0 g /GS2 gs -61.2388649 340.9819031 340.9819031 61.2388649 549.9105835 -303.1025085 cm BX /Sh0 sh EX Q Q q 300.444 -337.132 m 298.452 -335.13 l 719.729 90.184 l 721.754 88.166 l h W n q 0 g /GS3 gs -61.2448082 341.0150146 341.0150146 61.2448082 540.7234497 -293.9788818 cm BX /Sh0 sh EX Q Q q 291.32 -327.976 m 289.296 -326.019 l 710.589 99.326 l 712.598 97.307 l h W n q 0 g /GS4 gs -61.2428246 341.0039368 341.0039368 61.2428246 531.5627441 -284.8288574 cm BX /Sh0 sh EX Q Q q 282.119 -318.863 m 280.125 -316.86 l 701.434 108.467 l 703.428 106.449 l h W n q 0 g /GS5 gs -61.2463303 341.023468 341.023468 61.2463303 522.3981934 -275.7099304 cm BX /Sh0 sh EX Q Q q 272.979 -309.752 m 270.97 -307.75 l 692.263 117.579 l 694.272 115.562 l h W n q 0 g /GS6 gs -61.2475471 341.0302734 341.0302734 61.2475471 513.2435303 -266.6016235 cm BX /Sh0 sh EX Q Q q 263.808 -300.61 m 261.814 -298.623 l 683.092 126.706 l 685.116 124.702 l h W n q 0 g /GS7 gs -61.2448196 341.0150757 341.0150757 61.2448196 504.0853882 -257.4570923 cm BX /Sh0 sh EX Q Q q 254.652 -291.483 m 252.644 -289.481 l 673.937 135.849 l 675.946 133.83 l h W n q 0 g /GS8 gs -61.2475471 341.0302734 341.0302734 61.2475471 494.9172363 -248.3327789 cm BX /Sh0 sh EX Q Q q 245.512 -282.356 m 243.503 -280.37 l 664.766 144.959 l 666.791 142.941 l h W n q 0 g /GS9 gs -61.2457619 341.0203247 341.0203247 61.2457619 485.7670593 -239.2079468 cm BX /Sh0 sh EX Q Q q 236.341 -273.23 m 234.348 -271.242 l 655.626 154.086 l 657.634 152.098 l h W n q 0 g /GS10 gs -61.2448082 341.0150146 341.0150146 61.2448082 476.6132202 -230.0783844 cm BX /Sh0 sh EX Q Q q 227.186 -264.088 m 225.177 -262.102 l 646.455 163.229 l 648.465 161.21 l h W n q 0 g /GS11 gs -61.2452888 341.0176697 341.0176697 61.2452888 467.4408264 -220.9391022 cm BX /Sh0 sh EX Q Q q 218.061 -254.932 m 216.037 -252.959 l 637.3 172.354 l 639.323 170.337 l h W n q 0 g /GS12 gs -61.2410278 340.9939575 340.9939575 61.2410278 458.296814 -211.786026 cm BX /Sh0 sh EX Q Q q 208.875 -245.835 m 206.897 -243.816 l 628.16 181.466 l 630.152 179.479 l h W n q 0 g /GS13 gs -61.2420692 340.9997559 340.9997559 61.2420692 449.1481934 -202.682663 cm BX /Sh0 sh EX Q Q q 199.705 -236.708 m 197.711 -234.706 l 618.973 190.607 l 620.997 188.59 l h W n q 0 g /GS14 gs -61.2452888 341.0176697 341.0176697 61.2452888 439.974884 -193.5565643 cm BX /Sh0 sh EX Q Q q 190.58 -227.55 m 188.555 -225.579 l 609.833 199.734 l 611.842 197.732 l h W n q 0 g /GS15 gs -61.2402763 340.9897766 340.9897766 61.2402763 430.8163147 -184.4045258 cm BX /Sh0 sh EX Q Q q 181.394 -218.439 m 179.415 -216.421 l 600.662 208.893 l 602.687 206.875 l h W n q 0 g /GS16 gs -61.2480164 341.0328674 341.0328674 61.2480164 421.6741638 -175.2858582 cm BX /Sh0 sh EX Q Q q 172.238 -209.328 m 170.229 -207.324 l 591.507 218.019 l 593.516 216.001 l h W n q 0 g /GS17 gs -61.2507439 341.0480347 341.0480347 61.2507439 412.496582 -166.1789551 cm BX /Sh0 sh EX Q Q q 163.113 -200.17 m 161.089 -198.198 l 582.367 227.146 l 584.392 225.157 l h W n q 0 g /GS18 gs -61.2457314 341.0201416 341.0201416 61.2457314 403.3618469 -157.0225983 cm BX /Sh0 sh EX Q Q q 153.927 -191.06 m 151.949 -189.041 l 573.196 236.288 l 575.205 234.27 l h W n q 0 g /GS19 gs -61.2507362 341.0480042 341.0480042 61.2507362 394.2018127 -147.9071503 cm BX /Sh0 sh EX Q Q q 144.772 -181.933 m 142.763 -179.944 l 564.025 245.398 l 566.05 243.381 l h W n q 0 g /GS20 gs -61.2484779 341.0354309 341.0354309 61.2484779 385.0277405 -138.783905 cm BX /Sh0 sh EX Q Q q 135.632 -172.79 m 133.607 -170.803 l 554.886 254.525 l 556.864 252.539 l h W n q 0 g /GS21 gs -61.2457314 341.0201416 341.0201416 61.2457314 375.8597107 -129.6465607 cm BX /Sh0 sh EX Q Q q 126.446 -163.664 m 124.482 -161.646 l 545.715 263.668 l 547.724 261.649 l h W n q 0 g /GS22 gs -61.2480011 341.0327759 341.0327759 61.2480011 366.7262573 -120.5106201 cm BX /Sh0 sh EX Q Q q 117.29 -154.552 m 115.296 -152.533 l 536.56 272.778 l 538.584 270.761 l h W n q 0 g /GS23 gs -61.2477226 341.0312195 341.0312195 61.2477226 357.5635681 -111.3994675 cm BX /Sh0 sh EX Q Q q 108.12 -145.396 m 106.156 -143.361 l 527.434 281.952 l 529.397 279.919 l h W n q 0 g /GS24 gs -61.2493439 341.0402527 341.0402527 61.2493439 348.4013672 -102.2415466 cm BX /Sh0 sh EX Q Q q 98.964 -136.284 m 96.94 -134.265 l 518.233 291.047 l 520.242 289.029 l h W n q 0 g /GS25 gs -61.2480011 341.0327759 341.0327759 61.2480011 339.2152405 -93.1361771 cm BX /Sh0 sh EX Q Q q 89.824 -127.172 m 87.8 -125.154 l 509.094 300.174 l 511.087 298.156 l h W n q 0 g /GS26 gs -61.2504463 341.0463867 341.0463867 61.2504463 330.0687866 -84.0248032 cm BX /Sh0 sh EX Q Q q 80.638 -118.016 m 78.659 -115.981 l 499.952 309.332 l 501.932 307.298 l h W n q 0 g /GS27 gs -61.2493439 341.0402527 341.0402527 61.2493439 320.9199524 -74.8617859 cm BX /Sh0 sh EX Q Q q 71.498 -108.903 m 69.474 -106.885 l 490.768 318.442 l 492.76 316.425 l h W n q 0 g /GS28 gs -61.2504501 341.0464172 341.0464172 61.2504501 311.7425537 -65.7559738 cm BX /Sh0 sh EX Q Q q 62.358 -99.776 m 60.333 -97.759 l 481.612 327.556 l 483.621 325.536 l h W n q 0 g /GS29 gs -61.248455 341.0353088 341.0353088 61.248455 302.6013184 -56.6295319 cm BX /Sh0 sh EX Q Q q 53.172 -90.634 m 51.193 -88.602 l 472.441 336.712 l 474.449 334.709 l h W n q 0 g /GS30 gs -61.2504578 341.0464478 341.0464478 61.2504578 293.4487 -47.4813309 cm BX /Sh0 sh EX Q Q q 44.031 -81.508 m 42.007 -79.489 l 463.286 345.822 l 465.294 343.82 l h W n q 0 g /GS31 gs -61.2481842 341.0338135 341.0338135 61.2481842 284.2764282 -38.3604317 cm BX /Sh0 sh EX Q Q q 34.891 -72.365 m 32.852 -70.379 l 454.145 354.951 l 456.123 352.963 l h W n q 0 g /GS32 gs -61.2457581 341.0202942 341.0202942 61.2457581 275.1112061 -29.2225857 cm BX /Sh0 sh EX Q Q q 25.705 -63.238 m 23.681 -61.221 l 444.959 364.092 l 446.968 362.089 l h W n q 0 g /GS33 gs -61.2481918 341.033844 341.033844 61.2481918 265.9501953 -20.0916004 cm BX /Sh0 sh EX Q Q q 16.55 -54.128 m 14.541 -52.109 l 435.818 373.204 l 437.828 371.216 l h W n q 0 g /GS34 gs -61.248024 341.0328979 341.0328979 61.248024 256.8111572 -10.9777708 cm BX /Sh0 sh EX Q Q q 7.41 -44.97 m 5.37 -42.983 l 426.663 382.347 l 428.657 380.358 l h W n q 0 g /GS35 gs -61.2457581 341.0202942 341.0202942 61.2457581 247.6371613 -1.8257827 cm BX /Sh0 sh EX Q Q q -1.776 -35.858 m -3.786 -33.825 l 417.493 391.473 l 419.518 389.484 l h W n q 0 g /GS36 gs -61.247982 341.0326538 341.0326538 61.247982 238.4938507 7.292665 cm BX /Sh0 sh EX Q Q q -10.917 -26.717 m -12.941 -24.698 l 408.353 400.614 l 410.362 398.596 l h W n q 0 g /GS37 gs -61.2477417 341.0313416 341.0313416 61.2477417 229.3348541 16.431633 cm BX /Sh0 sh EX Q Q q -20.058 -17.574 m -22.096 -15.557 l 399.197 409.726 l 401.191 407.753 l h W n q 0 g /GS38 gs -61.2429886 341.0048828 341.0048828 61.2429886 220.1739349 25.5703907 cm BX /Sh0 sh EX Q Q q -29.243 -8.447 m -31.282 -6.445 l 390.026 418.882 l 392.021 416.864 l h W n q 0 g /GS39 gs -61.2477531 341.0314026 341.0314026 61.2477531 210.9922638 34.6974983 cm BX /Sh0 sh EX Q Q q -38.398 0.663 m -40.422 2.681 l 380.871 427.979 l 382.881 425.977 l h W n q 0 g /GS40 gs -61.2452927 341.0177002 341.0177002 61.2452927 201.8536682 43.8113785 cm BX /Sh0 sh EX Q Q q -47.569 9.79 m -49.548 11.839 l 371.731 437.106 l 373.71 435.118 l h W n q 0 g /GS41 gs -61.2443275 341.0123291 341.0123291 61.2443275 192.7086029 52.9425774 cm BX /Sh0 sh EX Q Q q -56.708 18.933 m -58.732 20.95 l 362.545 446.248 l 364.555 444.246 l h W n q 0 g /GS42 gs -61.2457733 341.0203857 341.0203857 61.2457733 183.5354156 62.0789108 cm BX /Sh0 sh EX Q Q q -65.85 28.089 m -67.903 30.061 l 353.404 455.375 l 355.429 453.402 l h W n q 0 g /GS43 gs -61.2405319 340.9911804 340.9911804 61.2405319 174.3833923 71.2334671 cm BX /Sh0 sh EX Q Q q -75.05 37.201 m -77.075 39.219 l 344.265 464.533 l 346.229 462.513 l h W n q 0 g /GS44 gs -61.246582 341.0248718 341.0248718 61.246582 165.2008972 80.3490448 cm BX /Sh0 sh EX Q Q endstream endobj 84 0 obj <> endobj 81 0 obj <> endobj 35 0 obj [/DeviceN[/Black]/DeviceCMYK 131 0 R 132 0 R] endobj 130 0 obj <> endobj 133 0 obj <> endobj 134 0 obj <> endobj 131 0 obj <>stream {1.000000 2 1 roll 1.000000 2 1 roll 1.000000 2 1 roll 0 index 1.000000 cvr exch sub 2 1 roll 5 -1 roll 1.000000 cvr exch sub 5 1 roll 4 -1 roll 1.000000 cvr exch sub 4 1 roll 3 -1 roll 1.000000 cvr exch sub 3 1 roll 2 -1 roll 1.000000 cvr exch sub 2 1 roll pop } endstream endobj 132 0 obj <> endobj 135 0 obj <> endobj 85 0 obj <> endobj 86 0 obj <> endobj 87 0 obj <> endobj 88 0 obj <> endobj 89 0 obj <> endobj 90 0 obj <> endobj 91 0 obj <> endobj 92 0 obj <> endobj 93 0 obj <> endobj 94 0 obj <> endobj 95 0 obj <> endobj 96 0 obj <> endobj 97 0 obj <> endobj 98 0 obj <> endobj 99 0 obj <> endobj 100 0 obj <> endobj 101 0 obj <> endobj 102 0 obj <> endobj 103 0 obj <> endobj 104 0 obj <> endobj 105 0 obj <> endobj 106 0 obj <> endobj 107 0 obj <> endobj 108 0 obj <> endobj 109 0 obj <> endobj 110 0 obj <> endobj 111 0 obj <> endobj 112 0 obj <> endobj 113 0 obj <> endobj 114 0 obj <> endobj 115 0 obj <> endobj 116 0 obj <> endobj 117 0 obj <> endobj 118 0 obj <> endobj 119 0 obj <> endobj 120 0 obj <> endobj 121 0 obj <> endobj 122 0 obj <> endobj 123 0 obj <> endobj 124 0 obj <> endobj 125 0 obj <> endobj 126 0 obj <> endobj 127 0 obj <> endobj 128 0 obj <> endobj 129 0 obj <> endobj 180 0 obj <> endobj 181 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457619 341.0203247 341.0203247 61.2457619 485.7670593 -239.2079468 cm BX /Sh0 sh EX Q endstream endobj 182 0 obj <> endobj 183 0 obj <> endobj 184 0 obj <> endobj 185 0 obj <> endobj 186 0 obj <> endobj 11 0 obj <> endobj 179 0 obj <> endobj 187 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2475471 341.0302734 341.0302734 61.2475471 494.9172363 -248.3327789 cm BX /Sh0 sh EX Q endstream endobj 188 0 obj <> endobj 178 0 obj <> endobj 189 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448196 341.0150757 341.0150757 61.2448196 504.0853882 -257.4570923 cm BX /Sh0 sh EX Q endstream endobj 190 0 obj <> endobj 177 0 obj <> endobj 191 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2475471 341.0302734 341.0302734 61.2475471 513.2435303 -266.6016235 cm BX /Sh0 sh EX Q endstream endobj 192 0 obj <> endobj 176 0 obj <> endobj 193 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2463303 341.023468 341.023468 61.2463303 522.3981934 -275.7099304 cm BX /Sh0 sh EX Q endstream endobj 194 0 obj <> endobj 175 0 obj <> endobj 195 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.246582 341.0248718 341.0248718 61.246582 165.2008972 80.3490448 cm BX /Sh0 sh EX Q endstream endobj 196 0 obj <> endobj 174 0 obj <> endobj 197 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2405319 340.9911804 340.9911804 61.2405319 174.3833923 71.2334671 cm BX /Sh0 sh EX Q endstream endobj 198 0 obj <> endobj 173 0 obj <> endobj 199 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 183.5354156 62.0789108 cm BX /Sh0 sh EX Q endstream endobj 200 0 obj <> endobj 172 0 obj <> endobj 201 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2443275 341.0123291 341.0123291 61.2443275 192.7086029 52.9425774 cm BX /Sh0 sh EX Q endstream endobj 202 0 obj <> endobj 171 0 obj <> endobj 203 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452927 341.0177002 341.0177002 61.2452927 201.8536682 43.8113785 cm BX /Sh0 sh EX Q endstream endobj 204 0 obj <> endobj 170 0 obj <> endobj 205 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2428246 341.0039368 341.0039368 61.2428246 531.5627441 -284.8288574 cm BX /Sh0 sh EX Q endstream endobj 206 0 obj <> endobj 169 0 obj <> endobj 207 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477531 341.0314026 341.0314026 61.2477531 210.9922638 34.6974983 cm BX /Sh0 sh EX Q endstream endobj 208 0 obj <> endobj 168 0 obj <> endobj 209 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2429886 341.0048828 341.0048828 61.2429886 220.1739349 25.5703907 cm BX /Sh0 sh EX Q endstream endobj 210 0 obj <> endobj 167 0 obj <> endobj 211 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477417 341.0313416 341.0313416 61.2477417 229.3348541 16.431633 cm BX /Sh0 sh EX Q endstream endobj 212 0 obj <> endobj 166 0 obj <> endobj 213 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.247982 341.0326538 341.0326538 61.247982 238.4938507 7.292665 cm BX /Sh0 sh EX Q endstream endobj 214 0 obj <> endobj 165 0 obj <> endobj 215 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457581 341.0202942 341.0202942 61.2457581 247.6371613 -1.8257827 cm BX /Sh0 sh EX Q endstream endobj 216 0 obj <> endobj 164 0 obj <> endobj 217 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.248024 341.0328979 341.0328979 61.248024 256.8111572 -10.9777708 cm BX /Sh0 sh EX Q endstream endobj 218 0 obj <> endobj 163 0 obj <> endobj 219 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2481918 341.033844 341.033844 61.2481918 265.9501953 -20.0916004 cm BX /Sh0 sh EX Q endstream endobj 220 0 obj <> endobj 162 0 obj <> endobj 221 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457581 341.0202942 341.0202942 61.2457581 275.1112061 -29.2225857 cm BX /Sh0 sh EX Q endstream endobj 222 0 obj <> endobj 161 0 obj <> endobj 223 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2481842 341.0338135 341.0338135 61.2481842 284.2764282 -38.3604317 cm BX /Sh0 sh EX Q endstream endobj 224 0 obj <> endobj 160 0 obj <> endobj 225 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504578 341.0464478 341.0464478 61.2504578 293.4487 -47.4813309 cm BX /Sh0 sh EX Q endstream endobj 226 0 obj <> endobj 159 0 obj <> endobj 227 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448082 341.0150146 341.0150146 61.2448082 540.7234497 -293.9788818 cm BX /Sh0 sh EX Q endstream endobj 228 0 obj <> endobj 158 0 obj <> endobj 229 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.248455 341.0353088 341.0353088 61.248455 302.6013184 -56.6295319 cm BX /Sh0 sh EX Q endstream endobj 230 0 obj <> endobj 157 0 obj <> endobj 231 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504501 341.0464172 341.0464172 61.2504501 311.7425537 -65.7559738 cm BX /Sh0 sh EX Q endstream endobj 232 0 obj <> endobj 156 0 obj <> endobj 233 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2493439 341.0402527 341.0402527 61.2493439 320.9199524 -74.8617859 cm BX /Sh0 sh EX Q endstream endobj 234 0 obj <> endobj 155 0 obj <> endobj 235 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504463 341.0463867 341.0463867 61.2504463 330.0687866 -84.0248032 cm BX /Sh0 sh EX Q endstream endobj 236 0 obj <> endobj 154 0 obj <> endobj 237 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480011 341.0327759 341.0327759 61.2480011 339.2152405 -93.1361771 cm BX /Sh0 sh EX Q endstream endobj 238 0 obj <> endobj 153 0 obj <> endobj 239 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2493439 341.0402527 341.0402527 61.2493439 348.4013672 -102.2415466 cm BX /Sh0 sh EX Q endstream endobj 240 0 obj <> endobj 152 0 obj <> endobj 241 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477226 341.0312195 341.0312195 61.2477226 357.5635681 -111.3994675 cm BX /Sh0 sh EX Q endstream endobj 242 0 obj <> endobj 151 0 obj <> endobj 243 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480011 341.0327759 341.0327759 61.2480011 366.7262573 -120.5106201 cm BX /Sh0 sh EX Q endstream endobj 244 0 obj <> endobj 150 0 obj <> endobj 245 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457314 341.0201416 341.0201416 61.2457314 375.8597107 -129.6465607 cm BX /Sh0 sh EX Q endstream endobj 246 0 obj <> endobj 149 0 obj <> endobj 247 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2484779 341.0354309 341.0354309 61.2484779 385.0277405 -138.783905 cm BX /Sh0 sh EX Q endstream endobj 248 0 obj <> endobj 148 0 obj <> endobj 249 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2388649 340.9819031 340.9819031 61.2388649 549.9105835 -303.1025085 cm BX /Sh0 sh EX Q endstream endobj 250 0 obj <> endobj 147 0 obj <> endobj 251 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2507362 341.0480042 341.0480042 61.2507362 394.2018127 -147.9071503 cm BX /Sh0 sh EX Q endstream endobj 252 0 obj <> endobj 146 0 obj <> endobj 253 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457314 341.0201416 341.0201416 61.2457314 403.3618469 -157.0225983 cm BX /Sh0 sh EX Q endstream endobj 254 0 obj <> endobj 145 0 obj <> endobj 255 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2507439 341.0480347 341.0480347 61.2507439 412.496582 -166.1789551 cm BX /Sh0 sh EX Q endstream endobj 256 0 obj <> endobj 144 0 obj <> endobj 257 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480164 341.0328674 341.0328674 61.2480164 421.6741638 -175.2858582 cm BX /Sh0 sh EX Q endstream endobj 258 0 obj <> endobj 143 0 obj <> endobj 259 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2402763 340.9897766 340.9897766 61.2402763 430.8163147 -184.4045258 cm BX /Sh0 sh EX Q endstream endobj 260 0 obj <> endobj 142 0 obj <> endobj 261 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452888 341.0176697 341.0176697 61.2452888 439.974884 -193.5565643 cm BX /Sh0 sh EX Q endstream endobj 262 0 obj <> endobj 141 0 obj <> endobj 263 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2420692 340.9997559 340.9997559 61.2420692 449.1481934 -202.682663 cm BX /Sh0 sh EX Q endstream endobj 264 0 obj <> endobj 140 0 obj <> endobj 265 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2410278 340.9939575 340.9939575 61.2410278 458.296814 -211.786026 cm BX /Sh0 sh EX Q endstream endobj 266 0 obj <> endobj 139 0 obj <> endobj 267 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452888 341.0176697 341.0176697 61.2452888 467.4408264 -220.9391022 cm BX /Sh0 sh EX Q endstream endobj 268 0 obj <> endobj 138 0 obj <> endobj 269 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448082 341.0150146 341.0150146 61.2448082 476.6132202 -230.0783844 cm BX /Sh0 sh EX Q endstream endobj 270 0 obj <> endobj 137 0 obj <> endobj 271 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2378426 340.9762268 340.9762268 61.2378426 559.036377 -312.210083 cm BX /Sh0 sh EX Q endstream endobj 272 0 obj <> endobj 136 0 obj <> endobj 273 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 568.1971436 -321.3670959 cm BX /Sh0 sh EX Q endstream endobj 274 0 obj <> endobj 83 0 obj <> endobj 82 0 obj <> endobj 34 0 obj <> endobj 36 0 obj <> endobj 37 0 obj <> endobj 38 0 obj <> endobj 39 0 obj <> endobj 40 0 obj <> endobj 41 0 obj <> endobj 42 0 obj <> endobj 43 0 obj <> endobj 44 0 obj <> endobj 45 0 obj <> endobj 46 0 obj <> endobj 47 0 obj <> endobj 48 0 obj <> endobj 49 0 obj <> endobj 50 0 obj <> endobj 51 0 obj <> endobj 52 0 obj <> endobj 53 0 obj <> endobj 54 0 obj <> endobj 55 0 obj <> endobj 56 0 obj <> endobj 57 0 obj <> endobj 58 0 obj <> endobj 59 0 obj <> endobj 60 0 obj <> endobj 61 0 obj <> endobj 62 0 obj <> endobj 63 0 obj <> endobj 64 0 obj <> endobj 65 0 obj <> endobj 66 0 obj <> endobj 67 0 obj <> endobj 68 0 obj <> endobj 69 0 obj <> endobj 70 0 obj <> endobj 71 0 obj <> endobj 72 0 obj <> endobj 73 0 obj <> endobj 74 0 obj <> endobj 75 0 obj <> endobj 76 0 obj <> endobj 77 0 obj <> endobj 78 0 obj <> endobj 79 0 obj <> endobj 80 0 obj <> endobj 319 0 obj <> endobj 320 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457619 341.0203247 341.0203247 61.2457619 485.7670593 422.6309204 cm BX /Sh0 sh EX Q endstream endobj 321 0 obj <> endobj 318 0 obj <> endobj 322 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2475471 341.0302734 341.0302734 61.2475471 494.9172363 413.506073 cm BX /Sh0 sh EX Q endstream endobj 323 0 obj <> endobj 317 0 obj <> endobj 324 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448196 341.0150757 341.0150757 61.2448196 504.0853882 404.3817749 cm BX /Sh0 sh EX Q endstream endobj 325 0 obj <> endobj 316 0 obj <> endobj 326 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2475471 341.0302734 341.0302734 61.2475471 513.2435303 395.2372437 cm BX /Sh0 sh EX Q endstream endobj 327 0 obj <> endobj 315 0 obj <> endobj 328 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2463303 341.023468 341.023468 61.2463303 522.3981934 386.1289368 cm BX /Sh0 sh EX Q endstream endobj 329 0 obj <> endobj 314 0 obj <> endobj 330 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.246582 341.0248718 341.0248718 61.246582 165.2008972 742.1879272 cm BX /Sh0 sh EX Q endstream endobj 331 0 obj <> endobj 313 0 obj <> endobj 332 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2405319 340.9911804 340.9911804 61.2405319 174.3833923 733.0723267 cm BX /Sh0 sh EX Q endstream endobj 333 0 obj <> endobj 312 0 obj <> endobj 334 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 183.5354156 723.9177856 cm BX /Sh0 sh EX Q endstream endobj 335 0 obj <> endobj 311 0 obj <> endobj 336 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2443275 341.0123291 341.0123291 61.2443275 192.7086029 714.7814331 cm BX /Sh0 sh EX Q endstream endobj 337 0 obj <> endobj 310 0 obj <> endobj 338 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452927 341.0177002 341.0177002 61.2452927 201.8536682 705.6502686 cm BX /Sh0 sh EX Q endstream endobj 339 0 obj <> endobj 309 0 obj <> endobj 340 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2428246 341.0039368 341.0039368 61.2428246 531.5627441 377.0100098 cm BX /Sh0 sh EX Q endstream endobj 341 0 obj <> endobj 308 0 obj <> endobj 342 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477531 341.0314026 341.0314026 61.2477531 210.9922638 696.536377 cm BX /Sh0 sh EX Q endstream endobj 343 0 obj <> endobj 307 0 obj <> endobj 344 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2429886 341.0048828 341.0048828 61.2429886 220.1739349 687.4092407 cm BX /Sh0 sh EX Q endstream endobj 345 0 obj <> endobj 306 0 obj <> endobj 346 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477417 341.0313416 341.0313416 61.2477417 229.3348541 678.2705078 cm BX /Sh0 sh EX Q endstream endobj 347 0 obj <> endobj 305 0 obj <> endobj 348 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.247982 341.0326538 341.0326538 61.247982 238.4938507 669.1315308 cm BX /Sh0 sh EX Q endstream endobj 349 0 obj <> endobj 304 0 obj <> endobj 350 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457581 341.0202942 341.0202942 61.2457581 247.6371613 660.0130615 cm BX /Sh0 sh EX Q endstream endobj 351 0 obj <> endobj 303 0 obj <> endobj 352 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.248024 341.0328979 341.0328979 61.248024 256.8111572 650.861084 cm BX /Sh0 sh EX Q endstream endobj 353 0 obj <> endobj 302 0 obj <> endobj 354 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2481918 341.033844 341.033844 61.2481918 265.9501953 641.7472534 cm BX /Sh0 sh EX Q endstream endobj 355 0 obj <> endobj 301 0 obj <> endobj 356 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457581 341.0202942 341.0202942 61.2457581 275.1112061 632.616272 cm BX /Sh0 sh EX Q endstream endobj 357 0 obj <> endobj 300 0 obj <> endobj 358 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2481842 341.0338135 341.0338135 61.2481842 284.2764282 623.4784546 cm BX /Sh0 sh EX Q endstream endobj 359 0 obj <> endobj 299 0 obj <> endobj 360 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504578 341.0464478 341.0464478 61.2504578 293.4487 614.3575439 cm BX /Sh0 sh EX Q endstream endobj 361 0 obj <> endobj 298 0 obj <> endobj 362 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448082 341.0150146 341.0150146 61.2448082 540.7234497 367.8599854 cm BX /Sh0 sh EX Q endstream endobj 363 0 obj <> endobj 297 0 obj <> endobj 364 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.248455 341.0353088 341.0353088 61.248455 302.6013184 605.2093506 cm BX /Sh0 sh EX Q endstream endobj 365 0 obj <> endobj 296 0 obj <> endobj 366 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504501 341.0464172 341.0464172 61.2504501 311.7425537 596.0828857 cm BX /Sh0 sh EX Q endstream endobj 367 0 obj <> endobj 295 0 obj <> endobj 368 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2493439 341.0402527 341.0402527 61.2493439 320.9199524 586.9771118 cm BX /Sh0 sh EX Q endstream endobj 369 0 obj <> endobj 294 0 obj <> endobj 370 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504463 341.0463867 341.0463867 61.2504463 330.0687866 577.8140869 cm BX /Sh0 sh EX Q endstream endobj 371 0 obj <> endobj 293 0 obj <> endobj 372 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480011 341.0327759 341.0327759 61.2480011 339.2152405 568.7026978 cm BX /Sh0 sh EX Q endstream endobj 373 0 obj <> endobj 292 0 obj <> endobj 374 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2493439 341.0402527 341.0402527 61.2493439 348.4013672 559.5973511 cm BX /Sh0 sh EX Q endstream endobj 375 0 obj <> endobj 291 0 obj <> endobj 376 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477226 341.0312195 341.0312195 61.2477226 357.5635681 550.4393921 cm BX /Sh0 sh EX Q endstream endobj 377 0 obj <> endobj 290 0 obj <> endobj 378 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480011 341.0327759 341.0327759 61.2480011 366.7262573 541.3282471 cm BX /Sh0 sh EX Q endstream endobj 379 0 obj <> endobj 289 0 obj <> endobj 380 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457314 341.0201416 341.0201416 61.2457314 375.8597107 532.1923218 cm BX /Sh0 sh EX Q endstream endobj 381 0 obj <> endobj 288 0 obj <> endobj 382 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2484779 341.0354309 341.0354309 61.2484779 385.0277405 523.0549316 cm BX /Sh0 sh EX Q endstream endobj 383 0 obj <> endobj 287 0 obj <> endobj 384 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2388649 340.9819031 340.9819031 61.2388649 549.9105835 358.7363586 cm BX /Sh0 sh EX Q endstream endobj 385 0 obj <> endobj 286 0 obj <> endobj 386 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2507362 341.0480042 341.0480042 61.2507362 394.2018127 513.9317017 cm BX /Sh0 sh EX Q endstream endobj 387 0 obj <> endobj 285 0 obj <> endobj 388 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457314 341.0201416 341.0201416 61.2457314 403.3618469 504.8162842 cm BX /Sh0 sh EX Q endstream endobj 389 0 obj <> endobj 284 0 obj <> endobj 390 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2507439 341.0480347 341.0480347 61.2507439 412.496582 495.6599121 cm BX /Sh0 sh EX Q endstream endobj 391 0 obj <> endobj 283 0 obj <> endobj 392 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480164 341.0328674 341.0328674 61.2480164 421.6741638 486.553009 cm BX /Sh0 sh EX Q endstream endobj 393 0 obj <> endobj 282 0 obj <> endobj 394 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2402763 340.9897766 340.9897766 61.2402763 430.8163147 477.4343567 cm BX /Sh0 sh EX Q endstream endobj 395 0 obj <> endobj 281 0 obj <> endobj 396 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452888 341.0176697 341.0176697 61.2452888 439.974884 468.2822876 cm BX /Sh0 sh EX Q endstream endobj 397 0 obj <> endobj 280 0 obj <> endobj 398 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2420692 340.9997559 340.9997559 61.2420692 449.1481934 459.1562195 cm BX /Sh0 sh EX Q endstream endobj 399 0 obj <> endobj 279 0 obj <> endobj 400 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2410278 340.9939575 340.9939575 61.2410278 458.296814 450.0528564 cm BX /Sh0 sh EX Q endstream endobj 401 0 obj <> endobj 278 0 obj <> endobj 402 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452888 341.0176697 341.0176697 61.2452888 467.4408264 440.8997498 cm BX /Sh0 sh EX Q endstream endobj 403 0 obj <> endobj 277 0 obj <> endobj 404 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448082 341.0150146 341.0150146 61.2448082 476.6132202 431.760498 cm BX /Sh0 sh EX Q endstream endobj 405 0 obj <> endobj 276 0 obj <> endobj 406 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2378426 340.9762268 340.9762268 61.2378426 559.036377 349.6287842 cm BX /Sh0 sh EX Q endstream endobj 407 0 obj <> endobj 275 0 obj <> endobj 408 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 568.1971436 340.4717712 cm BX /Sh0 sh EX Q endstream endobj 409 0 obj <> endobj 33 0 obj <> endobj 32 0 obj <> endobj 13 0 obj <> endobj 24 0 obj <> endobj 12 0 obj <> endobj 16 0 obj <> endobj 14 0 obj <> endobj 25 0 obj <> endobj 418 0 obj <> endobj 419 0 obj <>stream HVyxTW7KJ$yI3oBRLmXMA o$ %P;cUUѺ`KmQwT[Eݴ֭Z-΄~-7=s~yw}'5ӵyV^m;vf~R}][ftNgSZ> wva<>~@i&4KWR͠0-q\Jaj"yIP/iv.S#TIM$'*389{(}9O{=qaLKh-uu͚===hr8q\u^DhD8MsJ}*_-پkL<\]8H爵q|fc6Vg5Cl(F"kw-g#v;.]bnő٫WwO0BBj`;ȳz|PzH*4A2ӧN?ڨh}]WIf:9LhuXIi55Z73WK 4{{de~l!P^sW]ƻqރ \Bn`Sfq33a>/`Y fN\EFK-pXb%5XZ<?&o2KMTz(ԷIbg;gڱYV9֗motNK1,J5q9M͖-RRkLܗN& +aIf_%RAS1lZ3LH2"ݑW:k^ëBbnBPO3,KsWB*}:y<M*!da,nPBԦlݶ,K,C"ﲬtlLgp,.]FH$A4 Kt]BBiz5K͎$eeXD [] ry܎Vܰ+aA2e^80!d#28F(! ݒt2բpzl-uȺo! #/0_[(.-")#tS)tv򢗜#ё3Qt벁oAmb3 h LkZDv&:B"u%=jW^e),H]YEeftU<r3<]Խ_ݯ0( KKÒ!YP5˕JÓj΄1O1P_ SAXd>?w_$0 TĜf6W&-*.K".B .$l6Oy9q{ Rv4ULg%0%k̴SZ3RLtcttMbܥEҵ AQn)M#ʾބ|_=%^Ƨ)i0>%O&ƧƧd3S4lM6[n0gS3U2Af$&|q,ozBW[GRKr?H8ytd^bY9Y63ޛ#QK"-ZH(fLZ%ۑE+"%zuI%-6vQ $moinzɡ! "J7of:wlj?%k}ԋ`CUf{oT@@L/J&A7'IhpD@gvIТ|@kF9╛I- nZUF` Q:x&QM loV7^cFD 8 Mtʊ?NZGXѨ_ѯ֣͖yM ؽGyݻZ{Mf=K%XxI*LE-K1gTQ|qzdYVT_:=XCek{ {˅Cٽߵpwo˽L%{H9r \0: )Yqθc.Mr44T0r;ERoQzvֳ="Ud3%M H;9Mo`'ali*AȀ &^3oxGeeY |TÆ@C[Fy'}Fאָ\Oi}}xh'<06S*hdRpywiY@-,@=& u[_?uCh>z )iس]7^ )ͮQ;Kba3#/fOU{i|wYv]#zWV%ڮM܅n *[dt|]0,H$jC[IF}PD"<$D}aT.~ z!;Z,C.)Ah=GeFy3̑ZuYB.ːwuHW|`j:(/sU9|~w:p& ӡGA(8;P^{PpWsoKSPI{xt&0x]4Ǩ# vu^_[ak&2 煴cgIK Un!|nVL ۣ$jZqeRߊ4Ѵ'ZM_z}}B\-Eט Qjjl endstream endobj 417 0 obj <> endobj 420 0 obj <>stream HVyxTW7Kɞ4pg^MHg2l2l:Z&BX UѺTkEֵRK(;ԶVնb[V+P0;B}{޽w;oe+'#{o;ٓ=~-@"=3j]>4PYnJt F[&oj ;xгx~#jߴ%ػ <h{Y}fDO>[X?ػe!ϓ۔kxdé.;y%)ԅ+eK.a8v8?tQ8bbP@I+^yNgr\ 'o*fS84Ji^opų8ƹyqCxiR^f4ьIhŕyXXx':ЅW76؎؅F| ×e܁o۸8S<8~34gE!106b36}؊~Ƈn'S؇.܉89?i6͠bi;Mt%t "|%A ?~M4 5Idr "΃Dʣ|*Bi2rS~h^ R W΅Q:G& w`#lûLi-vZHKiEi Et.=;y#tدxI<$51-E6M{5]{L{B{q㰨5NDh3E8-މ>|_/[}] Gjt<\-H爵r|bc6fgڣl(Z ; 얲1#v;.]J|S5W5ŷ~n1窀cɡ}CC!my8'4szc 3zNiNH+ʴ FZX[]u33{箰Bw~ 3apw;3'y};<|lס(/{P Ň?|>zF{̌6L0ELW0_ ܎pX`1RBb)2܋U>V\c~#Osl/Ob9{EdS,Cp fzC:E_)biv(}J;O}tIBbu ۡ$S ;(5St y8&k(?IF;JGbmkx/YtDlᙐ-Jߢv{32?yE(]zjUOn[K X!wYVP:Lq6$3W8.#$FqXt%:SP属@R#I{Yb Z\ ry܎Vܰm+aA2eN802rq#ZG${!]1r ?W_K$0ĜAf&W&-*..| .$l6_i)q{ T; o >Sc+e"%8J^aJV)c̔K3VR7S9J֚\%ǚ<%'ƅK6DI(jD5 R6(:x 1:K0>%OIS`|J3>%OO&Ƨiٙ2 laέΤgZh`@LY4 /CW[FRKUٟrQe$΍L4:2WO6ŴSxE^o:|%z6sΌglℌ/1lNB8ǹؓmb s ]ni V>KB-2>KZVZ^R*Bj՚H/3QtS;/vY pgQrB+Z_P0*fሀ 㠗R $TjSi%Өoz@uag)WI;t84U\U*4gFpa&ơG<3`CjI-lA]C2U[^`DGS`2|iW#r'sBOmA:vy\MQ^&SQ\a8rMUM䅫񵧻u%S*OFOC7"*KN82]LNڠA*La@QW~o~//'m&MSjD & 3R K2(AEx$~v:-Bӳlh&#MMv$lvzZU S;᝻C;ʿ?=h'ݹ;04L}]vWpQDMW E(VCb0lL,a&ҢZ,o.GmMS]B=Azpq\van&0q#(,;?70-kx4#v׶d.cUfBvm}=׵IHvgS7HQW㯞 flu& 1%]nSJ BY_T/zJM L'W"L,1]ؑ#1rgF? ұEk1I) -mP*U:z,Hlk8NOmЃ4s6m;`&F-`dh]YDA4`ìF"_r&*I-)PivZUzfPcx`CRˠo9 F:X̴豭G#4.ݢ4l;| {# WWp[GF?;1ߦ4geH#q%LEL-j҆Y5W-2c,:pJFkPũ4{84S7o&CY$^@qy%jн5j#o kg.3?- /_!7ͯ旋l~Rv]z;#FNc)DӻzOEO7OGAS=gËd9pIr2]g1o4Xtw#B%DbC:&LNUx&]9mHw~p/N,IcyG>xQ&ݔfy\2J)XSk`&~T?JneAzIB CHɔWݪ#ѫG/6*oh7rd[;OKʾ`Qrnr|x;0one+˛O]LgƘn(Aߓ"d֢ff*-)3o,#$*ȍ&)ǔ3]jaw1.-:t&n0뚽 ?ށ>q|d "riʳ$}^"Kyy"O$aAN] R%wݘ~l&2s23O*I"3&@ǬRU!a_@_CcS.z߂O vw/5rC\(}t}ƬaNrdֺg"Ǽ22N8Q24\6#2s^%A,tfmTu$9~~5ƬW9,tg̘ H z$]KGI_PIZ Y,a)Ά E c;nUl) GSN}Xl; |Ej̦_E\(͎bOxL6l%ͮ4y))E%$_=׶519k./=%adpD7q&3$0#甦MUC.SRE&[3jJys?h(1v<X#B_'X7XkQ2Nj|Dm6>vBlѨQg'*jIOm@7߶.nHT*5oגΦQ:z%8N/Ӎ7**hI;\PoH[OF7ϺȏܠtJ^N ]bAsĂj]OQr9dDOKZ8:'AVסVף~CY O٪*wzǃ񉅐h8t:82gkgmšيřgl*01Y1kk)ʻc㶩;Mp`48Q*VL!Y) m8͑^^Q6Q iэ4rmabԦh3K]Ax139ncQ TNݘ35&1'_Ą7[%@D\lX>CG ]`BBNV`xc;NEldd!`#f`*ss0q@غll`6nPXN i70 > endobj 421 0 obj <>stream HVyxTW7KJҐμ$74,B:aay7Lb@ֽcu UQwb+T[ViS KպU+P0;B|w;dG͝=p l)=Nv'z<l*sȩ򰩫gC<ްyWwUe@;{AԲr'xؽoh~ poޚL|5NӟAlItw;Zܬg`[VΡGx Miq^$"uaÈgْ 1\3lqǕ2}G/eips_7pqxqi&.P=bTb4fa.,llF7z }؃q݊b/>;_½889i6͠RE#t-P+iE H>* D 8g lWoH dR%4ߩA;" t'сS)?4/+A:G& `#lNi-vZHKiEi Et.=;y#tدx*|UZ_/[} O^2ly29;VSk^^hm-vkGv+E#Dױ[vG`v)sM8?[xiŹG__R?v i?ʩNnP4^ujjND+*QZ6FkԦi-bmvv'jfOu SfċY1ftc4+s1׈wAf 4+Sl/a1uJ`+U,_1jf(XHb>pW};6fm=ΰ{ 7w3Cp8̜-VqЃr x'0X-0a6A?ngf|/4|Sb:>V|3EWp:X4Xo! cxXa-~.3lSXo3˽"2)p׈|xsh4TM7>@ў&f{&8qkG3gZAlf_G/XXBDdyTWil.ZZC|Nv2i׽^ K"l3v((ɔ JBĤqM#ɈtG^hV{ R ٪Z-KsfB6+}9 &0yE(]jQ_-n[K X!wZVP:L8+Kn#8,IvP:MiP属@R#I{Y)bfW\czb7,%d8tm~PLHyj JHm}${!]3r(q{@Xw3fX!%V,bڒ@%R+J&Saip߂-ϜS\8qnhI^sG$VO{Sζw-"BUJ;>lsc@[:Ku5v{tG[8zЂTshTwtٞ-M Ksf{` $ j1Bw0mm eQs03dKI{ ̲+<|upܮTx}8Ոխ DZf+& }++~F&$ę$CdC`^mb=^`a 1BO@_&;6@fZI`$0A6qdC`N6&E\@;D\vq-"=".BOEW8J [6yֆdaq}Hܱ߆tALِ ِ aے7# 6$6$#3c %˰]5q$̏ڐ_!wf ِ ې ^ /+I*;+K%|bu^_6FGϧoD|#rJ-s4*ҊX-BeʤIU1I0cH\phU(43 "ˢMpx<[;Ovl:l$BϷZ %_غeשGTècjbUX*芞D NW<"Ԩ'$aL ba^|mcsK&c|~,vPXs)̗̘\f|WQIQ,;ۜ`/ y[oO??vT*q q.vR]-t$k|~:3=ͮf㛅b)3 @+2'ܦ,(]n\˒ee'O#of n[//VC"RoAgURu]Ѽ!Kt-V_O-<`i2s9!O E0^oW.^QO,W/ŴFo O T*E1DYNݑ`R!Vk W 9B=An((؁ϋ#` B׵!0wH2˭e%QE'lfV5`~eyiFsYhkjk|2X$nYhhӲs)rji*A|,+Y(;ێXњ*Zʡy)͆Ft XāG$TeLEHfґCskG}H'RpŘZQ%rGG#ABjb0΢2qu:vGbK|>[7 ʯ 5E)}[;<<|gԊծ} oۭ/5OVoO'udsSpf/ nCKDhU~j1D*)Yz]+!g"޲eQf>(d1BKqMpzS%L%;-i0d>\ndǾxKV8Pa\ k'!f {[`.AH6 gF _ex̌=1>?n[*93y.]<1z ;7>P߾َhӻvu˗]!8kBCgIxΠ!` #B;l6LYHFس?Ņ)[SԩާAvNOC| ]K 08P&ιnrpVh9hӡʎK=]Q^*vM?{ro"v^0i<8..gjmgw6q{;8_>ql !ĄB B$|"PWn3 CZbݴImڤJlHTӾm8X|~<˯kqfi#Eae1 IX g)ֈ k8MNmx:Ñ4q1 d'2JehBsB_v9n\\Ds7|q~z*EB,lb]ѿfk[ir -DA/g+óx ƁIL rTH*N4Fͫtʹ¹2;XžòN;5TPjGȁ Qb.󁛢8^1!TX*QTR*f$ش' tx]3jC!G[W@ sv RAo].J}8z[{"]z0ʤvڃ7Tg4hsK.|NIv UV{"9aqHctv"'|;S I; $2_9DG302$E}W?m4W;j5^ax /`kRp|` gR @HugnjR|'_GuŜT\4q4LElZv.@%r3ex`' }[7~||?rM}@t+ e&D!ǽ0Q5GF;4H.xjz5Y1ςJPlhkd?WTs>3Kr~ptn_WF箊.e4{鑈3@<]'ש6i,jΣ8#N =SeYjjh XrU1-V -P07j: 6Owx,Q 2ǐ0{Ϡ߭*:Xncbi^I}784|4ԕ~[@%FSwBI2ZU ӖP4'S%bD!h&el<[.gǶ3&c-ުkj~9}[/.jjh}dG: K5[{,VcKl7Mr~{y/h7{CT8뷲vd gwa45ZE8}A;<sIOhsyp6᝔Ci*syvP>m([Qe ܬU4fGmߘi0W#6Dj/-N~#7971`i~Gdqp\sܹzcglី1 kX`}(E82B_.^#g,E> p$>:y=X+I+!%d!Yn xO61Y&YN$Uh{Xj @3b)&f٨[_Uϸ9vah#dhюM[LC&sQ b+zor`TZK.$i ?[n',.yc)X8wT>WfSlW.K5Uc7'b mT662?*(+/ ]j73Oo<:ly:M}7*{}V#*(22uᮦ.1|ޝzicP]Hbdž/،=<K ĝ;t_K\6szP=yڭ5} 6ӷ %Hs3}EbKLL_c}[MJ۰AhYU|=qEcMH(OE>gi"F]`JZ6+Nn_;>stream H\˪@>E/Y 0YOtUU~uOӸ ^uZ\m0د;wϷi(𱚗x+=xU߅~.}*bWK|ZNq>ߍEq~czm馽c`\[䞞 Q;uGP JE!B{rP/&֑lpg"{B)gJ@DQM(2pKJ )w(Q*h?զ)T^4KU.uIL+(\W՞oԖ=VF'3jx"RE⥦/5Ī %q֠`gymϭ؅qK6eۑqҟ{̋`5* endstream endobj 422 0 obj <> endobj 423 0 obj <> endobj 424 0 obj <> endobj 425 0 obj <>stream Hl$ 6q( endstream endobj 426 0 obj <>stream HWo?gYm%g} .cqX.dK JJ!4-MU/HU{z.?[}+XOcw yܥ(c/3i/iX̜228lŝ~b`:-HCTQ(( 1yrrz~ʶ=dASh%I0TL,3TCȸL6= P \5gٴԨcw]2C̤W֢ۅ')<)Jp%#㞉uNb.3܀kk|(.vW4ꍢel~< PuZ ӶF%U#D 3LG`d[EݩbRA+{țԣMF5Gbcx>tfq:zx+*"%Ѧ /J,+c\$죥ZE"2Y朻ȴaK5ʴȨZsSl & ijFlDRENy&(H~(In2mF1HR7!F7b5owta)R T]kOXW=fso3d@|$%#ىH8#܊HviҀٰ#L1RtVSJ&Tp.X2?$#>SݕV- Y'սpg4T4Z?v#r[(~$?a܊PR I583oGMXkL$|rw0)'*,"Y9oiFJТZ1\!%.`RDK1P5уM~G45*d}ty tfY53;_[hrŔ0 \+)F2(B'+Įؑ"NZC[rfR0R|E\$TJ(Ra+%%K* hڷWR$]k<1˥rOC.w"EYPL+)T1śqA_xD;ю>uVj(,iCH/.MVnt65c)qYRgޮ;x![Z԰DZsBv zP v$R$'twr$q_\g~75P! ,&.-gjAGXehV82wgrAdCq&#t1^6polqBGcsq4^!NM$'4q,q̹~]r"tз]q"/Bg]CwV |<%bt]KKX|eܑi$")xW=H7wyoz#wox? '$O=H;~j:支3X~'7vbAVX#kk t'pG7oPdKR?Xhӥ%~sgKKڽǵ竫+_q>q| ,GB{Bi;! gx OD4gXgGDmndM:Ԝ཭-Pf "(a6824Hȅ|gŞWg=cx:v;/_?gWʧ{cXlo6o.kgݣI>-& }5wS$mlo8Ѵ% %:#mmp#;Ч|؅܅,>sf ;߹v㝝o~_ssFh2FsxPXMMMSM8D "9Rv l|/o^}G.~~vןl7WMEE6`ߌW[lY>x.-g|ib'NbǷع8inv.M{lI/iJlRъ}@ey` $XeY )hUi+ }Djة[ugr3JkIMsVd&YxŽ.+C{xUlxT5޷e3diAB7`rVbj4oYd kbsA }8)/`zF!hT\F#D 1iÅ% yMg<~S/1 |/NפCĶWXԁg[[jvxDx# L7p>T+ܺץKݹqq˼Zjps9h13_Ts:>78zİ9@KBOە\nEk5ZgnAg=&w v ,0Z@zC=ݱKPI69^*Oz}8j Ǿj>4)f[Oy5"ÇBs \Nq,Y=7:m"!elH΂YҘQN’0Eb[Pu{1@d(6IjB/(1PfR'G-!)%ShmmRw\9-re X֘1^T\Bsgw$C-xпVNOMLC ۷ɡHg kCj:_"D#b:Kld*v*',k>G/v~NUb,ChկJ)Yu9X6 nSd:N0nd a 8 Th4&J.w04rU 3$DrGQ7K{ Z<[iG< z~eyDMn#A1 4/ѼDfqxQaU|S1F51뤅# B$8ŵ {\8+f.le0ZxBŞhT Da M꧌5T|0ܽ:3k\wOYz/JϏWl8N%\A]'9p>Aޱ,]`lVjC؋jaS ́v-nf}2 aP53 luuHlU߲~ڷ;հ,%^ҤB=R {( SeXo9A,׹xj򡔖pДZFpC >'Y~%FnKC!ZB]X&i[N_-L2=mss>w i/MAoYX F;)QTuyiNy^/NTTek}nb61w8 -g|~& 0R6 Rrܱїfk2[Z a3 B E߼ǜ:PϤ^=۸>qr` /IHbmUP^M^g=Kb8b'\p8Nȍ@B.BHX` ֮cie?*vceE2iLP'1Nڍ6{9g 6:srs}khD(]׼{7H.u<`uA/·pc%*kyT#"ՙqÛVA8P ׶TErݮUA}_ +ǻ ql}S->y?IŅ&o`%wJqNOpqh !)HD;U'XW]q#՗[/X:cVw]U Gz ms k20Jp6KR>+zŶb+!cl4}KtYfg.I>S3fcm^Ll|[2dVMÁdLî!sAA>WԷl +{/?9****ܕ6ce_=' {DfػX8rSzF^QA25ԖM6^H {8ӳC 7ÍHd1Lq٦o69z523-v)O) %\sR󸺔e89UɥQnzKsЊR]yо'z;ó->׷%gf''O]-IE'&u~?֛ꏥ?IlJj:'PCmB5 +,QQ$@KY͖f]ơc_Vǔeaz=ta^EPp~j5rjN_xzNf)I&ZiԂ`[?ՊG+j2rW8H)uL$)WȎz6qQddoo2݅n8kܒ9 bQ&ofݸK]fI)N#t*ff0cU A&h2@5k%`Yf( Y>92+ X~ ]k1_Y?v1"$XwGujkk}k.=ՠ[n;c|t}TlBq-{_8[*s/zϽ~g4չg< f%;FZ؟-״]/Mɾ#E@]gOZMCnz.+m+7Hb;DvkGf&3i$YU3_\z} dN%^l;~^,i';H! ?H*-;%J$v'/']TØ>hWAj q*]h}g!3ߘWT (P>6Ex5W!)MVv0FۘJchghע_fI`ގPmƝEym: qF؍eEǨPJ}AdQT,Y_o%4d4G~KQvֳ yE~5wh zQ]JSAN*8; Ucb-~uQD-MC-*N鸂+\h]h!m?E:kXQ{; *Jn/sOྟ}[`O6@oѿW(S-jYIy ޤy8)U[5T>IudlT|OC^3, ;F^$BBěSl6qo% &fhE">R#!}B*R&iM66Jo"(EHAD󘃝"N!jmE~/S !Z>yku r탶_rF,/XlޖWT>'')Z\.c7m%}ZQr.6khzQɘFjS)2Ğtۆ^5ٶlЬl#n#Q(I&i,qɓM2ET $R+(|M=xǩ4E仡 *%6_ -k[4xI=-E`oig"j[Ǫ|\wƧ I3m̠;vn6hk<]ɚA)S?CL^NH@b-0r:1漤/ cZl1]f[`34sĵzY:)y½ aQ!u#+`a> endstream endobj 412 0 obj [427 0 R] endobj 413 0 obj <>stream H\͊0{bDPۂa}]a!ڃoqta d&AY*MA8ApN!\F;5=D7V> ʴHS>8V:sWY!`f Y[_襱MPڦ~-BD2j8Fk E* 4~kG[.e$E$mɺ 1+fkį6 endstream endobj 427 0 obj <> endobj 428 0 obj <> endobj 429 0 obj <> endobj 430 0 obj <>stream H QAAH #} endstream endobj 431 0 obj <>stream HW[pS=GG" +%t$\.mL!Y)$ $(MNxC_%nǴ3t2>s*^BOWG2uWh2UH:!uroKOJ9?_lX `f- HlAxOb4$-{ULDJ?)R(5Ba+ ăDO f#[ o 5bͽhy8T5(a*eD4iYq٥ڈ!!AdMDsѴa8q;d[4nY\lY DJfM4a j'G8R=S(v,X*p9kPi2H͛ ah5 g׈f Cq. eiE2x!XBt{p-__#oE ml.2_$9,NֽR5Ѳr1HQh2fa+N6Q2 Ѯ1jxm8Q"S e+ Um&!i E/0O%c e~%!:¬Yw'Ca]C:0-EG,ӊ6xJ` tfca8q \ }G5iB[ ,)i ۠ 6e*wDvB|;/ C|(!>C9@|(]A)yL: YJz:դ.q[.@mRE^aCҠs4Ț0oaIGGOL8Oo> 7 0܊dBɭS 1p@`%Yo>Hyh&"B;4)[恮4dėIT8%ݽfɄM#5kUBwk's9Ɠf7îp lc#{rM ܂sPLri{Lt ('K{jW#H'Yt[#[P}<0բ<)HJ>h7HS09a&r$C%F`td-޳uR <1ꥲ+!{E[ W&N=v.T|Lz8 u7^|APRI f&x,9\$3w xԉ!-F-jCpBV,x=9퍇y-HA!{|x#cbDK뙚c4+3(3Erf9YsA0'`A ]DRwYȣN!O'Kȓ44A&m"(!'` 9APAeWЊ Ys/Dߔ~!zY[/D_.@5 _uA1rkq.9Kq.]ߐ#MoW` "p]#I˅HB߄5.D;.DwBcɑ߅H .s!w!nwVOW?_]WWF?C>%CrP*A<<k\'.U^E(tHW덏GFz^ѱ`0Ga`>aLgfޛo/u졃+7nTIv>I J^2r0 D]=ҳ1 ̹ϟS"^=|z l,OK`&|*GUBRzoo^zR >Ezgj)̺oH4m,Po}c _:s ʃr_Uqrپ#V3P)T9lkwo=h9ꐪ۫\Tb8,b8/LޘPmᖸϓu0N39dM!SǥKl| K1c01妹59@Bt SF g, :c8ClJy0˅Zn*5=eE>XMjt&aS}j07Zԭz]LP ϨZ{UV7W}U(4U TvnyMUECʵKYͨXiׇMisX]ȥ6..  d%k&)53~.xq+cz6‰3ӔSQ!l`H tEߌD,6˕jJE)rVṻt~ 2 q2=z/N0i s(ڠrweנz ~>yYʥ7>^r?>^%~+@hۈmg׊b1rёNB F#0%3Z?C-LzgH6bʥhDt:E&[uP\5H1o k˲9N˰re-ksٮiw ^˹7z a0ś'[wJt 2jZHfʀ iΠviU퇀>>A}Twbj :> T=i}<2%P&(tz s? T|L똻 [> 3Tyva ]N"T?Q>`urv x+eo`7u2u*R?n+2{< Q /0d6NKStWCLĚ R ʝTH'--|vلMAj@ծRHec'$0~k|LX^;k'?'!ѫ~&W|Kq^Ŭ]T@:JM6>A"o%D~\TRgc(E^փ3P 4jX5aV@P1{4-$usY&AG~j4T=kXK`jLb_J׌),} y,쵕G+ } E ҇NðYP+ "*RUud0va>;a; |$S}?+$y@;UceC~h?I>=i]z&n~mx_! "-6Ļ .o:׃2:o?2yi3.3r3s4^x\u5)i}+y‘W5>?_8t,%ͬ:N']≅CkVΞY^8^3\ճ=|Tݙ<>ue״keizvnqz+yصCݡz;P%$%Z#4Pdꨞcd ti?I:+ڑHgŊ| +!> (S ,4J;meHE4||\B\lv*SQ Y d' *} W"OʦQĐ gH(~z ;NEldd!`#f&-k2?&fs:*`vcfp٨#b#sF5oG09t$DDVUA&[7ndbp̚`O endstream endobj 410 0 obj [432 0 R] endobj 411 0 obj <>stream H\˪@E~E \Q AJ AVBGŘA+ЁIPiD}eq6q b)<-AhOfn2}[yo`q_.cY6F_kw3"teake|.FH1by0MW"Į*0_y9 9 5ļDK{ױG5rTRNaK  TkلŸFŸƭŸ]6Z(kQNIϖ"K~=z{Ǻcru?d>o|a^e endstream endobj 432 0 obj <> endobj 433 0 obj <> endobj 434 0 obj <> endobj 435 0 obj <>stream HԢpDž@JAL}"s@Xo endstream endobj 436 0 obj <>stream HWo?gYkg}1ޙ]Ȍe7(@(NBBUEՇTEURi+7}E/*v̮1SZw;绝ͳj 㓻{w56<.,\9w4~s__8%~ֿU.gyLe jb! /ýHBla>Ǐp=`_Zõ0c?wִ%l9,쁩1 |V>>*>[CxBv"Ƴ*<9m>]u:(֞e`rFs2rӦ4C ˝fT8cUݙxɎ˸^05B tQ9ՉHnwA*g"4@h]qt#c!O=BVV!VaF⮩_bI ҐǺ=ffU+% P;ݜpl'mt dT!CE2L1it^i3 2Uj5d3vPîCwsXT3+xU.<,LA.^N9UBe/QMTo\*? m h*b2tMUk5-#3@BXGi9L;FbdzlK@faWY(B!ibdbpn١j墩FvNz|Qd X_o)OYtx(ތJsvhԗv%i 8d aRmR"cٲ;9jh"2SiQ8|U.-\y4YK n!P'6 5&L3d3L(H~(In5!F1LR7یbb%],]]dX邘ky]LlPv+S!/"K >qG 񑔈G@|$w">awLMfP[JgYML(p7.ؤ2?(#>SjwW1cܳ13O{ ryPch6^hǚAf fGSVbB oߣRÀ)KMcxܾiV'M=Yzl9+l=~]jf{C9V~j.5ڻE1%,"> {  =+v='-~9Rd ):R~TQ^j=}L)lN^}iR_1:iǺT)IgOr\ xBHRGxe,&y.# =vkⰡ26ԾDBPRQФJbLg\:%{:WH_׹(E$ІwJ>f[$M],C"C"oܫ j/鄪W{O-fճᚺښH8Y;h(޲3woeg$?]wV?ۻ>YxU[5w{aլcXbY/x j8 yƪ@Dp%H"q~\ؿ, okKWa(keYaQUPP G`}sb7S//_~{r3}]rV3wiZ9e55|WYl}pHJ!ErE+UcY"%m˵ZHjKPꠁk#@EhПFDE&@ p#3uѦMzJl79$fr9^!ꬳ5a IbD`|3|7+r[QʔnhΟ=w3|FnN8Li&9_,ZT+4y,]HM]OX%$ߡ9ȋ,A^e'bə]aA"{6טx#B$ 𙙕&f+H-K{+ $qӫxj[&ԪH}LIxKh[xĮς"n9aTjM8ى -2HV$x1;\zsSψ2ܽܕP.Wʔ+ (Ohu4s%b4 enβ\@_܍|FVx':9 / -?荪fƶ2PZSkm"AOrڛ9 qs4xT15&GOy]}qQ}>|icjȒI2iK"3j^|^>R׮=-Fqs ߣxz ebA݊ r) I9--*PPua5{Ht+qihvLWphG:g(>~jJzg6vbb`ƯA'1h4]Jt|\- ;<⮎,#Buq5:8"jWo/ZD_n7"~ W;ؗSd.H[m/ϾLu7)ةO?;}P^bAaԏL DY͈3C  O-.#"nkE/D+X +*%a.s+Ph %~DtuuԥW?:40H-txXf}#l[4e% N'A~2A ?+M0 Okoz@0N(IYOQf֤=q [X$yL]JhrgTaC`iq魜9|~^Jk+/-%KVer4Ԧ߆Zv+{5V# 打fbI,RcS'! xaœcxڟ';4}ϝc8x:RO+UbhO( -ݨ%SѶKWj/]װ< Ӌ(o*jAgkf6_h@ƺaoF gWWT6=ZL3 ~+#grFo\t/Zf:PQ r!u!HO4ďataw"n(bsǪ d`+|48x|"OښG4=M؞ܾ=Ada4 .BN;Îi_aZ̀j(B5f85H4zPFCA9'Yk`RY1`vH^=kg( 3K-Pۻ#‡!G3tpcӉ&V=ݶ@+LpSs/74dsgΗlۂs?Dzz:ɀz[&W8࿃|tw[aH΀7~@!Y~I/δBunC=0Q_8C?VmYS3SE^Lp#'Ii'oUK^6};S)A5Q3ڂ!nb!F) Z贖mfa}+O_LJ9S$].L1Zԩ"°踕;Caa1QVt%8C`^w_n|"QrjT!s4d.F(!ͫT?e9ɩTۖTSBGaQg]5[&6^ݴA ̕ے~2a^_ v߷پeֱOF+4ҾV=)6DY*vDUN(IiD, 5 fo5dd4v|Wuɣl)Ս'Ƶ byB -Bii.lk0-0|hCYdvUgQ@rDUqƟ;|| q*") A6&5cZ;M36313fLR5LqƎu&MN;ͤ6TMvÏ3}w}wgXEpO'.)ҋrZf\TsJbE78 5QPX-CSguMmG"${.?u˻^hFL yzC\CcΘzqRDHbg1ǔ`){VUIY|/\i#7s^EAmۨRT EF8BYR9,̠1DJ!*მ-iE}nu64϶&5@%':#:<0I]eXeXKnNjٌkrҙ*f=Omk}#ܺr'Gf:WEn[lɒʒu֨TcFSReic5ݹH2s%)Mfܼ4"Εݤ>.gv3XJ^L G/O]b [܃j-!7*ַ (UĀN^5D>ScpI89ЄAĬ dM\n+)~:= [Y-XG&d!'Hr`ȐI`^Խ"a-!"s&MwrAQa0O&y)iSLS]J%L"K^%ٴ>MJDE(4")pfȋ[\&]a;\)NxPx-T#9NXa/v{+ϯbϢ<ˁ z^/3?_tڄDy1 oMxGh\%|uΚ8jZP K[[Jy뇣wnj.@?y^.b |ñ _˪rgψuQKخ0/_7^U?һگXu_zֳ_ xsk=y qzLwӌ;%_8Q^m+7YrR5"=R ܔ 6v[VKG> DUs*~B Ð ĻAIl4 :` ljV"{(}[Ji9;]Q%O-Mf+]JfIXؽUPDu+X:3-e `O* aVVOmkG旾"}͠|5iމ~Xe_+ Z_?CN>BYehJ)ﴔ)*Rїt2e1 c9e+&ʔx6pL_ԁzȎo6~AFBan(/[b\t ~kҽ)Iak4~@.Cn e|rQl[ s!8/$?7CҰg"c"}\TM PԅOS<{ ri60Y \Tr^]bœ&x ?Qكd<> endobj 22 0 obj <> endobj 23 0 obj <> endobj 8 0 obj <>stream HtWɮWfeVv5\|!$@?X" Z8"f#AuGOwU.Y.ˏn~r??.|n󥜥Σmv]+z/,nf2~aՏ(G0\yzx׾;j`8ެ^LWM/o"tRY%lx\N3ӏyNc|m!ظFwYq8ktq26Ά8 X6,~yWAD3`Esz`+qV]ï^Ok>>: dPrVW|~ ꁕ\ \!3}>akuN t*jgxB$'!Uẅ́V6<0s oܠ-&ao_UXa4-0ʝ7o3O(fMpQ&VzE, }5ldu0s΢˯ǧ/~=R*nBKU D>4 .S@Pqd1E=2T J$`L^Tn*ũgị+K.;D;%iJ-OzCp} <`h[B%3lhDYF9.+!j{ W!d˨V7;^=cޫh5*ҳszE"D 3@BD=kAO.kxkk4T,EbJےԞpzFz8+i-a(IRPL@I@`¥EÜ)$!ĻV*JEQʹ!"ئuQ!j@>….ID\) [DHץɅ &–U\;az Ts1"D`Qd0 j{?MEKLz A}>ڎy7v7 3Q3N2;HTs dyd5vHHY@޿,1z&dWr.ʀ2<.2q)'et¾TV]֜UNɰ  eà 0UC0ߌ%$gW3QЍ}3Ch$i`Ri) [Nnb&Iڣ*VYySj ]KI[ϱa0B,gδxly(>ek\Wp6}wUT|)y`BI{kZ40lWK$ )'J<~U_ȈJPH@l♕Hԑ@A AH )3AsK6KVGwji0/pa["s0 .vҿ#̍5C iDĻ'T&?\(Y,^N.B0` F^Ku HPIªσYo˱ {&oK<`k /fQ_Ьt|U;YS2kƖBOA`#}4\N⏰R) 01ٳGGX&PzQNNNC61Qj#q:*7gZ q!m4u]7;]QPT )DI3pSc7p j SP=j䟭zb(đc@~8\GC}x1p(S!6&OZ]q(VU|h^9~@̶ ӫA|)4eD^7僻^o,'81yK2{N<jb.Tب X>_˂B^Hܧ'J^+RȦ _9 &C 06ԅGM&x!eyY-]w5B[c$%OCGqd6i'K(&JxH ;/xA'8(CyGKp;Qm 9[OY>7y= t&,7\py>`K-㴛y mYѨP5Loo3Xrh{$p4P#ClF!܅J}H+Q"<9 M\W`P0@\HFuhK*+ Ȯue+\T^qQ_B1XBqMezQDSԚkkGo&5b%u=(_s8z]$/Ѵ+'5]yV9e!Gj/TRDRc%OlSC  Fu,[@?;SBkk C߿~9~?YqYZ[VFGhn"BYNɿ~i>k3N7iPA .?GLcD9D=RQ;I:6k^QFg8T\kN-/I-ȶ7S9 JD7 E;t(q5 lq{X>X<׺*\oti.2?49 y!k7~TVpo5 ק$K09 977 UIڍ 4۞O 1֦x~9Pv-E+*E3Zl^3mM&Gp?AUixmv;rMo\/kpQ;r|%H6)51NJd|"a6(plO@J1^w}#fŋ7㧄^DZАAlc}v}Mj(g*_R⌿fb"3z3lߨXtAI5. P%DQz glRHR=>%in!5r(=unQgDq׶ |GB1C &a8$^qJ5e$ՙo)>(7-*jz2{[SB lc^Ar͒juN ha(yNʞhÈԌFDa$i='B(OF*lS̶t98C=Bų0Lz?d}t@ &hPY[q88L^n$bDz5xz k&,>$$.Bp4<Y4OM&ko(l,M]9Ӝ)^>Υ]~u\O: &&P]*C e4GFIFUmD+aU~l?$mR ( Q`JJ9C޻Vj0Ù UҖ(Ia4 }Oň!n݄a7)_*7 ;'&zm 񘕔E 3tNv|LU:8ɓ2 ZGDb.iV Em񖙾U9.dWt_ܘ&oU=YYzr9)Vimg j +hyt=I ^ÄXh41=*Av*MX愮jgc!M*mkPSL޴(wb8=c"(8#avB^ZUjKn 9mtV)V>DOHІNx9NBۘE65O с/)1 PhEU)RE˼#0WIC)&g HU?$Y#LO,tA@B"  cTY>-E*'P,BkQ+ѳ?D@:;>"^<в&^qilH%ζiPn5-T-JO`66c w(Ҭ25&ZI NyMfhщi``8X|;i-B8H`JT٥,橣V'PYAT6v!Ob΅nbH8-ّ6[^2M,!2Tߵ*kQnؐ`V3:؀jhlD(m@ݬadFBƒLdheQjk8Y2v!!#%$2fc .Jŵ!: xEIO6mdIC ӫ}g[!XȼqjS|XK=]a+>Z6CQTiDY @kBl7CHX-+SR`kc4@rV]^TYh"/WXp"!:mki1Jbf iZ,̤xXm hA :3$T0$mRuKBUcjm[i:ۑ*G%"ؑr^Ar6>EsK珱UTHfi ? Tmf%$8~4[Q~$GIC͑>|ֳ:PϢ9kFْ͹ .QOfT*rwCTe1v+ks D@1KpdZu?AEtYy x o-/AB'C $^=MrLfw l/ӛ@J?V?teia4(mJLm:lgiT4m؋h \MLѝ%VwՏ/cڢ*ckM˵/mlU4m)>F@Ghe vC...V^M*^˲*I {YHB;JwLN$6z𠫒;lCSBI^l/",ybyq'Kj0}=cۨ 9;Vz6=4]241|&3-Y"@sNmmL@ť2~ i+9  k9lxwb'M:6aRW_?8C%~?r>Z%0")]?n^5c]s)p KnAН!og ǚF/=f~(*3`TbRA8Wi5Ļabar0 Y:E2bo{N~?C^^pr+*/5ȣ~+;zbv(Eiܔ7//w׷/NPM_6N/^NW7?_Nnw.`0k%O(]\OWm{7w7I< Fx|XI\ӷݍ yu: ~ؠIYo}Brk2iqq45^|N,!m`QI,-J?5/mns9[ 7C?DvKװ:[u;ذ >H6o % KOVxg_Moĺ)ަךf(R\rkJ&SvG$Gw.( }J$7:lgiT4m)R֑,5܇Wp(C ߲EZO#)06,~ܯ!O"# h 9Q D~4e/}W^OR!&oj4 QS_5qI_#yn~XtC%lG2$9 5݃ajH6{ 8tƊi <l#`8=':YnoOl ;?y6{HCS8u۶gmq`hp!8_68-to[N -ᏼ\Dq./\9Z[|+shQ,ؼ.Q~7I̺:qΨq_l )sHP@vIo{?fk^?-];^H%AdP:t!#3RvVJǿM0PN娊Յb^#`3[(-Th. |u1NGTg~v tR Of>\APBB4O5K1I9L ,N' ?jJȊ:J Y ݕ'wunƔp,EBJ*dQpψW#+6"t玊TK=gb{m6' 0!L1ЇNWu MvzQio#4)ЏwCE4aʔ1k4w! dJ!%h2"i0i N[ :) Gdžk { #6!e-IѦL }a:m儶$uPcF,NdbX) i+T4gb!+膐st1HCwqU,n>/-"")=feL%5)c&BΉ [J}Vvj-UxA\Ə.S _b3sVU;gt|5zB|.E]jqLGLSbՕLuu췕:Fh4Vо羯_o7ﮫ_oonn_<\??TOw˷ǧ? }h7?N[{wko|;*/i{4I/r[2k{z}!/g֎@MZSҿnZ]:1LN`fI&>3A)N5-+D|/Y!hc%.Q0;qE,sdcBocư+oHjSnvKזiޥzOn#*x.-O&"بC֋rǨ] YGHeF;âP벲L: [Z, p`Ɖ%kw =^LLR, @<բ@5C N,,R-3> 3c񛻋2E+ 3L_s81]}Ⱥ/bM&uhur% 2oK ^.:dE6x'ŀ;]993|lM$'! 0hR(#$zRϒ+@\Bɇ -_K{bɹ^e]Y䥭c޲DqnjDOK(bb¥肠PIlgXS>0a D Kܷ1WWme[KY7 /}3gqO Sh|g/h=<ہ+w$ ^Ĥ]0Ws; ?ϰ"s??5wD!`]-suuߺk0?5=~s`g]plv]5ػ`eMg@&|YrO GۋO02^ 'v2KlCO`RE͆Ojr)kя&6qH]܃ Vʕ[a=uٹ B>墨^Rl,ʖWc' @BzTِ!%J3iwV>(n** _^$2N\Q H`B܇@Z:2|Iu[m–!zx+tPEoPBA,rd,%o 郝BQrS{y>Ђ@Y[R4 1TSJ8Z FXS5o/W8̴.TPϴg2U06:Piu=ee#d)Ӓ(gR&vEe|CN=Ԩ^* Gg6o!0O?ޠt(TB̢ -(s}҅wHx)6% ,%VJforjc5//0b dGB}./; }A,.0c";%#Y)4! r>00'Xujá4苽M_MZ HQ`)D?Ȇ{4@&U,$kJkE^ 熱uSx0fǖ۫2խ1CG߬kW?40ox~iYc~s7|ckcZ T~Cu^ !=T7lO&gUɲtc+G<[T+XOxl$d麂h%Hc%*(2"WRͪK1Բń;g ac;1~2qsY^vLf\T֜%5'lk-eCqWr~63׾-M)flQw; &Ý.h57ԅԸ] `,Yp5Q)5f8!^;ds)w%+hc: l6Jx;aa_Z={su?FvH`ܠ" eTҬdjK|K}ؑ\}}E.%C>2PҰ7m0-ic}C$Ԣ^dFFsϭZhke3nl{Ta,д7Kٻ%n/㨳KfnɬM#Xl/O;ڛ4k/m_;za/R^S]x:V(z|=F`r[e?<TP2t(lEG g{O']][oԊW3ӯm,%мjOEFP?6)m\O ׎?VB!QG6x{LObS7~~7PqMK@ B)k<F kj xp¼'6<Z 'Sf)oj*OP,_4~rr?=kv3 "OP%߫Pw ‡'HV 9 'e ^T%=Pȥ|)7֊⫵ݻL#Ng ,a v=ݳ1;v_%2D~|~rb2'YQ z:+^4M|W!lVPɨP./hksɠ:F}q3f7ߗi.2v-N15,q l=ވ^cZ? (@ _9>=3/OgɽtuL`55vM'>/xpucN:֫h&TP 5t3:GM]"ϗkH(QJt%WC}1!'BOr*' 7}h'h%Y7]͔Ԋ*ѸdAبe7>5ΪvuLeOX*c.bXjt1jߖg y@ !6C;$X+?Ʀ 9×?y2rOy"z͞41DÚ_-OXOpyJ8uA;It߁WW5!vu= r<ؖr0辌 6^jC쓪s/qӣ=nw;SZi+5J= զ=MliOڠ^X`-K9h`ukMΛ39D*,w=TLnڵFƱE?<ŭkk?d+=6wsm;Sq3B+u~^PGx{f=_҂HK' ^IYJr0]Tn$E2N\,*XL}}Fo03\ W,ZRٹ8iZ;dwxސq-'DPVӞR+b@^{xƭۦƺ]YZ1I ca1*n+~nQ~T-XўV[| g挝  ^B |țL?ßO _N]rOoi88e*ּz~B3{&t$ MݼS|/4xKqK`-a{.Ls)[BD[ٶ)6'ܱe+2aCY3VZ^`m~% |G\nK"ҜPa"I$pGdӧ"rV[D`3[7"gkfy4̹b+^_pTPs|`-Sy UD;@p2FId+}NF2}Jح_9+R`|n;ﮝwVѭyyEpq(`\%88o /q \>.e.I'V׭-_3ch󮞍l[8hK(Y%C/YѵitZ$=0ku)g+xvQwԏ0#u+ڭ,Eg6<0ni6)@< LP# QEƿkRe%J 2]#HG}^TЯ%J*NrEsb SU jji@o'4ob 煗c& .# >qĆE1f+|M ΐ"&BGpH}DxLXR&Ky2* }7Qdἐ)"Lh 9VpKpPn% )XV@Q1nqwp50<X,)1-6ROrRKOD!}eY /s(_&% m%,˅$" 26c5f9SM(uŝ! s.-g5rv˕RibG-n=[糽59ݍıG04FV#=k䱝28y9oBW(͞Ү  *d T 1ڗR 83$) љ! #ktTq틴G.rDeIeD5kq2g)Tq1T)%UD){R$qwS&u6L>q#$Ĵ3. ʤ0Yg,\&RiMdZbe:b`Fd\RfL`lͽ ڥ):׸8[s+c5u-Vp[Z6qKQ+,ګMmH-t3:3_@7Z^Y/hS|z39Rz^g%0^$(/ v|wue$E]bY }'#4kr&K% RpLֆ""T) HܪH +RaZrdmO.?i0oT݀=3ʛN$A2䰬Q|oE GcC o6b|}xǒ9*>4҂\3B"%<ٚ0J5MlHzs!%H:D۲9;·:2a+x ^g#3Adڃ3HV}baHS:BЉG4q {oc|>媇P+_l Z*(],GLa;gֲP٬n- ]^cH͔ A^gZ!=Cz-7~Nb!_UyUlbS)|VCLWhpiSAk϶qT+*&Wreu~91eB@Śl%{5xF b|$4)w2UHe˸|o#xr<%ZrT q` ~lLa < pD mi3R8.yCkdi4(dmUE}GdAz7&ŠNntiÇA=F Tb]z&ţsRQ@mIXNyā }I#\Б"GŖ*bTƐ }D]h,ҡ=Aؙ3LN+XjdR\gdw8Y liSMu"ej|/M݌(XEFqt\r_/íJ[ 꾻K[y9íӇiIH"<Gp*A"flnCˆkߚ)c7-O ث 7oۺߚIGU wAzu缿i7[d MF4盆p~ K}ة6xʅeWj,#UZ7 *h*{ Imj :36q yGU m _Π4hngn le 7TZ ל%y*NSZ&A=YXY=W 3)vsp&ہFU v1iԅ YfLb-em x*#~P&e~a aAu>sI'&vۯMU.Gиz1OaQv?x/es_fT~;BSQ]{s}s߲ag -b ,&vJz6~ V^^;M,t=G&v !BDkZ0qŃLB(Þq M"}6,(5 0* +ըwCQױŴ؋xO;SBPD OIH}V*٭B6@H7H҄} (Y?6eNPҹj4(-O_kE\  cT#?3!r[j׆d?)D+#!cpƒ}X2\6 6y_C-V ;{9>v5-w]󀙷hb8^=1K64\>!)wed XXXU-H2:1#/[3s9EPɨT_5M0 Ž/o/SrB{@g`,d,G0T֤e<—`Pjy ppMp'z*86j 6p2*Z9M5IFCŻ0Ñ% i[Ȟ;.bDQ ZZJ P,Y`Z>[[s\@gá0jk>CmP&.7FEGV:ԌxRZ̺Br Tj_wYڢ" Enniw1'E 9K)(9p0FeXQ-c72Ɓ`/~Zt.q\|vej^9Pt)K2 N%;2I>#+*F%٥D}hKg*RE/涷wT`C)jvqPQU TVY! !ӷ'CUVV7YP4UL[k^?$#wK}kqxr@2vseDڴ/4nx9~ߏ_pb᮳pl7kIrEn1p jev!BydvjBYL2*O9 1@r*rQ ju (h-t7a7Ʀhؓzb8l5`ͯc 4Й^me&C=)f#47f[I`߮ibl5XWc $"Y~{шnvVգ!? @0X7"?Ytvr e-/ʹ~3-sy HR6T{DȀ[̊tDfoTcŽ"XHwष˧O?(͹{{WFƐFjyQt_4EYuFE;EU0-`B#D猬TW|-ϴyu^S 핧hr[pUv('\9@OVt0c RiСtrPĊCw9 ?ՓUqķvy/˯Uߨ4=8GM^Qp_ 0ucϴU)zh=iZ4'M*MiZiLSiFFN5k ^Iv M]@:x4-~@jՔwthW@U98?stF{61]S+R>WԴ \t_Tj| #DtjS4@)TV &hᖇF`r@ҵ7U7 yE>%J!%J^e7i43L/Y!) $wfRAkO4@gM 5:kb֙  n_zp쎨:%SG!|yOP"U&HvV3d/"apQû8Vik$4犘(B3estN-(+e'O-gu8VT/ƫ%LH P/]GJ@_ I ]bTf}@|ֺЏtT 6nņj"3Pt(.q\Տ~4x%P1*!N+}y_=+o&;9MbT2Y-'j^Y&9_+ZLn pN9Bxt+KN%x yonr}r2sal}kv}W>vqUjmVITP l,dB2C]pHr `|3\%7d൛D5W'aL%Bgg"]֎K>L졃kI%/$M-`I'{ʬ=j?cd?D"PXdyn,^ [r(&f9e*\ov@Z f*=}CbL_A_v=TsvӤą-Q<2{@leuRJfӻ.S =X)! DT #Zbě.Jk h@GR{WaߴR }wous-I,ld' AniE_d"eH7 endstream endobj 9 0 obj <> endobj 18 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs 193.865 -5.365 -197.255 785.455 re f endstream endobj 19 0 obj <>/XObject<>>>/Subtype/Form>>stream q 192.002 0 -193.002 780.09 re W n q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS0 gs 0 TL/Fm0 Do Q q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS1 gs 0 TL/Fm1 Do Q Q endstream endobj 438 0 obj <> endobj 439 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 63.7763 -161.1719 cm 0 0 m -2.825 2.744 l 580.704 589.983 l 583.51 587.197 l h f Q q 1 0 0 1 51.0957 -148.5283 cm 0 0 m -2.804 2.702 l 580.704 589.921 l 583.488 587.154 l h f Q q 1 0 0 1 38.3711 -135.9687 cm 0 0 m -2.741 2.786 l 580.77 589.94 l 583.573 587.217 l h f Q q 1 0 0 1 25.6689 -123.3682 cm 0 0 m -2.761 2.765 l 580.747 589.984 l 583.553 587.198 l h f Q q 1 0 0 1 13.0307 -110.7256 cm 0 0 m -2.804 2.701 l 580.726 589.964 l 583.508 587.176 l h f Q q 1 0 0 1 0.2861 -98.1445 cm 0 0 m -2.762 2.765 l 580.79 590.003 l 583.552 587.217 l h f Q q 1 0 0 1 -12.3741 -85.5654 cm 0 0 m -2.783 2.765 l 580.747 590.005 l 583.531 587.219 l h f Q q 1 0 0 1 -25.0762 -72.9424 cm 0 0 m -2.762 2.742 l 580.747 589.983 l 583.55 587.217 l h f Q q 1 0 0 1 -37.7574 -60.3418 cm 0 0 m -2.783 2.765 l 580.747 590.005 l 583.531 587.219 l h f Q q 1 0 0 1 -50.4175 -47.7412 cm 0 0 m -2.783 2.743 l 580.705 589.983 l 583.51 587.198 l h f Q q 1 0 0 1 -63.1197 -35.1406 cm 0 0 m -2.761 2.745 l 580.748 589.984 l 583.529 587.239 l h f Q q 1 0 0 1 -75.8008 -22.5176 cm 0 0 m -2.783 2.742 l 580.726 589.983 l 583.51 587.197 l h f Q q 1 0 0 1 -88.4395 -9.876 cm 0 0 m -2.804 2.724 l 580.684 589.942 l 583.487 587.157 l h f Q q 1 0 0 1 -101.1631 2.6836 cm 0 0 m -2.74 2.786 l 580.748 589.962 l 583.508 587.219 l h f Q q 1 0 0 1 -113.8653 15.2852 cm 0 0 m -2.762 2.764 l 580.726 589.983 l 583.529 587.197 l h f Q q 1 0 0 1 -126.5044 27.9287 cm 0 0 m -2.804 2.722 l 580.706 589.94 l 583.488 587.176 l h f Q q 1 0 0 1 -139.2276 40.5078 cm 0 0 m -2.74 2.786 l 580.726 590.005 l 583.53 587.219 l h f Q q 1 0 0 1 -151.9087 53.0869 cm 0 0 m -2.783 2.767 l 580.726 590.027 l 583.508 587.241 l h f Q q 1 0 0 1 -164.5479 65.7314 cm 0 0 m -2.803 2.724 l 580.706 589.983 l 583.51 587.239 l h f Q q 1 0 0 1 -177.271 78.3105 cm 0 0 m -2.74 2.786 l 580.727 590.027 l 583.509 587.241 l h f Q q 1 0 0 1 -189.9522 90.9111 cm 0 0 m -2.783 2.745 l 580.705 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -202.6124 103.5342 cm 0 0 m -2.804 2.745 l 580.706 589.983 l 583.447 587.24 l h f Q q 1 0 0 1 -215.3355 116.1348 cm 0 0 m -2.719 2.786 l 580.727 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -228.0166 128.7158 cm 0 0 m -2.762 2.786 l 580.727 590.003 l 583.53 587.217 l h f Q q 1 0 0 1 -240.7193 141.3584 cm 0 0 m -2.719 2.808 l 580.79 590.027 l 583.509 587.219 l h f Q q 1 0 0 1 -253.4004 153.9375 cm 0 0 m -2.804 2.788 l 580.727 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -266.0601 166.5186 cm 0 0 m -2.804 2.786 l 580.728 590.025 l 583.488 587.239 l h f Q q 1 0 0 1 -278.7837 179.1602 cm 0 0 m -2.74 2.809 l 580.79 590.027 l 583.53 587.22 l h f Q q 1 0 0 1 -291.4434 191.7422 cm 0 0 m -2.804 2.786 l 580.727 590.024 l 583.487 587.238 l h f Q q 1 0 0 1 -304.1035 204.3428 cm 0 0 m -2.804 2.786 l 580.706 590.005 l 583.488 587.217 l h f Q q 1 0 0 1 -316.8267 216.9648 cm 0 0 m -2.741 2.806 l 580.727 590.025 l 583.509 587.261 l h f Q q 1 0 0 1 -329.4868 229.5664 cm 0 0 m -2.804 2.786 l 580.706 590.002 l 583.488 587.238 l h f Q q 1 0 0 1 -342.147 242.1885 cm 0 0 m -2.825 2.743 l 580.705 589.983 l 583.445 587.239 l h f Q q 1 0 0 1 -354.8706 254.7891 cm 0 0 m -2.804 2.786 l 580.706 590.003 l 583.488 587.239 l h f Q q 1 0 0 1 -367.5513 267.3682 cm 0 0 m -2.783 2.786 l 580.726 590.005 l 583.509 587.261 l h f Q q 1 0 0 1 -380.2115 280.0127 cm 0 0 m -2.825 2.743 l 580.705 589.983 l 583.467 587.239 l h f Q q 1 0 0 1 -392.9351 292.5918 cm 0 0 m -2.783 2.808 l 580.728 590.005 l 583.531 587.26 l h f Q q 1 0 0 1 -405.5948 305.2148 cm 0 0 m -2.804 2.785 l 580.726 590.002 l 583.51 587.216 l h f Q q 1 0 0 1 -418.2559 317.8369 cm 0 0 m -2.823 2.786 l 580.706 589.962 l 583.468 587.239 l h f Q q 1 0 0 1 -430.9781 330.4375 cm 0 0 m -2.825 2.765 l 580.726 590.003 l 583.488 587.217 l h f Q q 1 0 0 1 -443.6592 343.0166 cm 0 0 m -2.804 2.786 l 580.726 589.984 l 583.51 587.219 l h f Q q 1 0 0 1 -456.3618 355.6182 cm 0 0 m -2.741 2.829 l 580.769 589.983 l 583.51 587.238 l h f Q q 1 0 0 1 -469.021 368.2402 cm 0 0 m -2.804 2.786 l 580.704 589.983 l 583.488 587.219 l h f Q q 1 0 0 1 -481.6826 380.8828 cm 0 0 m -2.845 2.723 l 580.707 589.942 l 583.51 587.219 l h f Q q 1 0 0 1 -494.4263 393.4639 cm 0 0 m -2.804 2.786 l 580.791 590.005 l 583.51 587.217 l h f Q endstream endobj 440 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 70.047 -167.342 m 67.222 -164.598 l 650.751 422.641 l 653.557 419.855 l h W n q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 402.6374512 -107.6104355 cm BX /Sh0 sh EX Q Q q 57.366 -154.698 m 54.562 -151.996 l 638.07 435.223 l 640.854 432.456 l h W n q 0 g /GS1 gs -84.491539 470.4542847 470.4542847 84.491539 389.9489441 -94.9675598 cm BX /Sh0 sh EX Q Q q 44.642 -142.139 m 41.901 -139.353 l 625.411 447.802 l 628.215 445.079 l h W n q 0 g /GS2 gs -84.4929352 470.4620667 470.4620667 84.4929352 377.3088379 -82.392952 cm BX /Sh0 sh EX Q Q q 31.939 -129.538 m 29.179 -126.773 l 612.686 460.446 l 615.493 457.66 l h W n q 0 g /GS3 gs -84.501152 470.5078125 470.5078125 84.501152 364.5837708 -69.7962036 cm BX /Sh0 sh EX Q Q q 19.301 -116.896 m 16.498 -114.194 l 600.027 473.068 l 602.81 470.28 l h W n q 0 g /GS4 gs -84.4984055 470.4925232 470.4925232 84.4984055 351.8954163 -57.163044 cm BX /Sh0 sh EX Q Q q 6.557 -104.314 m 3.795 -101.55 l 587.346 485.689 l 590.109 482.903 l h W n q 0 g /GS5 gs -84.5032425 470.5194702 470.5194702 84.5032425 339.2015991 -44.5727921 cm BX /Sh0 sh EX Q Q q -6.104 -91.735 m -8.886 -88.971 l 574.643 498.27 l 577.428 495.484 l h W n q 0 g /GS6 gs -84.5049362 470.5288696 470.5288696 84.5049362 326.5215454 -31.9971905 cm BX /Sh0 sh EX Q Q q -18.806 -79.112 m -21.567 -76.37 l 561.941 510.871 l 564.745 508.104 l h W n q 0 g /GS7 gs -84.5011673 470.5079041 470.5079041 84.5011673 313.8367004 -19.3715687 cm BX /Sh0 sh EX Q Q q -31.487 -66.512 m -34.27 -63.747 l 549.26 523.493 l 552.044 520.708 l h W n q 0 g /GS8 gs -84.5049362 470.5288696 470.5288696 84.5049362 301.1379089 -6.7738895 cm BX /Sh0 sh EX Q Q q -44.147 -53.911 m -46.929 -51.168 l 536.558 536.072 l 539.363 533.287 l h W n q 0 g /GS9 gs -84.5024719 470.5151367 470.5151367 84.5024719 288.4641113 5.8245244 cm BX /Sh0 sh EX Q Q q -56.849 -41.311 m -59.61 -38.565 l 523.898 548.673 l 526.68 545.929 l h W n q 0 g /GS10 gs -84.501152 470.5078125 470.5078125 84.501152 275.7851562 18.4294758 cm BX /Sh0 sh EX Q Q q -69.53 -28.687 m -72.313 -25.945 l 511.196 561.296 l 513.98 558.51 l h W n q 0 g /GS11 gs -84.5018082 470.5114746 470.5114746 84.5018082 263.0805664 31.0478077 cm BX /Sh0 sh EX Q Q q -82.169 -16.046 m -84.973 -13.322 l 498.515 573.896 l 501.318 571.111 l h W n q 0 g /GS12 gs -84.4959335 470.4787598 470.4787598 84.4959335 250.4152679 43.6852188 cm BX /Sh0 sh EX Q Q q -94.893 -3.486 m -97.633 -0.7 l 485.855 586.476 l 488.616 583.733 l h W n q 0 g /GS13 gs -84.4973679 470.4867249 470.4867249 84.4973679 237.743576 56.2540016 cm BX /Sh0 sh EX Q Q q -107.595 9.115 m -110.356 11.879 l 473.131 599.098 l 475.935 596.312 l h W n q 0 g /GS14 gs -84.5018082 470.5114746 470.5114746 84.5018082 225.037674 68.8541489 cm BX /Sh0 sh EX Q Q q -120.233 21.759 m -123.037 24.48 l 460.472 611.699 l 463.254 608.935 l h W n q 0 g /GS15 gs -84.4948959 470.4729614 470.4729614 84.4948959 212.3522186 81.4901123 cm BX /Sh0 sh EX Q Q q -132.957 34.338 m -135.697 37.124 l 447.769 624.343 l 450.573 621.557 l h W n q 0 g /GS16 gs -84.5055847 470.5324707 470.5324707 84.5055847 199.6894989 94.0800323 cm BX /Sh0 sh EX Q Q q -145.638 46.917 m -148.421 49.684 l 435.088 636.944 l 437.87 634.158 l h W n q 0 g /GS17 gs -84.509346 470.5534363 470.5534363 84.509346 186.9776917 106.6536789 cm BX /Sh0 sh EX Q Q q -158.277 59.562 m -161.081 62.285 l 422.429 649.545 l 425.232 646.8 l h W n q 0 g /GS18 gs -84.5024261 470.5148926 470.5148926 84.5024261 174.3252258 119.2956085 cm BX /Sh0 sh EX Q Q q -171.001 72.141 m -173.741 74.927 l 409.726 662.167 l 412.508 659.381 l h W n q 0 g /GS19 gs -84.5093384 470.5533752 470.5533752 84.5093384 161.6377258 131.881073 cm BX /Sh0 sh EX Q Q q -183.682 84.741 m -186.464 87.486 l 397.023 674.747 l 399.827 671.96 l h W n q 0 g /GS20 gs -84.5062256 470.5360413 470.5360413 84.5062256 148.9308014 144.4772797 cm BX /Sh0 sh EX Q Q q -196.341 97.364 m -199.146 100.109 l 384.364 687.348 l 387.105 684.604 l h W n q 0 g /GS21 gs -84.5024261 470.5148926 470.5148926 84.5024261 136.2322388 157.0929413 cm BX /Sh0 sh EX Q Q q -209.065 109.965 m -211.784 112.751 l 371.662 699.97 l 374.444 697.184 l h W n q 0 g /GS22 gs -84.5055618 470.5323486 470.5323486 84.5055618 123.5815582 169.7067261 cm BX /Sh0 sh EX Q Q q -221.746 122.546 m -224.508 125.332 l 358.981 712.549 l 361.785 709.763 l h W n q 0 g /GS23 gs -84.5051804 470.5302124 470.5302124 84.5051804 110.8903732 182.2862549 cm BX /Sh0 sh EX Q Q q -234.448 135.188 m -237.168 137.996 l 346.341 725.215 l 349.06 722.407 l h W n q 0 g /GS24 gs -84.5074081 470.5426636 470.5426636 84.5074081 98.1998596 194.9303436 cm BX /Sh0 sh EX Q Q q -247.129 147.768 m -249.933 150.556 l 333.597 737.772 l 336.379 734.986 l h W n q 0 g /GS25 gs -84.5055618 470.5323486 470.5323486 84.5055618 85.4762268 207.5018616 cm BX /Sh0 sh EX Q Q q -259.79 160.349 m -262.593 163.135 l 320.938 750.374 l 323.698 747.587 l h W n q 0 g /GS26 gs -84.508934 470.5511475 470.5511475 84.508934 72.8075562 220.0816803 cm BX /Sh0 sh EX Q Q q -272.513 172.99 m -275.253 175.799 l 308.276 763.018 l 311.017 760.21 l h W n q 0 g /GS27 gs -84.5074081 470.5426636 470.5426636 84.5074081 60.1355553 232.7328491 cm BX /Sh0 sh EX Q Q q -285.173 185.572 m -287.977 188.358 l 295.554 775.597 l 298.314 772.811 l h W n q 0 g /GS28 gs -84.5089417 470.551178 470.551178 84.5089417 47.4240265 245.3049622 cm BX /Sh0 sh EX Q Q q -297.833 198.173 m -300.637 200.959 l 282.874 788.178 l 285.655 785.39 l h W n q 0 g /GS29 gs -84.5061874 470.5358582 470.5358582 84.5061874 34.7625771 257.9055786 cm BX /Sh0 sh EX Q Q q -310.556 210.795 m -313.297 213.601 l 270.17 800.82 l 272.953 798.056 l h W n q 0 g /GS30 gs -84.5089493 470.551239 470.551239 84.5089493 22.0853176 270.5362854 cm BX /Sh0 sh EX Q Q q -323.216 223.396 m -326.02 226.183 l 257.49 813.399 l 260.271 810.635 l h W n q 0 g /GS31 gs -84.5058136 470.5337524 470.5337524 84.5058136 9.3808947 283.1292419 cm BX /Sh0 sh EX Q Q q -335.876 236.019 m -338.701 238.762 l 244.828 826.002 l 247.569 823.257 l h W n q 0 g /GS32 gs -84.5024643 470.5151062 470.5151062 84.5024643 -3.3137922 295.7456055 cm BX /Sh0 sh EX Q Q q -348.6 248.619 m -351.403 251.405 l 232.106 838.623 l 234.888 835.858 l h W n q 0 g /GS33 gs -84.5058212 470.5338135 470.5338135 84.5058212 -16.002634 308.3525391 cm BX /Sh0 sh EX Q Q q -361.281 261.198 m -364.064 263.984 l 219.445 851.204 l 222.229 848.459 l h W n q 0 g /GS34 gs -84.5055923 470.5325317 470.5325317 84.5055923 -28.6610661 320.9357605 cm BX /Sh0 sh EX Q Q q -373.941 273.843 m -376.766 276.586 l 206.764 863.826 l 209.526 861.082 l h W n q 0 g /GS35 gs -84.5024643 470.5151062 470.5151062 84.5024643 -41.3678703 333.5716248 cm BX /Sh0 sh EX Q Q q -386.665 286.422 m -389.447 289.229 l 194.063 876.427 l 196.867 873.682 l h W n q 0 g /GS36 gs -84.5055313 470.532196 470.532196 84.5055313 -54.0322342 346.1612549 cm BX /Sh0 sh EX Q Q q -399.324 299.045 m -402.128 301.831 l 181.402 889.047 l 184.186 886.262 l h W n q 0 g /GS37 gs -84.5052032 470.530365 470.530365 84.5052032 -66.7182693 358.7791748 cm BX /Sh0 sh EX Q Q q -411.985 311.667 m -414.809 314.453 l 168.721 901.629 l 171.483 898.906 l h W n q 0 g /GS38 gs -84.498642 470.4938354 470.4938354 84.498642 -79.4070053 371.3967896 cm BX /Sh0 sh EX Q Q q -424.708 324.268 m -427.533 327.032 l 156.018 914.271 l 158.781 911.485 l h W n q 0 g /GS39 gs -84.5052109 470.530426 470.530426 84.5052109 -92.1244507 383.9983521 cm BX /Sh0 sh EX Q Q q -437.388 336.847 m -440.192 339.633 l 143.337 926.831 l 146.122 924.066 l h W n q 0 g /GS40 gs -84.5018234 470.5115356 470.5115356 84.5018234 -104.7822647 396.581665 cm BX /Sh0 sh EX Q Q q -450.091 349.448 m -452.832 352.277 l 130.678 939.432 l 133.419 936.687 l h W n q 0 g /GS41 gs -84.5004883 470.5041199 470.5041199 84.5004883 -117.4490509 409.1888733 cm BX /Sh0 sh EX Q Q q -462.751 362.07 m -465.554 364.856 l 117.954 952.054 l 120.738 949.29 l h W n q 0 g /GS42 gs -84.5024872 470.5152283 470.5152283 84.5024872 -130.1547394 421.8031311 cm BX /Sh0 sh EX Q Q q -475.412 374.713 m -478.257 377.436 l 105.294 964.655 l 108.098 961.932 l h W n q 0 g /GS43 gs -84.4952469 470.4749146 470.4749146 84.4952469 -142.831131 434.4425659 cm BX /Sh0 sh EX Q Q q -488.156 387.294 m -490.96 390.08 l 92.635 977.299 l 95.354 974.511 l h W n q 0 g /GS44 gs -84.5035934 470.5214233 470.5214233 84.5035934 -155.5497284 447.0282288 cm BX /Sh0 sh EX Q Q endstream endobj 442 0 obj <> endobj 443 0 obj <> endobj 444 0 obj <> endobj 445 0 obj <> endobj 446 0 obj <> endobj 447 0 obj <> endobj 448 0 obj <> endobj 449 0 obj <> endobj 450 0 obj <> endobj 451 0 obj <> endobj 452 0 obj <> endobj 453 0 obj <> endobj 454 0 obj <> endobj 455 0 obj <> endobj 456 0 obj <> endobj 457 0 obj <> endobj 458 0 obj <> endobj 459 0 obj <> endobj 460 0 obj <> endobj 461 0 obj <> endobj 462 0 obj <> endobj 463 0 obj <> endobj 464 0 obj <> endobj 465 0 obj <> endobj 466 0 obj <> endobj 467 0 obj <> endobj 468 0 obj <> endobj 469 0 obj <> endobj 470 0 obj <> endobj 471 0 obj <> endobj 472 0 obj <> endobj 473 0 obj <> endobj 474 0 obj <> endobj 475 0 obj <> endobj 476 0 obj <> endobj 477 0 obj <> endobj 478 0 obj <> endobj 479 0 obj <> endobj 480 0 obj <> endobj 481 0 obj <> endobj 482 0 obj <> endobj 483 0 obj <> endobj 484 0 obj <> endobj 485 0 obj <> endobj 486 0 obj <> endobj 487 0 obj <> endobj 532 0 obj <> endobj 533 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024719 470.5151367 470.5151367 84.5024719 288.4641113 5.8245244 cm BX /Sh0 sh EX Q endstream endobj 534 0 obj <> endobj 531 0 obj <> endobj 535 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5049362 470.5288696 470.5288696 84.5049362 301.1379089 -6.7738895 cm BX /Sh0 sh EX Q endstream endobj 536 0 obj <> endobj 530 0 obj <> endobj 537 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5011673 470.5079041 470.5079041 84.5011673 313.8367004 -19.3715687 cm BX /Sh0 sh EX Q endstream endobj 538 0 obj <> endobj 529 0 obj <> endobj 539 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5049362 470.5288696 470.5288696 84.5049362 326.5215454 -31.9971905 cm BX /Sh0 sh EX Q endstream endobj 540 0 obj <> endobj 528 0 obj <> endobj 541 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5032425 470.5194702 470.5194702 84.5032425 339.2015991 -44.5727921 cm BX /Sh0 sh EX Q endstream endobj 542 0 obj <> endobj 527 0 obj <> endobj 543 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5035934 470.5214233 470.5214233 84.5035934 -155.5497284 447.0282288 cm BX /Sh0 sh EX Q endstream endobj 544 0 obj <> endobj 526 0 obj <> endobj 545 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4952469 470.4749146 470.4749146 84.4952469 -142.831131 434.4425659 cm BX /Sh0 sh EX Q endstream endobj 546 0 obj <> endobj 525 0 obj <> endobj 547 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 -130.1547394 421.8031311 cm BX /Sh0 sh EX Q endstream endobj 548 0 obj <> endobj 524 0 obj <> endobj 549 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5004883 470.5041199 470.5041199 84.5004883 -117.4490509 409.1888733 cm BX /Sh0 sh EX Q endstream endobj 550 0 obj <> endobj 523 0 obj <> endobj 551 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018234 470.5115356 470.5115356 84.5018234 -104.7822647 396.581665 cm BX /Sh0 sh EX Q endstream endobj 552 0 obj <> endobj 522 0 obj <> endobj 553 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4984055 470.4925232 470.4925232 84.4984055 351.8954163 -57.163044 cm BX /Sh0 sh EX Q endstream endobj 554 0 obj <> endobj 521 0 obj <> endobj 555 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5052109 470.530426 470.530426 84.5052109 -92.1244507 383.9983521 cm BX /Sh0 sh EX Q endstream endobj 556 0 obj <> endobj 520 0 obj <> endobj 557 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.498642 470.4938354 470.4938354 84.498642 -79.4070053 371.3967896 cm BX /Sh0 sh EX Q endstream endobj 558 0 obj <> endobj 519 0 obj <> endobj 559 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5052032 470.530365 470.530365 84.5052032 -66.7182693 358.7791748 cm BX /Sh0 sh EX Q endstream endobj 560 0 obj <> endobj 518 0 obj <> endobj 561 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055313 470.532196 470.532196 84.5055313 -54.0322342 346.1612549 cm BX /Sh0 sh EX Q endstream endobj 562 0 obj <> endobj 517 0 obj <> endobj 563 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024643 470.5151062 470.5151062 84.5024643 -41.3678703 333.5716248 cm BX /Sh0 sh EX Q endstream endobj 564 0 obj <> endobj 516 0 obj <> endobj 565 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055923 470.5325317 470.5325317 84.5055923 -28.6610661 320.9357605 cm BX /Sh0 sh EX Q endstream endobj 566 0 obj <> endobj 515 0 obj <> endobj 567 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5058212 470.5338135 470.5338135 84.5058212 -16.002634 308.3525391 cm BX /Sh0 sh EX Q endstream endobj 568 0 obj <> endobj 514 0 obj <> endobj 569 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024643 470.5151062 470.5151062 84.5024643 -3.3137922 295.7456055 cm BX /Sh0 sh EX Q endstream endobj 570 0 obj <> endobj 513 0 obj <> endobj 571 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5058136 470.5337524 470.5337524 84.5058136 9.3808947 283.1292419 cm BX /Sh0 sh EX Q endstream endobj 572 0 obj <> endobj 512 0 obj <> endobj 573 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5089493 470.551239 470.551239 84.5089493 22.0853176 270.5362854 cm BX /Sh0 sh EX Q endstream endobj 574 0 obj <> endobj 511 0 obj <> endobj 575 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.501152 470.5078125 470.5078125 84.501152 364.5837708 -69.7962036 cm BX /Sh0 sh EX Q endstream endobj 576 0 obj <> endobj 510 0 obj <> endobj 577 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5061874 470.5358582 470.5358582 84.5061874 34.7625771 257.9055786 cm BX /Sh0 sh EX Q endstream endobj 578 0 obj <> endobj 509 0 obj <> endobj 579 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5089417 470.551178 470.551178 84.5089417 47.4240265 245.3049622 cm BX /Sh0 sh EX Q endstream endobj 580 0 obj <> endobj 508 0 obj <> endobj 581 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5074081 470.5426636 470.5426636 84.5074081 60.1355553 232.7328491 cm BX /Sh0 sh EX Q endstream endobj 582 0 obj <> endobj 507 0 obj <> endobj 583 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.508934 470.5511475 470.5511475 84.508934 72.8075562 220.0816803 cm BX /Sh0 sh EX Q endstream endobj 584 0 obj <> endobj 506 0 obj <> endobj 585 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055618 470.5323486 470.5323486 84.5055618 85.4762268 207.5018616 cm BX /Sh0 sh EX Q endstream endobj 586 0 obj <> endobj 505 0 obj <> endobj 587 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5074081 470.5426636 470.5426636 84.5074081 98.1998596 194.9303436 cm BX /Sh0 sh EX Q endstream endobj 588 0 obj <> endobj 504 0 obj <> endobj 589 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5051804 470.5302124 470.5302124 84.5051804 110.8903732 182.2862549 cm BX /Sh0 sh EX Q endstream endobj 590 0 obj <> endobj 503 0 obj <> endobj 591 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055618 470.5323486 470.5323486 84.5055618 123.5815582 169.7067261 cm BX /Sh0 sh EX Q endstream endobj 592 0 obj <> endobj 502 0 obj <> endobj 593 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024261 470.5148926 470.5148926 84.5024261 136.2322388 157.0929413 cm BX /Sh0 sh EX Q endstream endobj 594 0 obj <> endobj 501 0 obj <> endobj 595 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5062256 470.5360413 470.5360413 84.5062256 148.9308014 144.4772797 cm BX /Sh0 sh EX Q endstream endobj 596 0 obj <> endobj 500 0 obj <> endobj 597 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4929352 470.4620667 470.4620667 84.4929352 377.3088379 -82.392952 cm BX /Sh0 sh EX Q endstream endobj 598 0 obj <> endobj 499 0 obj <> endobj 599 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5093384 470.5533752 470.5533752 84.5093384 161.6377258 131.881073 cm BX /Sh0 sh EX Q endstream endobj 600 0 obj <> endobj 498 0 obj <> endobj 601 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024261 470.5148926 470.5148926 84.5024261 174.3252258 119.2956085 cm BX /Sh0 sh EX Q endstream endobj 602 0 obj <> endobj 497 0 obj <> endobj 603 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.509346 470.5534363 470.5534363 84.509346 186.9776917 106.6536789 cm BX /Sh0 sh EX Q endstream endobj 604 0 obj <> endobj 496 0 obj <> endobj 605 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055847 470.5324707 470.5324707 84.5055847 199.6894989 94.0800323 cm BX /Sh0 sh EX Q endstream endobj 606 0 obj <> endobj 495 0 obj <> endobj 607 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4948959 470.4729614 470.4729614 84.4948959 212.3522186 81.4901123 cm BX /Sh0 sh EX Q endstream endobj 608 0 obj <> endobj 494 0 obj <> endobj 609 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018082 470.5114746 470.5114746 84.5018082 225.037674 68.8541489 cm BX /Sh0 sh EX Q endstream endobj 610 0 obj <> endobj 493 0 obj <> endobj 611 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4973679 470.4867249 470.4867249 84.4973679 237.743576 56.2540016 cm BX /Sh0 sh EX Q endstream endobj 612 0 obj <> endobj 492 0 obj <> endobj 613 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4959335 470.4787598 470.4787598 84.4959335 250.4152679 43.6852188 cm BX /Sh0 sh EX Q endstream endobj 614 0 obj <> endobj 491 0 obj <> endobj 615 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018082 470.5114746 470.5114746 84.5018082 263.0805664 31.0478077 cm BX /Sh0 sh EX Q endstream endobj 616 0 obj <> endobj 490 0 obj <> endobj 617 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.501152 470.5078125 470.5078125 84.501152 275.7851562 18.4294758 cm BX /Sh0 sh EX Q endstream endobj 618 0 obj <> endobj 489 0 obj <> endobj 619 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.491539 470.4542847 470.4542847 84.491539 389.9489441 -94.9675598 cm BX /Sh0 sh EX Q endstream endobj 620 0 obj <> endobj 488 0 obj <> endobj 621 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 402.6374512 -107.6104355 cm BX /Sh0 sh EX Q endstream endobj 622 0 obj <> endobj 441 0 obj <> endobj 437 0 obj <> endobj 17 0 obj <> endobj 623 0 obj <> endobj 624 0 obj <> endobj 625 0 obj <> endobj 15 0 obj <> endobj 626 0 obj <> endobj 627 0 obj <>stream HV{xWGoLww!@1 @x,tZ:&)(h}TbjRnl-VڧGEhү_s{s;쎁kzP…i3~ǷK|@ ywUrQgaSoib]wtżƞDw.ySF^ןvcߎ̼:D6oM&':e/1؟/ $zGKYK;҇>ߡ=pk;y3#ifԃ+ K-a:8?tk1~190gK</;zuV.74Sx i*^op38ʹyp#;^TM58x(B1{R C=0 тK1 +N\ G^_q_Zwc.c'<[u|!܇#9N\Z?(D\ [}6 b7>v>=>nm؇#* 4Y.j0-I(DO>TNAj54Oi -/RTFM%7yO*< (MDʥ<'1tTJ^/$*ljJй0Q)hT1v qAi Eh-IK) {!ɻ<q~5s7eO:`36ƴR]Mi7ݤڣڳzͮ\Q%j_ԋf1WDA_55_/5=vFK:*l^FZA5FX r:FhmA[=v[&*E9obNvR[qש]|g x9VGy#iFJǍ:p\;ثǎ8AyW3TI tJskZVMЪj^hK5Z/3_dڵ9;637O/:,+f]F[\\KF= 2 _xO3ǟgXWwטb{!3W\)g;|`>U!|QD᮰wmA ΰ{ romμ>Al.‹~p={q އ&C\E>G-n Ј0 _LBƗъb.n| !|cX;)tBbr܅Up/O?ZW'6 lX3Ƚ":)rCڸh"TMPg&Ф>ړlOwڡ)툖>^0x WtJoךCRKܛN&'aI0/lL)ޠL-tׯnp4h']uʵqӇBbnBVDlљJ߬v{327yE(]zjQO-n[K X!XVPLq%3O8#$FqXt%S!4c=fGceX !6j1q;'VZqYBwY+hcʬp`!8q#^IIBz2ռpzl-Ŏ8fYyGC瘯En-`Œ!#ċqLs^rvD$c"e-~Ch8/ 3iQٝe8?!KJ,(5NHG veaC,6;WSU+ z,1;W;2˜R3x(,)EU\ɡT xTp){3zuV,FwSu2hf;*3hUqYdDTq\p!aKJk(4dJyC@s&0@P)R%fʥdr+9Ly2S^%u3dVrQriaC4IR$()+Ɣ28er 1! odW~ Ƨ)g|JOZƧdS)9)4M1)ӠfKla'L=Sj)dNct dH#^t7*Ɣʣqnd yz)f;}}fW머JDzGusνg7Y` yl&!  @HPjQjD/2J;nX:Ge:/N3~%{|3]t( FU&`)߈ >z1aOG_/-i}hxE9w9$Z;4]AҲ݁K!i]zk)VV0=j(W''kjf{CtkY{vEl 5Bڻ֋`jء wzl-SE@L,#bE:QaU> o)_&.W|-{>ڔZt0;4KꍛUWzKk#Rv*%݅PW\o;E؛=>\Wu"f;Qk yZw fO۰+m,AX*ʆ0[rJK B>WH?$q+oԢZ5tU04&?9 O')veG(E=~,ǝl x M`Hz`O/ޥO )i[hVC-. ;(q"tN#@\ & %Dēhx=>G{= Оf 0GljC`8NH]]@'.B.BOJ]NK].B}>n)ʶ>sty"^:$Ӓ yLW\y%g\!͸C?u %K:$s{^^I :$:$e4/_!n[q啤_!ѿC 3 URUv%'Jp~04K;w3ۜVl*/+UL{6˽J,F ro,fy|myYs ϽIeY;~Y-ۓjbB1)"3I}) FTiȨfkT͚Ţx$viQ3\Nw$o^\^fܻ϶\R}z˅W/N_qtd'qX v۬¤&6jcO3A9ҡBFAE-b%X[<jM=G]Z~p%[9O=yӧ.Xi@Q|,1H <Äj',l~ Wu5gDzh.af7;Ɏxly2>?u8x;/v>9smTPoJ|^fa )԰c LSUUmRpD\.ۧFĝ<c$תJ"un Sl`#SA>hjJ3`y"ڴ*cvF yX&.fRVJ=g"/JYCM=ӹ_L~];B@C?.'kL[L4e&l,U.sw|%ܿ9S=9t:[2ûH^N#6mT=Q5:J4Lp"S5DbC~OM` !a4F(]UG GWgpjUMYNǖJ|Fy®!uH?grY]FE.4YK*LbAa;M-Hju!9)UC^Nh2]]@,(kz@`#6KjñL$n|4L4i;\e֪]ފM߶zGPvY%JWrfT-q1T3M vF-0uJ|e.^nDqIC@*d!b̔sM5nYwa2M]y2yn?K{?G ƚ1j]3x "`O#y_qN1Qe5k}1YĐ2֌F1w{ڽ)ҿ+=Gx ĭ@x[%ZL4[URW f26Y^v1=OG Dh)F:&|fut̉͂D 7 endstream endobj 6 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 629 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000067235 00000 n 0000000000 00000 f 0000067292 00000 n 0000282375 00000 n 0000067672 00000 n 0000216571 00000 n 0000235696 00000 n 0000216201 00000 n 0000120958 00000 n 0000166889 00000 n 0000166618 00000 n 0000167459 00000 n 0000276253 00000 n 0000167024 00000 n 0000275696 00000 n 0000235761 00000 n 0000236004 00000 n 0000068109 00000 n 0000086140 00000 n 0000216324 00000 n 0000216448 00000 n 0000166755 00000 n 0000167927 00000 n 0000086206 00000 n 0000086450 00000 n 0000090842 00000 n 0000099932 00000 n 0000100177 00000 n 0000104593 00000 n 0000166555 00000 n 0000166492 00000 n 0000140984 00000 n 0000113947 00000 n 0000141047 00000 n 0000141163 00000 n 0000141279 00000 n 0000141395 00000 n 0000141511 00000 n 0000141627 00000 n 0000141743 00000 n 0000141859 00000 n 0000141975 00000 n 0000142091 00000 n 0000142207 00000 n 0000142323 00000 n 0000142439 00000 n 0000142555 00000 n 0000142671 00000 n 0000142787 00000 n 0000142903 00000 n 0000143019 00000 n 0000143135 00000 n 0000143251 00000 n 0000143367 00000 n 0000143483 00000 n 0000143599 00000 n 0000143715 00000 n 0000143831 00000 n 0000143947 00000 n 0000144063 00000 n 0000144179 00000 n 0000144295 00000 n 0000144411 00000 n 0000144527 00000 n 0000144643 00000 n 0000144759 00000 n 0000144875 00000 n 0000144991 00000 n 0000145107 00000 n 0000145223 00000 n 0000145339 00000 n 0000145455 00000 n 0000145571 00000 n 0000145687 00000 n 0000145803 00000 n 0000145919 00000 n 0000146035 00000 n 0000146151 00000 n 0000113803 00000 n 0000140921 00000 n 0000140858 00000 n 0000113740 00000 n 0000114828 00000 n 0000114944 00000 n 0000115060 00000 n 0000115176 00000 n 0000115292 00000 n 0000115408 00000 n 0000115524 00000 n 0000115640 00000 n 0000115756 00000 n 0000115872 00000 n 0000115988 00000 n 0000116104 00000 n 0000116220 00000 n 0000116336 00000 n 0000116452 00000 n 0000116568 00000 n 0000116685 00000 n 0000116802 00000 n 0000116919 00000 n 0000117036 00000 n 0000117153 00000 n 0000117270 00000 n 0000117387 00000 n 0000117504 00000 n 0000117621 00000 n 0000117738 00000 n 0000117855 00000 n 0000117972 00000 n 0000118089 00000 n 0000118206 00000 n 0000118323 00000 n 0000118440 00000 n 0000118557 00000 n 0000118674 00000 n 0000118791 00000 n 0000118908 00000 n 0000119025 00000 n 0000119142 00000 n 0000119259 00000 n 0000119376 00000 n 0000119493 00000 n 0000119610 00000 n 0000119727 00000 n 0000119844 00000 n 0000119961 00000 n 0000114009 00000 n 0000114302 00000 n 0000114690 00000 n 0000114130 00000 n 0000114213 00000 n 0000114745 00000 n 0000140407 00000 n 0000139958 00000 n 0000139507 00000 n 0000139056 00000 n 0000138607 00000 n 0000138157 00000 n 0000137707 00000 n 0000137256 00000 n 0000136805 00000 n 0000136355 00000 n 0000135904 00000 n 0000135453 00000 n 0000135002 00000 n 0000134552 00000 n 0000134101 00000 n 0000133650 00000 n 0000133199 00000 n 0000132748 00000 n 0000132298 00000 n 0000131848 00000 n 0000131398 00000 n 0000130948 00000 n 0000130500 00000 n 0000130049 00000 n 0000129602 00000 n 0000129152 00000 n 0000128702 00000 n 0000128254 00000 n 0000127806 00000 n 0000127357 00000 n 0000126913 00000 n 0000126465 00000 n 0000126016 00000 n 0000125567 00000 n 0000125116 00000 n 0000124667 00000 n 0000124218 00000 n 0000123769 00000 n 0000123320 00000 n 0000122873 00000 n 0000122424 00000 n 0000121973 00000 n 0000121522 00000 n 0000121071 00000 n 0000120078 00000 n 0000120133 00000 n 0000120451 00000 n 0000120529 00000 n 0000120678 00000 n 0000120799 00000 n 0000120878 00000 n 0000121126 00000 n 0000121444 00000 n 0000121577 00000 n 0000121895 00000 n 0000122028 00000 n 0000122346 00000 n 0000122479 00000 n 0000122795 00000 n 0000122928 00000 n 0000123242 00000 n 0000123375 00000 n 0000123691 00000 n 0000123824 00000 n 0000124140 00000 n 0000124273 00000 n 0000124589 00000 n 0000124722 00000 n 0000125038 00000 n 0000125171 00000 n 0000125489 00000 n 0000125622 00000 n 0000125938 00000 n 0000126071 00000 n 0000126387 00000 n 0000126520 00000 n 0000126835 00000 n 0000126968 00000 n 0000127279 00000 n 0000127412 00000 n 0000127728 00000 n 0000127861 00000 n 0000128176 00000 n 0000128309 00000 n 0000128624 00000 n 0000128757 00000 n 0000129074 00000 n 0000129207 00000 n 0000129524 00000 n 0000129657 00000 n 0000129971 00000 n 0000130104 00000 n 0000130422 00000 n 0000130555 00000 n 0000130870 00000 n 0000131003 00000 n 0000131320 00000 n 0000131453 00000 n 0000131770 00000 n 0000131903 00000 n 0000132220 00000 n 0000132353 00000 n 0000132670 00000 n 0000132803 00000 n 0000133121 00000 n 0000133254 00000 n 0000133572 00000 n 0000133705 00000 n 0000134023 00000 n 0000134156 00000 n 0000134474 00000 n 0000134607 00000 n 0000134924 00000 n 0000135057 00000 n 0000135375 00000 n 0000135508 00000 n 0000135826 00000 n 0000135959 00000 n 0000136277 00000 n 0000136410 00000 n 0000136727 00000 n 0000136860 00000 n 0000137178 00000 n 0000137311 00000 n 0000137629 00000 n 0000137762 00000 n 0000138079 00000 n 0000138212 00000 n 0000138529 00000 n 0000138662 00000 n 0000138978 00000 n 0000139111 00000 n 0000139429 00000 n 0000139562 00000 n 0000139880 00000 n 0000140013 00000 n 0000140329 00000 n 0000140462 00000 n 0000140780 00000 n 0000166042 00000 n 0000165593 00000 n 0000165144 00000 n 0000164694 00000 n 0000164245 00000 n 0000163795 00000 n 0000163346 00000 n 0000162896 00000 n 0000162447 00000 n 0000161998 00000 n 0000161548 00000 n 0000161098 00000 n 0000160648 00000 n 0000160198 00000 n 0000159748 00000 n 0000159298 00000 n 0000158848 00000 n 0000158398 00000 n 0000157948 00000 n 0000157498 00000 n 0000157048 00000 n 0000156598 00000 n 0000156150 00000 n 0000155700 00000 n 0000155253 00000 n 0000154803 00000 n 0000154354 00000 n 0000153906 00000 n 0000153459 00000 n 0000153009 00000 n 0000152561 00000 n 0000152111 00000 n 0000151661 00000 n 0000151212 00000 n 0000150762 00000 n 0000150312 00000 n 0000149862 00000 n 0000149412 00000 n 0000148962 00000 n 0000148514 00000 n 0000148066 00000 n 0000147616 00000 n 0000147166 00000 n 0000146717 00000 n 0000146267 00000 n 0000146322 00000 n 0000146639 00000 n 0000146772 00000 n 0000147088 00000 n 0000147221 00000 n 0000147538 00000 n 0000147671 00000 n 0000147988 00000 n 0000148121 00000 n 0000148436 00000 n 0000148569 00000 n 0000148884 00000 n 0000149017 00000 n 0000149334 00000 n 0000149467 00000 n 0000149784 00000 n 0000149917 00000 n 0000150234 00000 n 0000150367 00000 n 0000150684 00000 n 0000150817 00000 n 0000151134 00000 n 0000151267 00000 n 0000151583 00000 n 0000151716 00000 n 0000152033 00000 n 0000152166 00000 n 0000152483 00000 n 0000152616 00000 n 0000152931 00000 n 0000153064 00000 n 0000153381 00000 n 0000153514 00000 n 0000153828 00000 n 0000153961 00000 n 0000154276 00000 n 0000154409 00000 n 0000154725 00000 n 0000154858 00000 n 0000155175 00000 n 0000155308 00000 n 0000155622 00000 n 0000155755 00000 n 0000156072 00000 n 0000156205 00000 n 0000156520 00000 n 0000156653 00000 n 0000156970 00000 n 0000157103 00000 n 0000157420 00000 n 0000157553 00000 n 0000157870 00000 n 0000158003 00000 n 0000158320 00000 n 0000158453 00000 n 0000158770 00000 n 0000158903 00000 n 0000159220 00000 n 0000159353 00000 n 0000159670 00000 n 0000159803 00000 n 0000160120 00000 n 0000160253 00000 n 0000160570 00000 n 0000160703 00000 n 0000161020 00000 n 0000161153 00000 n 0000161470 00000 n 0000161603 00000 n 0000161920 00000 n 0000162053 00000 n 0000162369 00000 n 0000162502 00000 n 0000162818 00000 n 0000162951 00000 n 0000163268 00000 n 0000163401 00000 n 0000163717 00000 n 0000163850 00000 n 0000164167 00000 n 0000164300 00000 n 0000164616 00000 n 0000164749 00000 n 0000165066 00000 n 0000165199 00000 n 0000165515 00000 n 0000165648 00000 n 0000165964 00000 n 0000166097 00000 n 0000166414 00000 n 0000207232 00000 n 0000207259 00000 n 0000201089 00000 n 0000201116 00000 n 0000191701 00000 n 0000191728 00000 n 0000182928 00000 n 0000175339 00000 n 0000168314 00000 n 0000168567 00000 n 0000175592 00000 n 0000183184 00000 n 0000192258 00000 n 0000192724 00000 n 0000192794 00000 n 0000193064 00000 n 0000193180 00000 n 0000201491 00000 n 0000201761 00000 n 0000201831 00000 n 0000202101 00000 n 0000202202 00000 n 0000207797 00000 n 0000208295 00000 n 0000208365 00000 n 0000208632 00000 n 0000208746 00000 n 0000275632 00000 n 0000236377 00000 n 0000236441 00000 n 0000240868 00000 n 0000275568 00000 n 0000250033 00000 n 0000250097 00000 n 0000250214 00000 n 0000250331 00000 n 0000250448 00000 n 0000250565 00000 n 0000250682 00000 n 0000250799 00000 n 0000250916 00000 n 0000251033 00000 n 0000251150 00000 n 0000251267 00000 n 0000251384 00000 n 0000251501 00000 n 0000251618 00000 n 0000251735 00000 n 0000251852 00000 n 0000251969 00000 n 0000252086 00000 n 0000252203 00000 n 0000252320 00000 n 0000252437 00000 n 0000252554 00000 n 0000252671 00000 n 0000252788 00000 n 0000252905 00000 n 0000253022 00000 n 0000253139 00000 n 0000253256 00000 n 0000253373 00000 n 0000253490 00000 n 0000253607 00000 n 0000253724 00000 n 0000253841 00000 n 0000253958 00000 n 0000254075 00000 n 0000254192 00000 n 0000254309 00000 n 0000254426 00000 n 0000254543 00000 n 0000254660 00000 n 0000254777 00000 n 0000254894 00000 n 0000255011 00000 n 0000255128 00000 n 0000255245 00000 n 0000275117 00000 n 0000274669 00000 n 0000274222 00000 n 0000273773 00000 n 0000273324 00000 n 0000272876 00000 n 0000272428 00000 n 0000271979 00000 n 0000271530 00000 n 0000271082 00000 n 0000270632 00000 n 0000270183 00000 n 0000269734 00000 n 0000269284 00000 n 0000268834 00000 n 0000268384 00000 n 0000267934 00000 n 0000267485 00000 n 0000267036 00000 n 0000266589 00000 n 0000266140 00000 n 0000265693 00000 n 0000265244 00000 n 0000264796 00000 n 0000264349 00000 n 0000263901 00000 n 0000263452 00000 n 0000263003 00000 n 0000262553 00000 n 0000262103 00000 n 0000261655 00000 n 0000261207 00000 n 0000260759 00000 n 0000260311 00000 n 0000259862 00000 n 0000259412 00000 n 0000258961 00000 n 0000258510 00000 n 0000258060 00000 n 0000257609 00000 n 0000257159 00000 n 0000256709 00000 n 0000256259 00000 n 0000255810 00000 n 0000255362 00000 n 0000255417 00000 n 0000255732 00000 n 0000255865 00000 n 0000256181 00000 n 0000256314 00000 n 0000256631 00000 n 0000256764 00000 n 0000257081 00000 n 0000257214 00000 n 0000257531 00000 n 0000257664 00000 n 0000257982 00000 n 0000258115 00000 n 0000258432 00000 n 0000258565 00000 n 0000258883 00000 n 0000259016 00000 n 0000259334 00000 n 0000259467 00000 n 0000259784 00000 n 0000259917 00000 n 0000260233 00000 n 0000260366 00000 n 0000260681 00000 n 0000260814 00000 n 0000261129 00000 n 0000261262 00000 n 0000261577 00000 n 0000261710 00000 n 0000262025 00000 n 0000262158 00000 n 0000262475 00000 n 0000262608 00000 n 0000262925 00000 n 0000263058 00000 n 0000263374 00000 n 0000263507 00000 n 0000263823 00000 n 0000263956 00000 n 0000264271 00000 n 0000264404 00000 n 0000264718 00000 n 0000264851 00000 n 0000265166 00000 n 0000265299 00000 n 0000265615 00000 n 0000265748 00000 n 0000266062 00000 n 0000266195 00000 n 0000266511 00000 n 0000266644 00000 n 0000266958 00000 n 0000267091 00000 n 0000267407 00000 n 0000267540 00000 n 0000267856 00000 n 0000267989 00000 n 0000268306 00000 n 0000268439 00000 n 0000268756 00000 n 0000268889 00000 n 0000269206 00000 n 0000269339 00000 n 0000269656 00000 n 0000269789 00000 n 0000270105 00000 n 0000270238 00000 n 0000270554 00000 n 0000270687 00000 n 0000271004 00000 n 0000271137 00000 n 0000271452 00000 n 0000271585 00000 n 0000271901 00000 n 0000272034 00000 n 0000272350 00000 n 0000272483 00000 n 0000272798 00000 n 0000272931 00000 n 0000273246 00000 n 0000273379 00000 n 0000273695 00000 n 0000273828 00000 n 0000274144 00000 n 0000274277 00000 n 0000274591 00000 n 0000274724 00000 n 0000275039 00000 n 0000275172 00000 n 0000275490 00000 n 0000275844 00000 n 0000275965 00000 n 0000276112 00000 n 0000276617 00000 n 0000276873 00000 n 0000936783 00000 n trailer <]>> startxref 937027 %%EOF