%PDF-1.6 % 1 0 obj <>]/Pages 3 0 R/Type/Catalog>> endobj 2 0 obj <>stream application/pdf Kubernetes Mongodb 2019-05-29T15:21:50-03:00 2019-05-29T15:21:50-03:00 2019-05-29T15:21:50-03:00 Adobe Illustrator CC 23.0 (Macintosh) 256 148 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAlAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A7q/kSyZy36R1AciTQTL1 Ph8Gas9lQ/nT+f7HZDtOf82Hy/a1/gGx/wCrlqP/ACPXc+3wYP5Jh/On8/2L/Kc/5sPl+13+AbHv qWoe/wC/X7vsY/yTD+dP5/sX+U5/zYfL9rv8BWX/AFctQHj+/Xb/AITH+SYfzp/P9i/ynP8Amw+X 7VaL8u9PdAx1LUhX/i9f+aMf5Jh/On8/2L/Kc/5sPl+1f/yrjTv+rnqX/I9f+qeP8kw/nT+f7F/l Of8ANh8v2u/5Vxp3/Vz1L/kev/VPH+SYfzp/P9i/ynP+bD5ftd/yrjTv+rnqX/I9f+qeP8kw/nT+ f7F/lOf82Hy/a7/lXGnf9XPUv+R6/wDVPH+SYfzp/P8AYv8AKc/5sPl+13/KuNO/6uepf8j1/wCq eP8AJMP50/n+xf5Tn/Nh8v2u/wCVcad/1c9S/wCR6/8AVPH+SYfzp/P9i/ynP+bD5ftd/wAq407/ AKuepf8AI9f+qeP8kw/nT+f7F/lOf82Hy/a7/lXGnf8AVz1L/kev/VPH+SYfzp/P9i/ynP8Amw+X 7U+0bSYtKshaRTTToGLepOwd/i7VAXM7T4Bijwgk+9w8+Y5JcRAHuR2XtLsVdirsVY1rXle11W6W 4lu7q3ZEEYS3kCKQGJqQVbf4swtToY5ZcRMht0Ll4NZLFGgIn3hL/wDlX9h/1ctQ/wCR6/8ANGUf yTD+dP5/sb/5Tn/Nh8v2u/wBYf8AVy1D/kcv/NGP8kw/nT+f7F/lOf8ANh8v2u/wBYf9XLUP+R6/ 80Y/yTD+dP5/sX+U5/zYfL9qE1Xynoul6dPqF5qepLbWy85SsoZqVpsoSpO+Qn2ZjiLMp/P9jPHr 8k5CIjCz5ftRf+ALD/q5ah/yPX/mjJ/yTD+dP5/sYfynP+bD5ftd/gCw/wCrjqH/ACOX/mjH+SYf zp/P9i/ynP8Amw+X7Wv8AWH/AFctQ/5HL/zRj/JMP50/n+xf5Tn/ADYfL9rv8AWH/Vx1D/kcv/NG P8kw/nT+f7F/lOf82Hy/a7/AFhT/AI6Wof8AI5f+aMf5Jh/On8/2L/Kcv5sPl+13+AbD/q46h/yO X/mjH+SYfzp/P9i/ynP+bD5ftd/gGw/6uOof8jl/5ox/kmH86fz/AGL/ACnP+bD5ftd/gGw/6uOo f8j1/wCaMf5Jh/On8/2L/Kc/5sPl+1G6R5WtdLuzcxXd1OxQpwnkDpuQa8Qq77bZfp9DHFLiEpH3 lpz6yWSNERHuCcTtMsMjQqHmCn00Y8QzAfCtaGgr1NMzDycQVe7Dv+Vo6TbQJb6na3MHmIMYptBt 42uLlXG/7viArIy/ErVoRmP+ZA5j1dznfkJE3Ejg/ncgkfkP8xfLWleXLTTtUF1pbxrcSQy3kTCO Ues7sIpBUOwrSm2+wyrBnjGIB2cjV6LJPIZRqXLl7me+X9Q1PUNOF3qFgdNkkdjDayNykENfgaUU HF2HVd6Zl45EiyKdbmhGMqieJb50e0Tyjdvd3l/YW4aLld6WX+uJynRR6fAM25NG2Pw1ybUwfTNR 02W0t418z+aWEwSRZJrK4DFGeNQpkFtT/dZHJW/abfwUqWl3umy2UqL5r82VuA0kUktnOXiEKgMA 31Vlb4WHLc+OxNcVWetYWF9ZqfOPmqd1lCtG1rLIrIeQCv8A6P3aL7W5ofeuKpjomu6FZ6jHdT+Y vMd+LQkra3dpcpE/KKRQZALePl0PGtByAoK4oZS/5keXUZ09O9aSMcmjWznZ+NVAbiFLUo1enY13 2xVRX80/KzgGOPUXDKGU/o69VaEKQeTxKoX4x8RNPemKtW/5reVJ5RCq3yylDJ6cljdI3FQSSA0Y 5fZp8Nf14qy5ZI3JCMGK/aAINK+OKrsVdirsVdirsVQZ64q7FWsVULy9sLRFa8uIreOQ8FMzqgZi K8RyIqadsjKQHNlGBlyFvFNd1++uLHUbMazcL5bEtzaaSsTxT3M0kZG1xIeUvos3JYj1IFGPQnW5 Mhoi/T0/Hc77FhAkDwjxNiegHu6X3/Yn3lvzNczeZLGDVdZefQZFmn0WeZ4YZpXi4qBerHx2oxeI NSvVhXYW48tyFn09P2uPnwAYyYxqe3FzP+l/SybzxY6XrOn6NdSH63YWl+l6Pq8gHqCOCZV4yKa/ aYGq718PtDLlOhY3dbjxXIiR4fewC78oW93HqIeO5hl1DVJNaDJFAJPVP1tI4wzXA9Ti04IYBKU2 oTyEBmP80t50sf8AVI/b+pPbzSf0mNfVBfJJqzwP8Rt2RfTeNgnLkxlRg9AjjjxBFQvxY+Kf5pYn TxH8cft8/wBX2/BK30eOXVLvVrSXU45rzT1sWacwOyxyWsERm5GWplCoasVFWNO2Dxj/ADSzOkiP 8pH7f1PSfJtkbDyxYWPqyTR2sZhhkm9P1PRRysSt6RZCVjCjbr126ZfE2HDnEA0Dac4WLsVdiqVa 1q+q2M9vHZaPPqiyhvVkgkgjEXHoD6zx7tlc5kHYW3YscZA3IR+f6HkVtqGqq2teaRp11B5ljv7g pdNNbcI4IKJ9TeB5UeRKDgSq1rTiajNeJHeX8V/gO7lCPpx2PD4R0PM/xXWyF0959d8v6hZ31vNq 9jpNtM1obWWOCK3kcNKbuRLmSGeRkZ2QEpxAU0qa5GHqiQdwB+CznWOYIPCZEXe99K2BD0jyP5p8 x6ho+hi80O5ZLmBfW1RpYPTbitBMU5+pR6V3Uddq5m4ckiBY+LqtXp8cZSqQ2PLf5dyY/mhbzXP5 f38MMTXDu9v+5SL1+ai5jLfB6F30FTX0mpTMlwHh7eXr1Li1S0sBCzLyR0sqDjAvqqDI+jK/qsqc jX2alDQKVzeWmRrWCLSjwMCeoEsXaVucAWRgDozSFlfcNypUbUPRVESWN4PhOkTwzmA20/K15gGN uPAkaLJG6sqr9kUooFf5lXf4XkcIkmit6dyfUSunyowKNxAK2+jcdpeanklePEgDFXDSbiJJQvlk huCH6wNOYhnlBDkV0VaLtQoqigqV3qcVWWuiXin07XSON7aiWV7qOzYmtBSvLR+YZf2UqOm4r9pV UuNH1DTdSiV9IZXglRS0VkZFQMajgf0KOPNnXZO5Oyk4q9h/LafS3W+MHl5NAvZpC8scFncW0ckK k+iXeaC2VpAJDUCv8AoZtirsVdirsVdiqEOKtYq6mKoPVLKC6tHD2sN3LGGe3juFV09UKeJ+IGnu cjONjlbPHIg8yPc8a1j8rPzBjrHafUrm2aczpbW6xxIHkYs1WcQyIoLGgV2ptmtnpcnk73F2hg62 DX47x9yP8p+U/OEeu2S6z5bt/qOnxyxwO80BiQTsCztxEsk3BFKxq2/i3fJ4sM+IXHYfj4tWp1GI wPBM3LyPT7vP7mYfmF5TvdX8v2elaLa2gWG59Qwzj04kRbeYLx4CqkyMq/D0BPTrmwAA2DpTIk2X nzflf5xW1mT9DaZMsLIunQu5B9Dn6sqSyK9eTs7dOjV40FMKqUH5U+eLd454NL0xbuGKMrI80p/f oUJ4Uk6VFTy78v8AJxVR/wCVS+cfgZNF09XjREQPKWHEJxNaSVPU/TSm1cVeueQdHvdG8pafpt7D Hb3UAk9WGE1jUvK7/Cat2bffboMUJ/irsVdiqC1qRRYtbi/TTri8It7W4cqCJZAaCMMRykIB4jIz BIobM4EAgkWHkOo/lJoeoz107X7G8v7h3LI8ziZ3jAMpEvrXO69WrG1O+YMtEehdxi7XrYjb4fdQ +9BTfl15ygtYzHr+m31lJatUzXUif6ISOYMyhHeAMR+1xr2GQOlyDq2jtHAd+Eg35fP3vWvKCXtv p0VpqF/Z3V0sUZitbABYYoFHpp6YJMjLVSOR22oBtmdijIDd02onCUriD8eZVvPl5ptp5MvZ9SWS S0VofUSG5WykJ9dOPCdnhClTv9sVpTvlrQ810vzb5CSCzl9HVrSEhY0Z/MMTQqUlAZQG1H7C9/hH w9t91VK381eRLxw7xaxb3DqPVSLX4jyaCNF6C/DGqLu3EbCvyUspsvzf8o6bawabaQPJb2cTRgnU NOd0WEmNQzTXgZuXEUJPfFCKh/O7ypJSqhSTsv13TCaVoDtdEb/P50xVCXX59eX7eH1vqEjx8UJK 3mmvRnRnCnhdPQkRn/b2xVcn576A6o66fM6NL6JZLrT6Bg1GA5XK8qCjbbUIJI3oqr/8rs0E2/1i O25oiPJMgvdPLgI4UhCs7RsfiU/bHUYq9ChdpIUkZDEzqGaJqclJFeJ4kio9jiq/FXYq7FXYq7FV nox+GKpD5n802Hl4xG5sL+7jljklaWyga4WNYmRSJOJqCfVqNugJ7YqlT/mXoweBY9H1mdLjiI5o 7CXgS/Ej4m49nrXp74q7/lZej8YS2i64ryqGaM6dPyjO9VegIqvE14k4qyjS7q21GxjvIopoY5Cw EdxG8Mo4OUPKNwGFStRXtiqL9CPwxVr0IvDFXehH4Yq70IvDFXehH4fjirvq8Xhirvq8Xh+OKu+r xeGKu+rxeH44qx/zFoo1RLCtvb3LWN2l2kV1y9PkiOnL4a/EPUqtQRkZ8XRsx8P8V/Bidv8AltLC tpKLLT3ubQzNGjyXLRH61GyXFR/K1aAMDsa1r1q/ef0ftb/3F/x18FWT8u1ZIYhp1jJElq9k3q3F 27elI5circuVWlk3IqAaVocP7z+j9qB4P9L7Ex8r+Sk0bUo770oY3jshYKYZbiSkSMhSNVlJXiCp NftV77nJQ4+tNeTw69PF8aTHz9p+pah5MvLXTY5pb1mhMKWzFXPCdGYVE9ptxBr+9GWNLy7T/Jvn qKFPV0/UnVVbnWWaN/3KkgKV1o7uGIWi05UxV1j5J89wuiT2OoTmMeqG9WYVkMQK1P6ZVTTdGG25 8DUKWk8l+dVimtX0i/kspZCzCOeZSysYz8bNq6lz6Yof3dOXTYYq2nk7z8xmZtNvlKuK8naRXUGj r6b6vIHLfDuT9nl8XKmKqjeTfPFtbJbix1C4haORJGSa55M9FMcnE6wnFRQDjSuzDuMVdf8Aknzy IQVsb+ZvQWNuEkwUuBQUUa2p2RVBJUgmp3xQn/lHyh5vN+2oXEf6PvoqCR79JpYZonXjxSJNTu4+ QMSszMoNT474q9RskvEtIVvZEmu1UCeWJDGjP3KoWcqP9kcVVsVdirsVdirsVdiqT+bIdRl0G8XT bwWV6YmFvM0iwqH24lpGjm40/wBXFWAfo/8ANDklu/mGMIREyyrqFsJSvJvXbidPIZY+YHb7PetA qqy2n5q3HKGLWowkacGuEvrMMZiNkYDTm39RONRTvt+ziqnLZ/mdJbpdQ65GqqAvrrqdqY2kmovA k6ZwrxCuvw9W+HrsqqDTPzJBiR/MASdXdWb9I2pDCVKgUOmUZl4BlHpjZvtDeiq+fTfzR9ONRra+ knGOeSS/tI2Vq1T4k037TMwj3rX5kEKqVjoX5pS6jbHUNfe3t0kAmMV9bNKFlQfah+oCN2UA8dxW laCpOKsmTy9qEkbxr521B2CBOQGnVUg8+Xw2wNSo/artX6FVz6BeJJHHJ501ESLxRUJ05SWaJ1Gw tlJJBLgGvStDTFVEeX9Rabgvnm+aSWGRY4yLAkNyBEihYVrx6GoPzHTFVQaNdqskR88X5kI4VP6M qrcVPQWvgtfkfpKq+XynrNwkqJ5y1T4qqxRdPBUHkQBwtl4n4hv122pirK8VQJaFSglkCGUlY1P2 nIFTQewxpUm13zdouiC0kvXla1vUeVLqCGSeNUTgOUnpB2VS0qqDTqcVSuX81vIcRAl1F0JoKNa3 YIqCQCDF8P2T1xVPND1/TdbtHu9PdmijkaCXmjRlZEoWWjAV6jcbYqhfP9xpVv5Mu31W2a6sQ8Hq wpcpZtUToUYTvJCEKOAw+MdMVeZ3N/8AlsVW+bTr0pfo4nSTXIQOM6u3Hj9dZaSqslNwKjtuQpQ8 Vz+U07GI2d/Irr/pM36etnEas/pszf7kPsUepNPDbFXDWPyzKQ3I0/UfqzW/1aRzrdvGGRXaSIFm vk5/Gsq/a232NRiqnpmuflhb+o8OjaiEgYSNI+tW4JIBqd75QY35HdSVc7HtirrqP8r7dk0yDS9S Fux4yWCa1ZlJPWWijh9ekHINyFFYHr1FRirI/Ln5w+WNN0UWljpbW+n2wK2Qk1GwYu7q8vBi9xyX 4xx79cUJ1dfnZoFt9XE1o6PPGzlWvdLXgyFlKNW7/mRl+YxVlnlrzBc61bNPNpN1pagI0RujAwlV wSGjaCSUEfOnXFU4xV2KuxV2KuxV2KpB55g0qfy3eRaoJls2jPqT28KzyxgEGqIUlqxOw+A4q8bg 0L8uBbx+udYiiX96gk0C0NQC/IVWxc/FTx8K+ylMLLy35Eur6W9juNXuL2NTezq+h2yPKwZmBUGx T4mc7eJ2r0GKoWHQPy7X1Il1HVmsnIuUt20KAKsiqKlTLYcOTInBQq7nxrihkekQflHaaa0FzpNx fIp+sCW60SYFA0an4PStY1VTUtQdyf8AJxVXj1T8mVCRJ5ZAW8oAF0aQlgHJHFViLMoaPqgI2Hti q06t+TEtzNcHyy5uA4eRxolwGDruTUQ/Cat8XSuKr5NU/JmWYtJ5c5CNzCrto8xUsXcfCnpV/vCw rx2Y+JxVUiufyfV57iPyw0aRrDO7jRrhEBjYqhVPRHF05b0UbHuMVWNe/k3zjt/8NMQC0gH6GuOK u8allYGHqUAFKYq43X5LXUM058uI8dUJYaPNyfaisqLDzIoetP44qnOheafy+0yKddF0u5sFdh68 Vto97HydSyAUjt6MwCnYb0r4GirMLC+gv7OK7gWRYZl5IJopIJKf5Ucqo6/SMVQV9p9jfwrDexet Grc0FSPipSuEEhSEu1vyvYarFZxGe5so7AFbb6nKYyKqFG9G3WmzdfvOAqlkv5d2kyMJda1h35Bk m+uNzjILFeBCjp6hpXpiqN0byjDpN4LqPU9RuCFdWgubkywkyEEuY6BeYpsRiqN81Wuq3PluaDSr pLK9eSER3ErIiisy1FZI515MNl+A1NBt1xVgEehfmwIzF+l7SYwS/Cq3tqAFUfYcfovfiB/k7Hpi qpb6F+Z1vclLjXYIAiJNNGLqzV6tydjJXTjX95Ucm6ip/wAnFLUuifmS8UsL6xDAzS+rbqL+0Jdm cbM500GnNvhUJT4iuwoMVd/hj8xpoJblNWgeWVfUtpvrtq6hDJTb/cWQqujmpUmtAOm2KFOKD81Z 7mUDV7U23OVFjS+s2ZT6RMSxMLEFeLGvxb7dP5lLcfl38z7hLuF9TtJY5oWRR9asjwf7QLBNLAbl QA1p8LfTihMtM0fzmmqRzeYteW1tlhJ5Ld2EziRiF+w2mWwHxmuzde57qvRNOgkt7G3gkuXvHjjV WupAgeQgfbIjVE39hiqIxV2KuxV2KuxV2Ksd/MCeOHylqDSRtJHwXlx9Db41pX6x+6FT3YUGKvBF uPIq6oZAtyP3MiyrTy8vpu6LCvErsEFQB2+5sUozTrjybBfRBIPWS4VEt0dvLSkXCn0iRwqPh+0u xqT2Baqqnbn8sZ7gamVuCGkCtZSL5dCHlHVZH2WMFzEaLUN1PQmqqN0rWvy008XWq3OkjUwwRYYL 1tAUj0yC7IYGRvURWX4Tv0774qntv50/KZ7GBR5QsgsVzIttbhtKesp9P4oyJuLsylOVD2pvtihQ Pnf8p7sqE8mWEz/HFCrSaQH5ABokAEzH42JG1ae+9FW4fOX5QemkcXk6zb1V+syQhtIooi5tyPK4 CllUE8a1oaGndVuXzh+U8QNs/kywjjZVDr62ihqOiemVC3NWDJK3xA+/7RoqrWvmn8mpLtTD5TtI 1njYxzAaUgMbxMZqoLjlxUBkJUEbHFVO381/k+1vK0flHTwIAHCtNou7tQUUm58BWvtirJ/IvnfR NSvpofLvlpbdp5I21Ke0n05kQSFz6s31aZ3NDy/ZqSffFXo+KsH81azq+nalH9UunSA25ka3XSrq +qUc8iJ4GRFJXbgTX7wCqxWXzr5rZlji1NxKZURmHl++VI1cj+8V5OS9ftcqcelTXiqqXHnPzWrK qai9ZZKR8fLepjirDkvINKzU7bAn9eKs0sLPznHdxNe6nYzWgFZYks5UkO29JPrBUfPgfliqh+Zt hNfeRLyCGNZnMkDcHQSAgToT8LQXfb/is069MVeL22j2SfWfrmmlpSq28Mtraq7MUKDnDTR445EZ Q6/CWqp32+LFKGeyil0yK5fT2a+hmR5kSxjSL01Wj8aaOsdUAqyUNKdWPwhVMP0Y8/qfWdOiPIM0 t99W9Ji7To68idDSXmSQoFN+op1xVCr5ftbe2fUbzT1T6usbJ6NkVThMfTV5OWjceacg1B18FOKo i20mOyee4v8ATm5QsIYrc6dxEsao0UiNImi/ArrIoKheW/UGmKoS28vmaI2y6e9sqRztG8lk0lTC jsofno3xCoUAB6/TQYqtv9OuR60M1ixuOaKIlsqq7oDIFIGixlXWKU/D/wAEKfDir238rLTWodDa a+MkdlOIzpdlK6s0EKqRx4C0sSnyKnpX5qGaYq7FXYq7FXYq7FUk85Xlna+XL2W+hllsvTPr+jcJ asASAB6zyQcKk/zYq8k0zzv+XlpqFhdR2WoLxfnFPPrkUkX7CuJFlvSGCGh4kb02qMUsl/5XZ5dg iBfSDCzuHto/remDmCob1A31niOq96naneihWtvzh8tS2s80+lGC2trf6yrNc6Y6sBJ6aoONyaEy EqK964qhYvzv8qBisWlAO0TysiXWm8uatxkVqT0FIqPyJ3FR2xVNdP8AzHtdUjupdF8tT6rHZHeS yl0+ZQ7cdjxn5cuNPsBulBWmKprJ5k1Y3qxHybqEiAms4awoBQvVeVwu/KnUjev0qtnXb0eg6+Tb 9jJUin1AMnKJWavK4WlfUKfMHFWpPMOoTQRSXPk3UH5MGeNjYOyOrEKaG43pxBqPEfQq3Dr2ovdr CfJl/Ggf0xOW07iEqRy2uelDWn+ZVbTXdQgjYxeTb9QzKzxRnTgxIL0YgXIUlfTU/aP2hTFUVpms 373EEB8s3lhFOf3k7tZcI6+oxLiKd26r+yD9rFU/xViPnHT/ADNd29qdAumt7iK4RpqTx26mIKwI 5PbXoapYbFKYqxqx0j82GtJkvb4rLJDLECl5bgK4jVUlUiwLAsys3XavTwVTuz8p+ZlW2e6816gZ EKyTQKlkycq1ZOf1VGZe24FetB0xVktrDJDbxxSTPcyIoDTyhA8hH7biNY0Ff8lQMVSf8xLb6z5F 1GL0vrFfSb0PTMwk4zo3H0xb3pPT/fJ/2P2gq8LtrW2W3Mc2iKltAiieZNPLygqOTMGfR+G8Z5cW puN6DFKyDQ7y5WNJNO4pEjLQ2ALPHMRGGVk0V+NCBx+Ev4UNBiq6w02aZJo20yIG5SWeRvqRWsQB cIT+hHPwtFUb/Ew74qjrW2lggZI7BLS1b1YL8i14b27LOzuG0Lip9PjxBG9B3rVVTfy6zyGNrFI5 7eaSGcmzjRAsRjhVw50OvE132ptWnXFVC60KSc7aagdZvTSlmygK0ULqWVtEYKSlKl361oAvVVmn kWx0l/MC6RqflS0n+sSu6X72MsfoqkXMBQdOtoeDPFy3kqHbauKHs0EENvDHBBGsUMShI40AVVVR QAAdAMVX4q7FXYq7FXYq7FUl82XjWmlSzjUYtMVFJa5nh9eNTUcSRUdD08Tirz6bziscLxW/n3yz CRz4iKzASrMWZv8AemTqKj3r44qrf4unWBZB558sO8QHqSG0qvByeIJW6+HkO3+ZVVbTz5F9XkW4 89eWnfhwhItjtIN91+trVR+ziqgPONt9Xlkg86eVY7pyG2teIO3pvWt1yJY8aew7jFUwTzl9QRbe 686+W4rtXBnjS1YH7JDDa9FSTxo3EfI4q7/F96kFvKfPfl301cxTTNByV3FRuVu0A2Uk9AfYYqug 85XnprFced/LYvHcII4oS25dlKhTeBm6gA0FCKGuKqlr54S31KKXUvO/l6TTnXn9XjhMMrqVDgoz XknGoOxIavhU7Kshh/MHyNNO8EWv2EksezqtxGaEsFAryp9ogYqpSfmX+X0cojfzFp6sQSCbiPj8 IBPxV49GHfFW0/Mr8vXcIPMenBm6crqJQd6dSwGKp9Z3tnfWsd1ZzJcW0orFPEwdGFaVVhUHFWMe bIBItixsbu89O6jYmzuRbNEpSVTISZYeaqGPJa9DXtirEI7RI44uPlzzAkzK6fVl1ZgQrh4iwU3i oX2VmPblWpNKqrhBD9RVovL/AJjKJEPiGqhW2kkADMb4chWQsOoI47EdFWRWPl3y/dpaXrXF7Fc2 5E8ls+pXDtFI7h2ilCzOlFkXiV+zsQMVTjzcgk8rzq9tYXqGSHnb6o/p2bATof3jcJOhHw/D1pir zt5PKEFrFP8AoLyfCTFP60Ju1Ei/uW6D6qrhaBlf4ff9ndSh4NU8mQrbjT9H8nm6ZR68CXm4ZCHQ pIlq3MqeRbaqgAk0piqIs08jvZQevpPk1WkC8uF4jxP8ZST0qwbfEV49dzT3xVDLeeVfqccb6R5J 9KYC4nb9IrwYlmT1Sj2ynjy26mnjihTtL7ylcRTXEmgeTBch5DMGv/RKhQCCQ9n8PVRXoa9hirUt 95RlnIvND8ls4bikn6RCj04gyRhqWrrUcAlC2/hToqn1n5t8v6ZdpL5ft/K8UsyywSmHUBCzQ2oR lRJFtuNQr1KNQDx8FWW+S/M99rb3y3kulu0AgeKPTLr60wjmTmGm2HHkN1pUHfc0rirJ8VdirsVd irsVdirF/PLavDbLdWmu22jWcUUi3Iu7ZbiN2ZkCMalSAo5Cg7kYqwKHX7ak0Mnn7y8YpO0enwpu HEsjfFI6tyi5LuD9rx3xSsl8yXovSkn5ieXWjkRmMpsom48eKrGAHpQbGrSVrtxNMUJlc6hqMX+j f4/0K3kdHKuLGASFhFxDCszJ8LduOw2NcUqOm+ZEhltzc+fPLr2TSR/WIFs4oxIvqCWZEl9ZVNed OXHrvQMDihmQ/MD8s55KHXdLZ6K9XnhH2iVBqx61H6j3GKtv+Yv5biRkbXNPLI1T+9Qivwmtem/q Df8AtxVVm8/fl7Gkfq69pnpycmib6zCVYoNypDEVGKrB57/LdEQjW9LSPkVU+vCqhmUEitaCqnfF V0XnH8upFnni1bTHBrJcSLLCamIBizGu5XiD92Ktv56/L0erz1vTQIpOEvKeEcZACwDVOx/dmnyx VTHn/wDLaOB7tNb0z04t3kjmiJU0NK8STU8DQdT2xVkNjNZzWVvNYsj2csaSWzxU9No2UFClNuJU 7Yqxjzf5a0zzJb2+n3lysJgk+sCMx2s7GqPGDwuo51H2juFrtscVSDT/AMt/JdlqMk+oXFrqUTlz HZXtvp/BXkdQXqsKSM3whalt+9cVT+Tyt5BS0e1k0zTRbMypJG0UIBaMKqqaj9kIoxVbF5F/L9ld YdD0wrKKP6dvDuAwegovTkAcVRnnaOxk8n3iX99HptoWh9W9mMqxx/6QlOTQS28g5Gi1Eg677VGK vJH0Hy79ZlkTz7pczxmSQBZ9QlKj0eMzVj1KoFR77d+2Kqsmk6DHFKp/MHTA8bH0w15qRdBxeicR qYNV+Ffs/PwKqNm0jy49ysN3530e3MbwysiT3dvLzCkPUnUQwZlJ3Jr49sUuii0K106awuPP2nRy cvUDR3F8aLMjFQed+zMvGZjsR41qK4qg9P03yy0sFx/j7TPTju0lIee+jDgE8gyS6h8XLgh5dPGu Kou403ytHpTq3nywWSe3UxyPe6hxcRzuCfT/AEieaFeScQPtVO+KF2j6J5bF7FZ6v52tbuGeYBLW 0vL2ORvVjcJSVruVl5rJH8P2eg3JxS9phhjhjWONeKKAAOpooAFSdzsMUL8VdirsVdirsVdirH/P t1ZW3lTUJb+Bp7FYq3AScWrABl4kSlk4nl3BriryW1178vZ55pIbO+Mnp1dZfMKEMjGK3ZnYXkij 4ZOVeVfh7UGKV9x5q8ixtPZvp2oyRq0cHqLr0bMHliLemeV6KU9P4aErUdjQYqusvNvlCQxajDp2 oXc0QYTxnXreTjHHNUGVTd0eMGVkQuNwAO4OKttq35XPptrbWdvfyc5A8EEeuRqyyFogUB+vHcK3 IcvA0O+KrYvN35epG5tbfUpIo6SJK2vpGf3saF42c3wYOu9FqVNDv1xVDHzd+Xcxhie01iYSCjud ZSJg7OwZpkS7jQFPhYt0r16HFUVL5j/LtomuY7O/nM/qmZF1+Npk4hWYlWvioUrDuynoKe2KovQm 8teaIbgaTo+v3EMUwhmuINbEnplzUOQb5gaDfofavXFCdRaSjWl1IvlTzGjTMAY21NeW4MZK8r2o AUfjttWiq268twBYWh8reZWliZStNYUAmEnju+oMQGqd6A06UxVNtE1bUbHS1t4vJWrycVZS089n M7fFWjSXFysrLWQ0qv0dcVZ1H/dr8Hp7D92aVXbpsSNvbFXjv5t67Y6brUP1i00+ZxYl1mube0uL oH1W48BPdWz8FK8qCMjrvXoqwm11jSrwi2On6BDFJ6ZSBbXTubyupTnw/SDIpVx0pWjUpXqpVY9f 8tSF0OleXi/rxxShbTT+Tg+oXePhqNOJCLXsK7EmmKvRfIN55J13UDd6T5ZtrSWzTkdQT6hMY3B4 olbeSWRXZakMR0HXFDJ/P9nql55LvbfS4pZb1/T9KO3ZlkNJVJoVnsz0G/7z6D0xV5g3lDzxItvJ Dp+o/WFHqXD3Tu1TGBRUVtVZdzUhWqDty6YpVY/Kv5hy3EMM9leQxUSGSTncSoB6/wALcv016uwY MSOi7dsVZHD+UevxPC0XmH0fq7hoyh1JmHEKAKtf8aVXccehxQpy/lB5hlEEcuvK8ENCtG1RXDIo 4kM2oSAEOo34/wABiqvB+UusxyRyHXFVozGFMf6UU8IyzUJOpNyPJ/h5Vp7jbFUrt/yS8yxXnL/E Ea2zosdyIzqIeVK/Grcr1qVAHf6PFVFv+UHmRrx7s65Csry+oDH+k4goK8WVQmoKePwgqAwp06bY qzLyL5Z1Py/pktrqV+dRuHkUrOZLmT4FjVQKXM1xxPIN9kgUp4YqyTFXYq7FXYq7FXYqgNctNUu9 Olh0y6jtLthRJZoRPH1H2kJWo+nFWOfoH8xiAx1jSDKGUhzpjnioBBC/6QP8nFVa10b8wUiczavp hmloW46e9FIaMbETryHBX6ioLdTTFVA6B+ZCFfS1vSeMalYydMcEBiCy7XHQkAmnUjFVIeV/zBVX kTWNJS6YpwcaXsq8fjQH1uRHPdfx9lUdcaL549KBbTU9JiZYkE/LTZGDTCvKRaXIoKUoMVU7nRPz BMcpt9W0fnubdW0yUBTUU3+tPTavY9e+Kq0Oj+d1jmV9T0tnZi0DHTpCF5MS1Qt0laggfRvU74q7 9E+fkiKQaxpsJIQ8l06QfGAnNj/pNKMQ21K0puOuKqa6Z+ZqOlNe0yRGp63qafLVPHhxuVqPZt/f FVaPTvzE40k1zTd0deS6dKCHKkI293T4TQ0pviqvpmn+dItTEupaxa3WnUJNtDZmGTlx4j94ZpPh 5fF9mvvTFU/xVgHm+6jg1qFZL3WLRJoEVjp9ml3bmkxABLQXJWQl6HahXt4Kse0y9tEK6euteYo5 Bwt45P0SqRgyyOUoDZuo4g7k7U+zTspZdpXk25sb761Nrt5fI1TPbTxWQSVivGrmO3RyadwwPvTF DI0REBCKEFakAUFfE++KpB+ZE1tF5JuWuXEUBmtlkkLmOga5jFeYuLEjr/v5fpxV4q+sXxls4I9S LPPAgZBqbMFkkLM9SNaTlUMCP8k+26lfe63LPbG1ur43EMDSBrX9IfGAyu0bNTWnB9KTd6noQNuy qy81udbddTGtkzRtDZGH66QVjZGHL93rRFHWJSTyFe9RyOKqjeYb2O1SP9JyM4T04pIb5m4cpXRl lC6739ZCklSu4HicVQ8Opaza3yxTay80Ra3S2A1Cg9RI1cK6jWgq13BJ5/5I3AxVXXzVqFxozQxa wVnic3BC37PIyQhH+0dbZkPxPWh6DscVQ0PmE3kkpa/kTULlFC241AujTMYklRZf0wrlZOvF9qgA fZpir3vyJo+p6Xo7JfyuzXEgnjgm5tNArIq+lJI891zK8eofFDI8VdirsVdirsVee/mH5r1/SNah ttPuvQhe2WRk9ON6sZHUmrqx6KM0Pamty4sgEDQ4e4d5d32bpMeTGTIWb8/JItH81a9q2qxQ6jci 4hjiuJBGY4l3WB2Bqqjf4cHZevzZM3DI2K7gy7R0WLHi4oij7yjtY1fzDpEC3Gm3sUMDqhmhRfUP Jq0Y+rHQbUHwnM/tSeaEOOEqA57BwuzoYpz4JiyeTY1nz8QCNcsSCgf+8sx17UK1qM1X5nVf6pH5 wdj4Gm/mS+Ulp13z36ZkGuWLKIxJQSWnLpUrxKV5Dpg/Namr8SPLviv5fTXXBL/ZLv0157qF/T1h zLcePO12PHl14UpTvXrth/M6n/VIfOP6l8DTf6nL/ZfrU28wefFV2OtWZCBjUPaGoQVPGi7+3jkT q9V/Pj/sUjTab+ZL/ZKx1fz8JJIzrtgPTrQmS0AYU5ArVK0I9sn+Y1VkeJDbzix8HTUDwS+UlkWu +eZGjH6fsEEjMhZntaIUBJ5UQ7fD1FRkY6nUmv3kP9j+pJ0+nF/u5f7L9avHqH5gsFZ9dsIY3Yqk jyWpViCAacUbpXLBm1XXJAfGP6mBx6bpCR/0361FNZ8+uFK67YcWVGBMlmPtrWlCoNR0OQGp1R/y kPnBmcGm/mS+Umv03589L1DrljUmgT1LMtuadlp95wfmdVV+JD5wX8vprrgl8pJXdefPOltcSQPq SO0ZKlo47d0NO6sqUIzHn2lqImuL7I/qciHZ+CQvh+/9bIPIHm3zBq2uta6hdetAIHcJ6cafEGUA 1RVPfM7szXZcuXhmbFdwcLtHR4seO4ijfmmfnfzPcaDZQy28+mwyyyCPlqlw1vHQxSvsURzWsYp4 7jbOgdGxuX81pgiGG48uu7DcfpdqBuVOIK2zAkhlp/sv5TiqaeX/AMztDvILuXU9R0u2MEn7r6pe fWU9AqCJHZkiZd6j4lH44qy+zvLW9tIbu0lWe1uEEkEyGqsjCoYHwIxVB+bZdLi8rXL6pHdy2IaL 1UsDKtySZk4emYWST7dPsnpirDYbL8tZZpiq69G9xIrSHlrUQDSgAdCoX+86ex7KcVQsOoflZPYF SdfCzLykdzrKuxgUR8XkDcfhrxoW41PvupV5l/LQRTuw18RSKbmVUGtEL6zoxNVB4nkB3238cULR N+WCu0YbzCi2hEL+mNcRK8kA5ekF3Pwip3bbqaYqyh/zE8olijRXjHmY/i0+63ZEL/tRCvw1oe/a uKqbfmB5KiiMj2t3Eqq1S+mXaAAihqzQhV5Vp8RFcVVV8++V1thNBY6hKvD1Vjh0q9ZvhLquwh+E /AaE0HviqfaLrVprFmbu1juI4g5jK3VvPavUAHZJ0jYrv9oCnbqDiqPxV2KuxV2KuxV5P+bP/KR2 3/MGn/J2TOX7b/vh/V/SXpOx/wC6P9b9AYlp1/NY3QuYgC4V0o3QrIhRv+FY5r9LqThnxjdztTpx lhwlOdb8y2WoacttDaNDIFjDyFuXIoNz9ObfW9q48uIwAlZru7/e6zSdmzxZRMkUP1e5GL5qtvSQ SXkjyqFWrafaNsqkUqzEn55hjWCtzv8A1IuSdIb2H+zksj13ShC8ZvZArxlG/wBx1pyHIBaBuVei juK9euAaiFVxdP5kf1qdPO74ev8APkqf4ptfXZvrrmMilTp9qKEElaLyYd9/H2w/nBf1f7CKPyhr 6f8AZyc3mXTmVla6r6hdWpplqOKMTUj4+/L+vunVQ7/+lcf1qNLLu/2cv1NHzJYCXml9KrOwMjjT bRTRBVaUffcAHH81G74j/pI/rX8rKq4R/p5fqcvmLS2lDyXkgHqcqDTrQmikcaNzFKiNagCmI1ML 3l1/mR/X5BTpp1sOn8+X6nN5k05o3U3khMoAkI02zWuwWuz+Hv8ATidVAjnz/oQ/Wo0sr5cv6cv1 KGratompQkT3UvqBy6mOxghLGh+0yykmuQzZseQbk3/UiP0s8OHJjOwH+mJ/Ql6W/lYsQ17eKKji 5t4+m3UCXtlAjh/nS/0o/wCKbjLN/Nj8z+pLJxAJnEDM8IY+m7qFYr2JUFqH6cx5Ve3JyI3W/Nlv 5V/8pM//ADDSf8STNr2N/ff5pdb2v/c/FnmvaLcapFEkOp3GmtE/MPbLA1fgdOLCaOUEHnXp2zqn mUqHkvUkhhij8zahGIYzGKR2J3KBOZrbE1+H+lMVWxeStVWMCTzRqLsVRZP3VhxYqAGNGtmIDU3+ KvviqK0XytqGmXETt5gvry0i2WxmS0WIqEKKP3METALyrsw6Yq1+ZNubnyNeQCD6y0kluFiERnJP 1hD/AHYtr+vT/fLYq8Wl8sajcJHKLGWgictC1gQrGM+qV4foXjT94SrMu7VXqcUuby1qMAZ4dKdY y7QOYNOLyAKhL1posIKOApVie9d/iGKqx8q6peSXzmx4TXqmTaw2LIesjNo0fINKgLKi71r8I+0q hpPK+sRPPaPpXposRt5ZF0uRwxQiSoePQ6PR4u+xFKN1bFCN/QcwRJP8OqZBFxJ+pGjCiuxZJNDV eSpxZVA6jYHdcUoeHRLwRyGfSZE5rUyRaW4Mg5g8JK6DTixHLkVbwp4Ksw8m+VvOLW4vNC/3B2he VGjSUWzyKlWRXiudJLUEtfiKn7TUHYqvQvJNt5ytbS4g8zypcTIy/V7hJkm5rQhq8be049B1Br7Y oZJirsVdirsVdiqFdlc1eNGI2qVrtgMQeaRIhTke3jUu8cSqOpKjIT4IizQDIGRQq6pprPx4IPBi lBmHHW4Ca/QzMJofX/Mvl3y/ZR3usyw2drLKsCSuhKmRwSo+EN2U75m8Ee4NfEe9JpvzY/LWIDnq 9mSSw4qrOw4faJVVJA9zh4I9y8R72TWV5Y31nBe2iwzWtzGs0Eqr8LI4DKw9qHHgj3LxHvVv3X++ Y/8AgRjwR7l4j3u/df75j/4EY8Ee5eI97v3X++Y/+BGPBHuXiPe791/vmP8A4EY8Ee5eI97qxf75 j/4EY8Ee5eI97VYv98x/8CMeCPcvEe91Y/8AfMf/AAIx4I9y8R71ySKhqkaKelQtDiIgcggyJSHz B5vsdFuobR4Jrm6mie4EUC8isURAZzUjuwAGYms1gw1tduVp9JLKCbAA2+Kiv5heUfRglkvhELiK GaNHSSvG5V3i5UUipETd+2ZcJ8QB72jLiMJGJ5hx/MPyYIvVOpx+mU9UNxk3Q2xu+X2f98Dn+HXb JNdJppOvaPrCSvpl0l0kJRZSldjJGsqDenVJAfw6g4qg/Pt3qFp5MvZ9Pkmiu0MXpy2/P1F/fJy4 +nBeHpUH90dvDriryW480/mP9VQtqepK5QBmW3uKBmfmDyXSEoyDgrLvyqendSj282edkjJm1XUm mmct6cML/u0dJJIeP+4bk1RxV9hxPUdsVS6y82fmBFCYjqmqMxV5Iw0c7MY/UABq+iu5oo+2D26C tMUIpvOvnWa/WFNWu47i5RAiMssKo3JnP7ttHkA+NXjBZqsoFRilZH5888ssSSX9wsdmJTNK6Xau yulUMjLpBQMoJYckpSm1dyq6Hzh55iLJPq1/Hb8SFmKyOyhD8XXRPjYKjN+ztuTSuKr284ef5Yol +v6lHOoVXX05V+NnWJBQ6EKli42DHFD2TypqU2peXrG6uFlW7MSpdieJ4H9dBxl+B0i25g0IUA9s VTbFXYq7FXYq7FUGeuKpH5qnkitUo/ox9Xm2+BagM+9R8Cktvtmu1kRLJjhL6ST8fL8d7djNRJHN 5jZ39oE0lofMDOGnuxb3T2vpveiD1BEplZafH8Na7sfBszp4zIzhKAGMAVvy/H2NEZUARLdlvnvU dStPKdpPZtKsiXqKWhBJ9IJITyH1a+qu1N4qDx8cTs6ROIW3Zh6nndx5v8zIbqQ31x6s1BBClvIY 1jiXnJOJP0W3IsY25UA+Hr0oM5rTN/N/m+bTBLpuqT1e4MZl4OsMTRqG9MM2j+mEq9FBapAG+5UK oa388ebI5LmCLULy7YwziKaUTRFESNpfVKNpPGoAHjXalKnFVW58yeeYbVL2PV7qUyBEgYhylZRH DIkp/RaRo6SMDGTQ7/F3GKqM3mbz4qLJLqGoxTwPKrDhMRWKOq+pGNGA482A3FD36VxVz+ZPPsup raPqd8JRIryen6qhEkqQCP0OKfC+4b7NN+PHZVG6d5w88rCZpLi8uDIEkgguI5IyW3LRHhpK0Hxb HlvRQPtUCqYWmm/mhqluHs9WuGt0Mlq5uJvqModWVmkDNp5L0PJOYWlOm9cUMy8sL55t7h7XWkhu bIM7JqLXCtcmpHBTDFa28dOtOlMVZNtiqW695Z0bXoFh1OAyogZV4SSRNxcguhaNkPF+A5L0OV5M UZ82/BqZ4jcSjINNsILaK1ht40t4FVIYgo4qsY4oAP8AJHTJgUKDVKRkSTzKp9Wt+PH0k4+HEU6c f1GmFi3HDDECI0VAdjxAHTttiqhr+gW/mDQJ9IuZDFBc8ebLHDL9hw4+C4SaM7qOq/jirCV/IXy2 tibMXsnEyepzNnphanJXK8vqnKhKjv7dKgqsg078q/I9rHEbjSrW/u41dGu57e3VnWRmJ5RwxxQ9 GpsnT6cVRSflx5AQ1Ty7pyEqUJW2iU8WUqw2XuGIOKtxfl15Dhr6WgWCVQxnjbxiqHcqdtxXenji rTflx5AKGP8Aw5pwjZldkW1iVSyAqpICgbBjirn/AC3/AC/csX8u6c5Y8mZraImtKdStcVVoPInk u3vI72DQ7GK7hcSQzpbxhkcNz5IQPhPLeoxVPcVdirsVdirsVdiqEOKqF1ax3MXB+26sOoOUajTx yxosoTMTaTxeU7RHiBb9zbmsEY5cUNCv7tCSiHiSBQdMxTpMshwyyXH3bn8fFs44jcDdMb/RtK1C y+pX1rHc2m/7mVQy7qVPX2Y75nwgIgAcg1E2lUX5e+RoWjaPQbINEjRRn0EJVH5cgKjvzb78khVP kfyaY5YzoliYp+PrJ6EfFuFONRTtQYqpH8vfIvFlOgWFHNX/ANHiqT4k0rXfFVyeQfJEds9smhWC wyCjqLeMVBKkgmlaEovzoPDFVMfl15DUMq+X7ABuQI+rx/tU5U22rTtirUP5c+RIXkaLQrJPVULI ohXgQAy1CfZB4yMKgVIOKqkXkDyRE8TxaFYo1u4lhKwRjhIOPxCg+18C1OKp9irsVdiqM9CPwxV3 oR+GKu9CPwxV3oR+GKrlUKKDpireKuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KoMnfFXVxV2KtYq7FX Yq7FXYq1TFXYq6mKupirqHFXUOKo7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqh/9 H98Vd/o/virv9H98Vd/o/virv9H98Vd/o/virv8AR/fFXf6P74q7/R/fFXf6P74q7/R/fFXf6P74 q7/R/fFXf6P74q//2Q== uuid:f8220e20-aa71-614a-ae59-11821edfa059 xmp.did:4bdfefe8-4bd3-4fcf-a30e-b423c7a74edd uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:404301c0-c62c-f843-a192-4086c74f9cc4 xmp.did:320e32e4-0b83-42aa-bc57-ffac8fc0138a uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:ab17be08-b65f-453f-ae7f-4fe23b51a1d3 2019-02-13T16:27:05-03:00 Adobe Illustrator CC 23.0 (Macintosh) / saved xmp.iid:4bdfefe8-4bd3-4fcf-a30e-b423c7a74edd 2019-05-29T15:21:47-03:00 Adobe Illustrator CC 23.0 (Macintosh) / Print False True 1 215.900000 279.400000 Millimeters Chivo-Bold Chivo Bold Open Type Version 1.007 False Chivo-Bold.ttf Chivo-Light Chivo Light Open Type Version 1.007 False Chivo-Light.ttf Chivo-Regular Chivo Regular Open Type Version 1.007 False Chivo-Regular.ttf Chivo-Italic Chivo Italic Open Type Version 1.007 False Chivo-Italic.ttf Cyan Magenta Yellow Black Grupo de muestras por defecto 0 Blanco CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Negro CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 Rojo CMYK CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 Amarillo CMYK CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 Verde CMYK CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 Cian CMYK CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 Azul CMYK CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 Magenta CMYK CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 P Charcoal CMYK PROCESS 100.000000 CMYK 65.792322 56.157774 58.059049 62.648964 P Citron CMYK PROCESS 100.000000 CMYK 13.846035 14.843976 94.692910 0.973526 P Cardinal CMYK PROCESS 100.000000 CMYK 24.188600 100.000000 95.858699 21.084915 P Charcoal CMYK 2 PROCESS 100.000000 CMYK 65.493244 58.352023 54.680699 61.406881 P Citron CMYK 3 PROCESS 100.000000 CMYK 8.401617 19.711603 95.400929 0.433356 P Cardinal CMYK 2 PROCESS 100.000000 CMYK 17.169450 99.975580 98.559546 7.455558 PANTONE 151 C 2 PROCESS 100.000000 CMYK 3.836118 58.623636 99.395740 0.250248 Grises 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brillantes 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 endstream endobj 3 0 obj <> endobj 5 0 obj <>/Font<>/ProcSet[/PDF/Text]/Shading<>/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 7 0 obj <>/Font<>/ProcSet[/PDF/Text]/XObject<>>>/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 20 0 obj <>stream HWn}W|/dM $kA`aicmIYS&9qb=-]]]uԩO&W7n/>]+S TǻI躝yhb6ZH]傏;2~ 4u1wx1lEE?iqOYK輼/Gw+(Q'Le.h]5 0P]}x][շuUشUmZ}ִf7VWxqp 7h?uP%,奁#~o-an Ӟs;`'#wwA#qis#tfDbi#@ 81& x'LAX,'dRrdAI;P/w %#(Nr캨WQb*X:FtƗtN#;]c)J-%^^cPg\|( EK) l.Ice+:xZ%fGlK%>(Wu4zȌSp$-m#cVrcZfv|w0g"5ať;$k88UOz}"]~u跫6ð}iD?3vvPgؐbAjwL!G1B1Vuh=\Ҵyz{r*m#!·$UaU+_$;;0Yݯ~}`w `P#ꛆF^*cɆm;'~,!ݠK썭goe1}ӆO=Ra<Uox/|V:'XkK #HdH<+;MQDAutg3imJKU{eF67لcYPxri;:vpꭊaϹRt$FPeCp-麁~}/E z@}ې-K>I:` U)累V:&dK/x:JkQGLL1YEmVʩLq9]ޤ FT4,O'e> \H\h5D6ڡa2y;fw2}pŔ;<(W9ERѕh ߟ/foFO?;r҄b|̧5as]ԏPB2g+P(D_V2ӅⳘ46R@RW"&6f66Sn3y25$&$K݊) r>oIJ'IRR;cۍ&C3`7~s Iܞ: b[((D1l̈́`N'~>nnCfwn*N=xBI$OSZJ)}}e(]jQZF w_`q {8.ȍ?vCZAQS+(Z>O(/uJ.a anf㴶ݦTeT&{tb#ۓ׳{H6f-]&{ʯ=qz| KUڵ^g=oD*^ڠKu!ҪkSRXa Akuҗ{W&zBhDfJG G-ǫ'ްEBդTۣtuI)n3i/{*J?6JwFwsPbM*|Kj?#E؈gG秮Ƣ;(H̚%2uNq0{≗P 渤!l*'pvJCM~>vPe:Ȇt/RvMFK+Mx|&;GxscCvDeFVF`j+\)UCu߄%CnEڴHV0ѭٱ1y_e[ȚHW*|nMFh׷?)v;=3$vf́4 S|҉`ݽLfW#dQP۞,.=kebWo5]q?~w-17fu^>f[#f0 k vL'>rx+oNթ)ߟ~>mJ__L~:2w hNS(e2~wwRB'm]^ޅq ߪ?}dgUot7 M.g?Ggݣìvuipw6h: 9pj"KR$;,X7~#>/:Cr{uv,;G#ld_v<↧ן#D٧u&sM~ϣVWIF_kX#$&VKw@?l!`J*we8>ar yE;i`iaq<n_o⳺$Hԉ ZVT2 7HQ 8[ҞظTQGw3lF-NgTnҪzٓxv6X*[ il>Gz(AE*~v\EM Q>Rv!'-. l&5;)~7x!%-<, 2Q\# ̀e{JJXt4O +([f%Ah=C, )Ab0b!SZMy%~#{I!]f:*YziWEY%rT ^w<"H.ͷ&kw{ڈ5b6K/cEpdAv}bkIEZ`AnKί]0 Y3ǧE۩ؾt 7V k?TQSBj1t= M3/BI5Ewp;Xz H-:LV]Jp2|#.UBAMc3 btx2֨b U@ХkL̯}xC},oE7OjVqJ+&7"%>IM UوbiT6*9:x O ^4"t*ddLoSDE9)++čX]0*3_nm8Vg/>E"B{,,CX󋅅zB޻1"r% 6Fr* ]A4FC$;͊>4(4$&~{6XOE)/lY&@]/&\͘1 tgi8_j@u,SnwڱAWI Wf!(P&s83*S{SوK ex1C2I^kߏqdZY(dyn%kMKf޿nIzoTcֈ['@![OD!L&Uцa1{7@AeTZ[5j~0#rrxIF*+eZqg!8vNU+Oď!V` 4ad4V Jމe dM"*,SVi;[ 'S"Ύ c_w22IU! Wͅ ]U5hn49\? ?p;VJ4M,ńȍg79xyҼ_rs<a<4Y'|qxv|3$?'HaI}InƳ?nO-lq1(U)q2w/}tO,qOXdUܻ}׆n2}wZ1+kaߵp=g0iy?7/L9ΧoÏxIY-y3P?Kh:~ B0J]c:~]Q걡Mhuv77gw{.+횅zAYIoj[|]e寓5 oYfgN>'}'pܯ4?'&snFihݎ W-Bz/>&dY>ËS/#u*7cM:WUv"'ۦRQt7E$$r5vZv i݆o'&ABE%Zwur-vi8/l)nNlNhΊ(@jlyjX˵w-'+E8bo /`DyIB41}-W^q5C :QcvBoUo?t` SA#gP9,GeÀ\"o#EHY-x]ETM1W]jDnvm+]%)Hpuy> ]_Kg3'D!/з/<60Ř00=b=vnrQ @/(CbDWDQF{3p~Vxw9l!#ٿY#7YD!9ZåCzKǣV)|j|> NTSv.ų@Xȭ^ p53z9e'e#fxq3G6;WG&;4IL 'C[ߙYCȬj ld"/zLWq lt||ˏ6NDp|P" fsHr>X5܏[o 򐫵`GKge7 n s,Sh:L&#FRYm2+ȈnN(^=H.y̴8I u|~L;'o}>L|xߓ\t6iǺ3ȭ\_b`J$Q.򡦬nV5?>6CՀWGMJfpAGײKYx~𐐎`J|85n' `:-Fb48kuV}X[-Mu#[lXaa8][/A\þ%ԩju-QB9;[Q4Np+k&Ft^5] P^jyȝB8u'3s̼3錄 .sU7$`rC9>]J&MNcmXʮl if&N[eZiH'_+*<+'JĨ<\91p|GOWIޅUݍ]?$cȖ( 0EhIT1eJ^ Ӆ"#8'zɁ'ApEK-`;"Y1w]FH4`VN)u'kM3']XK>M S͢h;H/W)Ht.7OɜimӔKA]Xp{2gh9&"aQSdB!X*^!)iaE.2atFil,Aي*c+_vP!i\:r uQa Yg*:1r 2XyV.Dll|VqXw^hӧXO@⩩l0Se/#bh.u2k5l{otfKTL8OiRKU[ 2s2qju€~]R{ 1BǾl/1>Gb|_6J*; :(| .f}pv9 c?ΰO"Gfi+n,\Z3s/_na9̅nߚ%y@־"K؂o, yba~W9c t.硧%~3ؒ==w~*ݭ TX)B'I"٘I˰F;7M;3v1 jdג,B f`㬫ДH0$]da 7t}8:E4Ĵ{w/a Wo嚀QE|= 1gTbjtbdC|+=SBab'$X`=u*1D r{blڔ,,6sڱI0=103 :frf~ATPĺ[D&rO.}WQ`%eTTUNBF s\;5MS-|K\13ZѼрȢлj%hYɪG(T)Xku5V_/&Ķ"L*[hn/m1tch(R5@"t8g쯕exW_68Cla5{F% wWr!6yˑ]k={DmA1y@EH:+uE+] çr&&=SCb(E!11 pJx#E(I*"Sq 'ȇ RU^5ȢCw"")A f.zCiq.I>yqhfpM%f 7 ݎ_jYɦw99vYEnn>'{5tx<{2N Qf B|B Sh5}|2xeBnMk3Յ>\HvS_se<\u{n kǞkC/C/dUS!b3$T$[dX#"擁PJdRX;e2`{Ec HkH*P_5 QC8 `_z?e@9VQQ,en l¡-+E"K!c[w̭;),EN0N)C˱serrxFX+O[%0llchg'MN(g{cW'skN<zWm$u}>l#Qm04=.0 ?As8. M47X|nK6GR`s0tN5Q.8,"VT} "ȣI44J;;8NNf="92mSwSk 6‘EawslB'XPF8¼Bh V(42w2X7 wv-Aѳ}"ƨ@id,lѵ j|hbA*^"[`}fb9vxάx)3xPM̛!__РGhitϩi=,y#J8UZ' YZ@ :㠞ooD9\ allW`-1+s闾[4ƢPnk';gkFWJ-4FJ#KC $6}NyA^qP" 9xj[F dLPCE/(MC#1RM*RY[1u3y}V5-\i{?jb)_|{ʔ] NeG[i}p}x\ϲz/G_1ƦYwܸ7 GrYc@]@plNeԧFLN:rk%Yw*r(p@ a-R|_j39:lnN3):@ lTfAQsGU?Z/IݓҴdki xTI)e$ca"OG;K;_1CMqzht -EXZ%W#Bc8}I?'Cz],zAʕ|}֤ϒ;.Qxq9&Z}A&8L>M|a51bo=;X,-sP 9+с8<A2t{s̽38OxT×_tb4lxxkʜYXy' eyskIV(o(JNr[+!L''(H )Qd"Ybar q->#}ps+I>*\v߮%gpH(+q4Q~CؘR%fʌ S MK5/B qRMm1dxX>o5Ь[S!BfyHVNEmήzM XB)9 NcRKBy.w ɮ(Vk'^םY+?:Lq)%y҆"1+*?g)d`_7B~a/ yWpsV:$ /[x孲7 Yz5@.nxm)|#?qƙ(OSX dw B c0D!0) =v[F? Ɋv4Cu!ZuFvZPD[TyŃdۭܹ?3Ɏ=4f Ƿ^gGc= G=y[" fh?U&%O]Xa0_:)'I ԔD$ˎi$xYmO+n/z)@xNP׳gAcv͍ucC9\Rm< Qq `D0T~0J/O1dc ӍDWع9^[DZv 41Ryk:(O"g+;{q7zFkya`v`*>f+Z$[h(N)WNq00&ChK"FUӧi)f<\4-aXu&Ȩ;%ʨbd@aU0 E]>8ijT2`tp zX-5 8s\NsU[Ҥ C{ WWޯ_5@'±ﲦWEVthKbB5dt J7RkQ ARBc+49ӕbEbTNHQg@+pbGfTꪰriyR堵Ɵ")@8VәW>UiPP׈Lк}OBļUڕ\ϩVћq,t(O}JZW>)q +^#%Moùz߬G *3# pu0Rȏm_tCm8ϸ?p h+U8s ڻSON?~'?3~O/>aC~O|k.aY0ȗ9&}.ѪlSZLDuZAo:ːCkgKsABP\ChlZXM8E/Ga$o&B*Co&e;³xxFސ o!Iǣ2VQ EIn;փpA/JVղ`?6/ýsZn2-4nJ6IA1q͢]-Jō;+lI,R")Ap\Hu x|^36:XУ3Tߔ.F=r'Kk"tHɧꁬ)fAs`D萖+p3MAN^QaKfʪ! p*9HVd";\ -( QKcNȾr*aZk7H|hǣ.)Sɧbm6 rut, cULqV G"3) ͞-K|2ךo3 /l8:0Y_ʌ ]UwV`>//i %8|U: azyguQ#? <C"~H!?H#O{[.%֋KZ/.iK$.|'d'|hLǦ1A/i7*uT:u*ڤ'1o 6DD?4+i%+mTʎH]g i[r| 5--i>qER{> 乴;ĘKD49. ~^u11F4FP~qmSRCOlܙk i~/2@c@C<-5y{ݔKWt1X"@S(N_bمs̵%{sL@EZOx;0cU7(`Ѧ_Am$A╰|yy : R e 6-2bQ G)Wk`Y"w&Ӓ~Be"<*m?S8ȯha!=T!MTGb^n6ޮc*#R +JscہRR8#[>u;k/|#Oj1M5'-Τ|>bkr\Uۗw3 u~/\jHV6.BfB_U8d#)Y;#H5CzΧDjN0f&4JիKߡf1nvAd89VHw`$z {dW/a֪jYc; =șn?zz$tDv+vXKB}5,etY"u`cAK\ el5m!ׄÖaF7ivk3y"5pi +ѐNt%NbCj59ɇ@U@>G*}k*bx:Sף/ģ@l Rf6,NZESCߝT]8<5aׄ alxL:^iu<&o,\ +Y9hJF,Q,du,<`B\T RhrL6{v=} ꂫZLtV+ݻ '+ꢾxX@Q M $O|L P"vF㿾ahE;(U08ZDOZk_%q$1WrfU"/ݼfg q3n*{h^,[q.K|l8t)\lg$}BN#DN-M8VLmMF"=?hyn Y옙B#z׎X3F:u,w<ă~{#E~ uSx_Vb}.no:`̿RjÚ'ed7}H%$гm EojDabzS 57:.ӁBÇF1l=7wH2y)OUEG/De40s m%4Lw< &a5+4Ɓ wrsmHiFvttH88;aM;Ѯ*DC:Ŋ6mbR16` b]dww=ZLHmWwbi?VC90VWgP}[ZyC.z|_]#3Z/HcI.l`! w$Ĕ2SUL0q^1e!(r&MFo> ld,WVeVrtmڑhOGX;G"u#%(7]ps{ d9 d~6d @9d=z?gZt= G&ճ)`> endobj 26 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs 629.656 644.182 -647.312 151.908 re f endstream endobj 27 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 323.4297 297.1914 cm 0 0 m -2.039 1.988 l 419.253 427.315 l 421.279 425.298 l h f Q q 1 0 0 1 314.2744 306.3496 cm 0 0 m -2.023 1.956 l 419.253 427.27 l 421.264 425.266 l h f Q q 1 0 0 1 305.0879 315.4463 cm 0 0 m -1.979 2.018 l 419.3 427.284 l 421.324 425.312 l h f Q q 1 0 0 1 295.917 324.5723 cm 0 0 m -1.993 2.003 l 419.284 427.316 l 421.311 425.298 l h f Q q 1 0 0 1 286.793 333.7285 cm 0 0 m -2.024 1.957 l 419.269 427.302 l 421.277 425.283 l h f Q q 1 0 0 1 277.5913 342.8408 cm 0 0 m -1.994 2.003 l 419.315 427.331 l 421.309 425.312 l h f Q q 1 0 0 1 268.4512 351.9521 cm 0 0 m -2.009 2.002 l 419.284 427.332 l 421.294 425.314 l h f Q q 1 0 0 1 259.2808 361.0947 cm 0 0 m -1.994 1.986 l 419.284 427.316 l 421.308 425.312 l h f Q q 1 0 0 1 250.125 370.2207 cm 0 0 m -2.009 2.003 l 419.284 427.332 l 421.294 425.314 l h f Q q 1 0 0 1 240.9849 379.3477 cm 0 0 m -2.009 1.986 l 419.253 427.316 l 421.279 425.298 l h f Q q 1 0 0 1 231.8145 388.4746 cm 0 0 m -1.994 1.987 l 419.284 427.315 l 421.292 425.328 l h f Q q 1 0 0 1 222.6587 397.6167 cm 0 0 m -2.009 1.986 l 419.269 427.316 l 421.279 425.298 l h f Q q 1 0 0 1 213.5337 406.7729 cm 0 0 m -2.024 1.973 l 419.239 427.286 l 421.262 425.268 l h f Q q 1 0 0 1 204.3481 415.8696 cm 0 0 m -1.979 2.018 l 419.285 427.3 l 421.277 425.314 l h f Q q 1 0 0 1 195.1772 424.9961 cm 0 0 m -1.994 2.002 l 419.269 427.316 l 421.292 425.298 l h f Q q 1 0 0 1 186.0522 434.1543 cm 0 0 m -2.024 1.971 l 419.254 427.285 l 421.262 425.282 l h f Q q 1 0 0 1 176.8662 443.2651 cm 0 0 m -1.979 2.018 l 419.269 427.332 l 421.293 425.314 l h f Q q 1 0 0 1 167.7109 452.376 cm 0 0 m -2.009 2.004 l 419.269 427.347 l 421.277 425.33 l h f Q q 1 0 0 1 158.5859 461.5342 cm 0 0 m -2.024 1.972 l 419.254 427.316 l 421.278 425.328 l h f Q q 1 0 0 1 149.3999 470.645 cm 0 0 m -1.979 2.018 l 419.269 427.347 l 421.278 425.329 l h f Q q 1 0 0 1 140.2446 479.7715 cm 0 0 m -2.009 1.988 l 419.253 427.332 l 421.278 425.314 l h f Q q 1 0 0 1 131.1045 488.9141 cm 0 0 m -2.024 1.988 l 419.254 427.316 l 421.232 425.329 l h f Q q 1 0 0 1 121.9185 498.0405 cm 0 0 m -1.963 2.018 l 419.269 427.332 l 421.278 425.313 l h f Q q 1 0 0 1 112.7632 507.1528 cm 0 0 m -1.994 2.018 l 419.269 427.33 l 421.293 425.312 l h f Q q 1 0 0 1 103.5923 516.3091 cm 0 0 m -1.963 2.034 l 419.314 427.348 l 421.278 425.314 l h f Q q 1 0 0 1 94.437 525.4199 cm 0 0 m -2.024 2.02 l 419.269 427.332 l 421.278 425.314 l h f Q q 1 0 0 1 85.2969 534.5327 cm 0 0 m -2.024 2.018 l 419.27 427.346 l 421.263 425.328 l h f Q q 1 0 0 1 76.1108 543.689 cm 0 0 m -1.979 2.034 l 419.314 427.348 l 421.293 425.314 l h f Q q 1 0 0 1 66.9707 552.8013 cm 0 0 m -2.024 2.018 l 419.27 427.346 l 421.263 425.328 l h f Q q 1 0 0 1 57.8306 561.9282 cm 0 0 m -2.024 2.018 l 419.254 427.332 l 421.263 425.312 l h f Q q 1 0 0 1 48.6445 571.0703 cm 0 0 m -1.979 2.032 l 419.27 427.346 l 421.277 425.344 l h f Q q 1 0 0 1 39.5044 580.1968 cm 0 0 m -2.024 2.018 l 419.254 427.33 l 421.262 425.328 l h f Q q 1 0 0 1 30.3643 589.3394 cm 0 0 m -2.04 1.986 l 419.253 427.316 l 421.231 425.328 l h f Q q 1 0 0 1 21.1782 598.4658 cm 0 0 m -2.024 2.018 l 419.254 427.33 l 421.262 425.328 l h f Q q 1 0 0 1 12.0225 607.5767 cm 0 0 m -2.009 2.018 l 419.269 427.332 l 421.278 425.344 l h f Q q 1 0 0 1 2.8823 616.7349 cm 0 0 m -2.04 1.986 l 419.253 427.316 l 421.248 425.328 l h f Q q 1 0 0 1 -6.3037 625.8457 cm 0 0 m -2.009 2.034 l 419.271 427.332 l 421.294 425.343 l h f Q q 1 0 0 1 -15.4438 634.9878 cm 0 0 m -2.024 2.018 l 419.269 427.33 l 421.279 425.312 l h f Q q 1 0 0 1 -24.5845 644.1304 cm 0 0 m -2.039 2.018 l 419.254 427.3 l 421.249 425.328 l h f Q q 1 0 0 1 -33.7695 653.2568 cm 0 0 m -2.04 2.002 l 419.269 427.33 l 421.263 425.312 l h f Q q 1 0 0 1 -42.9248 662.3677 cm 0 0 m -2.024 2.018 l 419.269 427.316 l 421.278 425.313 l h f Q q 1 0 0 1 -52.0957 671.4941 cm 0 0 m -1.979 2.049 l 419.3 427.316 l 421.278 425.328 l h f Q q 1 0 0 1 -61.2358 680.6367 cm 0 0 m -2.024 2.018 l 419.253 427.315 l 421.263 425.313 l h f Q q 1 0 0 1 -70.377 689.793 cm 0 0 m -2.054 1.972 l 419.255 427.286 l 421.278 425.314 l h f Q q 1 0 0 1 -79.5776 698.9053 cm 0 0 m -2.024 2.018 l 419.316 427.332 l 421.279 425.312 l h f Q endstream endobj 28 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 327.957 292.723 m 325.917 294.711 l 747.21 720.038 l 749.236 718.021 l h W n q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 568.1971436 335.8685303 cm BX /Sh0 sh EX Q Q q 318.802 301.881 m 316.777 303.837 l 738.055 729.151 l 740.064 727.147 l h W n q 0 g /GS1 gs -61.2378426 340.9762268 340.9762268 61.2378426 559.036377 345.0255737 cm BX /Sh0 sh EX Q Q q 309.615 310.978 m 307.637 312.995 l 728.915 738.262 l 730.939 736.29 l h W n q 0 g /GS2 gs -61.2388649 340.9819031 340.9819031 61.2388649 549.9105835 354.1331482 cm BX /Sh0 sh EX Q Q q 300.444 320.104 m 298.452 322.106 l 719.729 747.419 l 721.754 745.402 l h W n q 0 g /GS3 gs -61.2448082 341.0150146 341.0150146 61.2448082 540.7234497 363.2567749 cm BX /Sh0 sh EX Q Q q 291.32 329.26 m 289.296 331.217 l 710.589 756.562 l 712.598 754.542 l h W n q 0 g /GS4 gs -61.2428246 341.0039368 341.0039368 61.2428246 531.5627441 372.4067993 cm BX /Sh0 sh EX Q Q q 282.119 338.372 m 280.125 340.375 l 701.434 765.703 l 703.428 763.685 l h W n q 0 g /GS5 gs -61.2463303 341.023468 341.023468 61.2463303 522.3981934 381.5256958 cm BX /Sh0 sh EX Q Q q 272.979 347.483 m 270.97 349.485 l 692.263 774.815 l 694.272 772.797 l h W n q 0 g /GS6 gs -61.2475471 341.0302734 341.0302734 61.2475471 513.2435303 390.6340332 cm BX /Sh0 sh EX Q Q q 263.808 356.626 m 261.814 358.612 l 683.092 783.942 l 685.116 781.938 l h W n q 0 g /GS7 gs -61.2448196 341.0150757 341.0150757 61.2448196 504.0853882 399.7785645 cm BX /Sh0 sh EX Q Q q 254.652 365.752 m 252.644 367.755 l 673.937 793.084 l 675.946 791.066 l h W n q 0 g /GS8 gs -61.2475471 341.0302734 341.0302734 61.2475471 494.9172363 408.9028625 cm BX /Sh0 sh EX Q Q q 245.512 374.879 m 243.503 376.865 l 664.766 802.195 l 666.791 800.177 l h W n q 0 g /GS9 gs -61.2457619 341.0203247 341.0203247 61.2457619 485.7670593 418.02771 cm BX /Sh0 sh EX Q Q q 236.341 384.006 m 234.348 385.993 l 655.626 811.321 l 657.634 809.333 l h W n q 0 g /GS10 gs -61.2448082 341.0150146 341.0150146 61.2448082 476.6132202 427.1572571 cm BX /Sh0 sh EX Q Q q 227.186 393.147 m 225.177 395.134 l 646.455 820.464 l 648.465 818.446 l h W n q 0 g /GS11 gs -61.2452888 341.0176697 341.0176697 61.2452888 467.4408264 436.2965393 cm BX /Sh0 sh EX Q Q q 218.061 402.304 m 216.037 404.277 l 637.3 829.59 l 639.323 827.572 l h W n q 0 g /GS12 gs -61.2410278 340.9939575 340.9939575 61.2410278 458.296814 445.4496155 cm BX /Sh0 sh EX Q Q q 208.875 411.401 m 206.897 413.419 l 628.16 838.701 l 630.152 836.715 l h W n q 0 g /GS13 gs -61.2420692 340.9997559 340.9997559 61.2420692 449.1481934 454.5529785 cm BX /Sh0 sh EX Q Q q 199.705 420.527 m 197.711 422.53 l 618.973 847.843 l 620.997 845.826 l h W n q 0 g /GS14 gs -61.2452888 341.0176697 341.0176697 61.2452888 439.974884 463.6790771 cm BX /Sh0 sh EX Q Q q 190.58 429.686 m 188.555 431.656 l 609.833 856.97 l 611.842 854.968 l h W n q 0 g /GS15 gs -61.2402763 340.9897766 340.9897766 61.2402763 430.8163147 472.8311157 cm BX /Sh0 sh EX Q Q q 181.394 438.796 m 179.415 440.814 l 600.662 866.128 l 602.687 864.11 l h W n q 0 g /GS16 gs -61.2480164 341.0328674 341.0328674 61.2480164 421.6741638 481.9497986 cm BX /Sh0 sh EX Q Q q 172.238 447.907 m 170.229 449.911 l 591.507 875.254 l 593.516 873.237 l h W n q 0 g /GS17 gs -61.2507439 341.0480347 341.0480347 61.2507439 412.496582 491.0567017 cm BX /Sh0 sh EX Q Q q 163.113 457.065 m 161.089 459.038 l 582.367 884.381 l 584.392 882.393 l h W n q 0 g /GS18 gs -61.2457314 341.0201416 341.0201416 61.2457314 403.3618469 500.2130432 cm BX /Sh0 sh EX Q Q q 153.927 466.176 m 151.949 468.194 l 573.196 893.523 l 575.205 891.505 l h W n q 0 g /GS19 gs -61.2507362 341.0480042 341.0480042 61.2507362 394.2018127 509.3284912 cm BX /Sh0 sh EX Q Q q 144.772 475.303 m 142.763 477.291 l 564.025 902.634 l 566.05 900.617 l h W n q 0 g /GS20 gs -61.2484779 341.0354309 341.0354309 61.2484779 385.0277405 518.4517212 cm BX /Sh0 sh EX Q Q q 135.632 484.445 m 133.607 486.433 l 554.886 911.761 l 556.864 909.774 l h W n q 0 g /GS21 gs -61.2457314 341.0201416 341.0201416 61.2457314 375.8597107 527.5891113 cm BX /Sh0 sh EX Q Q q 126.446 493.572 m 124.482 495.59 l 545.715 920.903 l 547.724 918.885 l h W n q 0 g /GS22 gs -61.2480011 341.0327759 341.0327759 61.2480011 366.7262573 536.7250366 cm BX /Sh0 sh EX Q Q q 117.29 502.684 m 115.296 504.702 l 536.56 930.014 l 538.584 927.996 l h W n q 0 g /GS23 gs -61.2477226 341.0312195 341.0312195 61.2477226 357.5635681 545.8361816 cm BX /Sh0 sh EX Q Q q 108.12 511.84 m 106.156 513.875 l 527.434 939.188 l 529.397 937.154 l h W n q 0 g /GS24 gs -61.2493439 341.0402527 341.0402527 61.2493439 348.4013672 554.9940796 cm BX /Sh0 sh EX Q Q q 98.964 520.951 m 96.94 522.971 l 518.233 948.283 l 520.242 946.265 l h W n q 0 g /GS25 gs -61.2480011 341.0327759 341.0327759 61.2480011 339.2152405 564.0994873 cm BX /Sh0 sh EX Q Q q 89.824 530.064 m 87.8 532.082 l 509.094 957.41 l 511.087 955.392 l h W n q 0 g /GS26 gs -61.2504463 341.0463867 341.0463867 61.2504463 330.0687866 573.2108154 cm BX /Sh0 sh EX Q Q q 80.638 539.22 m 78.659 541.254 l 499.952 966.568 l 501.932 964.534 l h W n q 0 g /GS27 gs -61.2493439 341.0402527 341.0402527 61.2493439 320.9199524 582.3738403 cm BX /Sh0 sh EX Q Q q 71.498 548.333 m 69.474 550.351 l 490.768 975.679 l 492.76 973.661 l h W n q 0 g /GS28 gs -61.2504501 341.0464172 341.0464172 61.2504501 311.7425537 591.4796753 cm BX /Sh0 sh EX Q Q q 62.358 557.459 m 60.333 559.477 l 481.612 984.791 l 483.621 982.771 l h W n q 0 g /GS29 gs -61.248455 341.0353088 341.0353088 61.248455 302.6013184 600.6061401 cm BX /Sh0 sh EX Q Q q 53.172 566.602 m 51.193 568.634 l 472.441 993.947 l 474.449 991.945 l h W n q 0 g /GS30 gs -61.2504578 341.0464478 341.0464478 61.2504578 293.4487 609.7543335 cm BX /Sh0 sh EX Q Q q 44.031 575.728 m 42.007 577.746 l 463.286 1003.058 l 465.294 1001.056 l h W n q 0 g /GS31 gs -61.2481842 341.0338135 341.0338135 61.2481842 284.2764282 618.8751831 cm BX /Sh0 sh EX Q Q q 34.891 584.871 m 32.852 586.857 l 454.145 1012.187 l 456.123 1010.198 l h W n q 0 g /GS32 gs -61.2457581 341.0202942 341.0202942 61.2457581 275.1112061 628.0130615 cm BX /Sh0 sh EX Q Q q 25.705 593.997 m 23.681 596.015 l 444.959 1021.327 l 446.968 1019.325 l h W n q 0 g /GS33 gs -61.2481918 341.033844 341.033844 61.2481918 265.9501953 637.144043 cm BX /Sh0 sh EX Q Q q 16.55 603.108 m 14.541 605.126 l 435.818 1030.439 l 437.828 1028.452 l h W n q 0 g /GS34 gs -61.248024 341.0328979 341.0328979 61.248024 256.8111572 646.2578735 cm BX /Sh0 sh EX Q Q q 7.41 612.266 m 5.37 614.252 l 426.663 1039.582 l 428.657 1037.594 l h W n q 0 g /GS35 gs -61.2457581 341.0202942 341.0202942 61.2457581 247.6371613 655.4098511 cm BX /Sh0 sh EX Q Q q -1.776 621.377 m -3.786 623.411 l 417.493 1048.708 l 419.518 1046.72 l h W n q 0 g /GS36 gs -61.247982 341.0326538 341.0326538 61.247982 238.4938507 664.5283203 cm BX /Sh0 sh EX Q Q q -10.917 630.519 m -12.941 632.537 l 408.353 1057.849 l 410.362 1055.831 l h W n q 0 g /GS37 gs -61.2477417 341.0313416 341.0313416 61.2477417 229.3348541 673.6672974 cm BX /Sh0 sh EX Q Q q -20.058 639.662 m -22.096 641.679 l 399.197 1066.961 l 401.191 1064.989 l h W n q 0 g /GS38 gs -61.2429886 341.0048828 341.0048828 61.2429886 220.1739349 682.8060303 cm BX /Sh0 sh EX Q Q q -29.243 648.788 m -31.282 650.79 l 390.026 1076.118 l 392.021 1074.1 l h W n q 0 g /GS39 gs -61.2477531 341.0314026 341.0314026 61.2477531 210.9922638 691.9331665 cm BX /Sh0 sh EX Q Q q -38.398 657.899 m -40.422 659.917 l 380.871 1085.215 l 382.881 1083.212 l h W n q 0 g /GS40 gs -61.2452927 341.0177002 341.0177002 61.2452927 201.8536682 701.0469971 cm BX /Sh0 sh EX Q Q q -47.569 667.025 m -49.548 669.075 l 371.731 1094.341 l 373.71 1092.353 l h W n q 0 g /GS41 gs -61.2443275 341.0123291 341.0123291 61.2443275 192.7086029 710.1782227 cm BX /Sh0 sh EX Q Q q -56.708 676.168 m -58.732 678.186 l 362.545 1103.483 l 364.555 1101.481 l h W n q 0 g /GS42 gs -61.2457733 341.0203857 341.0203857 61.2457733 183.5354156 719.3145752 cm BX /Sh0 sh EX Q Q q -65.85 685.324 m -67.903 687.296 l 353.404 1112.61 l 355.429 1110.638 l h W n q 0 g /GS43 gs -61.2405319 340.9911804 340.9911804 61.2405319 174.3833923 728.4691162 cm BX /Sh0 sh EX Q Q q -75.05 694.437 m -77.075 696.455 l 344.265 1121.769 l 346.229 1119.749 l h W n q 0 g /GS44 gs -61.246582 341.0248718 341.0248718 61.246582 165.2008972 737.5847168 cm BX /Sh0 sh EX Q Q endstream endobj 29 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs 629.656 -52.269 -647.312 180.592 re f endstream endobj 30 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 323.4297 -370.5752 cm 0 0 m -2.039 1.987 l 419.253 427.315 l 421.279 425.298 l h f Q q 1 0 0 1 314.2744 -361.418 cm 0 0 m -2.023 1.957 l 419.253 427.271 l 421.264 425.267 l h f Q q 1 0 0 1 305.0879 -352.3213 cm 0 0 m -1.979 2.019 l 419.3 427.285 l 421.324 425.312 l h f Q q 1 0 0 1 295.917 -343.1943 cm 0 0 m -1.993 2.002 l 419.284 427.316 l 421.311 425.298 l h f Q q 1 0 0 1 286.793 -334.0381 cm 0 0 m -2.024 1.957 l 419.269 427.302 l 421.277 425.282 l h f Q q 1 0 0 1 277.5913 -324.9258 cm 0 0 m -1.994 2.003 l 419.315 427.33 l 421.309 425.312 l h f Q q 1 0 0 1 268.4512 -315.8145 cm 0 0 m -2.009 2.002 l 419.284 427.332 l 421.294 425.313 l h f Q q 1 0 0 1 259.2808 -306.6719 cm 0 0 m -1.994 1.986 l 419.284 427.315 l 421.308 425.312 l h f Q q 1 0 0 1 250.125 -297.5459 cm 0 0 m -2.009 2.002 l 419.284 427.332 l 421.294 425.313 l h f Q q 1 0 0 1 240.9849 -288.4189 cm 0 0 m -2.009 1.986 l 419.253 427.315 l 421.279 425.298 l h f Q q 1 0 0 1 231.8145 -279.293 cm 0 0 m -1.994 1.988 l 419.284 427.316 l 421.292 425.328 l h f Q q 1 0 0 1 222.6587 -270.1504 cm 0 0 m -2.009 1.986 l 419.269 427.316 l 421.279 425.298 l h f Q q 1 0 0 1 213.5337 -260.9941 cm 0 0 m -2.024 1.973 l 419.239 427.286 l 421.262 425.269 l h f Q q 1 0 0 1 204.3481 -251.8975 cm 0 0 m -1.979 2.019 l 419.285 427.301 l 421.277 425.314 l h f Q q 1 0 0 1 195.1772 -242.7705 cm 0 0 m -1.994 2.002 l 419.269 427.316 l 421.292 425.298 l h f Q q 1 0 0 1 186.0522 -233.6123 cm 0 0 m -2.024 1.971 l 419.254 427.284 l 421.262 425.282 l h f Q q 1 0 0 1 176.8662 -224.502 cm 0 0 m -1.979 2.019 l 419.269 427.332 l 421.293 425.314 l h f Q q 1 0 0 1 167.7109 -215.3906 cm 0 0 m -2.009 2.004 l 419.269 427.348 l 421.277 425.329 l h f Q q 1 0 0 1 158.5859 -206.2324 cm 0 0 m -2.024 1.973 l 419.254 427.315 l 421.278 425.328 l h f Q q 1 0 0 1 149.3999 -197.1221 cm 0 0 m -1.979 2.019 l 419.269 427.348 l 421.278 425.33 l h f Q q 1 0 0 1 140.2446 -187.9951 cm 0 0 m -2.009 1.988 l 419.253 427.331 l 421.278 425.313 l h f Q q 1 0 0 1 131.1045 -178.8525 cm 0 0 m -2.024 1.987 l 419.254 427.315 l 421.232 425.329 l h f Q q 1 0 0 1 121.9185 -169.7266 cm 0 0 m -1.963 2.019 l 419.269 427.332 l 421.278 425.313 l h f Q q 1 0 0 1 112.7632 -160.6143 cm 0 0 m -1.994 2.019 l 419.269 427.33 l 421.293 425.312 l h f Q q 1 0 0 1 103.5923 -151.457 cm 0 0 m -1.963 2.033 l 419.314 427.347 l 421.278 425.313 l h f Q q 1 0 0 1 94.437 -142.3467 cm 0 0 m -2.024 2.02 l 419.269 427.332 l 421.278 425.313 l h f Q q 1 0 0 1 85.2969 -133.2344 cm 0 0 m -2.024 2.019 l 419.27 427.346 l 421.263 425.328 l h f Q q 1 0 0 1 76.1108 -124.0781 cm 0 0 m -1.979 2.034 l 419.314 427.348 l 421.293 425.314 l h f Q q 1 0 0 1 66.9707 -114.9648 cm 0 0 m -2.024 2.018 l 419.27 427.346 l 421.263 425.327 l h f Q q 1 0 0 1 57.8306 -105.8389 cm 0 0 m -2.024 2.019 l 419.254 427.332 l 421.263 425.312 l h f Q q 1 0 0 1 48.6445 -96.6963 cm 0 0 m -1.979 2.032 l 419.27 427.346 l 421.277 425.344 l h f Q q 1 0 0 1 39.5044 -87.5693 cm 0 0 m -2.024 2.018 l 419.254 427.329 l 421.262 425.327 l h f Q q 1 0 0 1 30.3643 -78.4277 cm 0 0 m -2.04 1.986 l 419.253 427.316 l 421.231 425.328 l h f Q q 1 0 0 1 21.1782 -69.3008 cm 0 0 m -2.024 2.018 l 419.254 427.33 l 421.262 425.327 l h f Q q 1 0 0 1 12.0225 -60.1904 cm 0 0 m -2.009 2.019 l 419.269 427.332 l 421.278 425.344 l h f Q q 1 0 0 1 2.8823 -51.0322 cm 0 0 m -2.04 1.986 l 419.253 427.316 l 421.248 425.328 l h f Q q 1 0 0 1 -6.3037 -41.9209 cm 0 0 m -2.009 2.033 l 419.271 427.331 l 421.294 425.344 l h f Q q 1 0 0 1 -15.4438 -32.7793 cm 0 0 m -2.024 2.019 l 419.269 427.33 l 421.279 425.312 l h f Q q 1 0 0 1 -24.5845 -23.6367 cm 0 0 m -2.039 2.018 l 419.254 427.3 l 421.249 425.328 l h f Q q 1 0 0 1 -33.7695 -14.5098 cm 0 0 m -2.04 2.002 l 419.269 427.33 l 421.263 425.312 l h f Q q 1 0 0 1 -42.9248 -5.3994 cm 0 0 m -2.024 2.019 l 419.269 427.316 l 421.278 425.314 l h f Q q 1 0 0 1 -52.0957 3.7275 cm 0 0 m -1.979 2.05 l 419.3 427.316 l 421.278 425.328 l h f Q q 1 0 0 1 -61.2358 12.8701 cm 0 0 m -2.024 2.018 l 419.253 427.315 l 421.263 425.313 l h f Q q 1 0 0 1 -70.377 22.0264 cm 0 0 m -2.054 1.972 l 419.255 427.286 l 421.278 425.313 l h f Q q 1 0 0 1 -79.5776 31.1387 cm 0 0 m -2.024 2.018 l 419.316 427.332 l 421.279 425.312 l h f Q endstream endobj 31 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 327.957 -375.044 m 325.917 -373.057 l 747.21 52.271 l 749.236 50.254 l h W n q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 568.1971436 -331.8982239 cm BX /Sh0 sh EX Q Q q 318.802 -365.887 m 316.777 -363.93 l 738.055 61.384 l 740.064 59.38 l h W n q 0 g /GS1 gs -61.2378426 340.9762268 340.9762268 61.2378426 559.036377 -322.7411804 cm BX /Sh0 sh EX Q Q q 309.615 -356.79 m 307.637 -354.771 l 728.915 70.495 l 730.939 68.522 l h W n q 0 g /GS2 gs -61.2388649 340.9819031 340.9819031 61.2388649 549.9105835 -313.633606 cm BX /Sh0 sh EX Q Q q 300.444 -347.663 m 298.452 -345.661 l 719.729 79.653 l 721.754 77.635 l h W n q 0 g /GS3 gs -61.2448082 341.0150146 341.0150146 61.2448082 540.7234497 -304.5099792 cm BX /Sh0 sh EX Q Q q 291.32 -338.507 m 289.296 -336.55 l 710.589 88.795 l 712.598 86.775 l h W n q 0 g /GS4 gs -61.2428246 341.0039368 341.0039368 61.2428246 531.5627441 -295.3599548 cm BX /Sh0 sh EX Q Q q 282.119 -329.395 m 280.125 -327.392 l 701.434 97.936 l 703.428 95.918 l h W n q 0 g /GS5 gs -61.2463303 341.023468 341.023468 61.2463303 522.3981934 -286.2410583 cm BX /Sh0 sh EX Q Q q 272.979 -320.283 m 270.97 -318.281 l 692.263 107.049 l 694.272 105.03 l h W n q 0 g /GS6 gs -61.2475471 341.0302734 341.0302734 61.2475471 513.2435303 -277.1327515 cm BX /Sh0 sh EX Q Q q 263.808 -311.141 m 261.814 -309.154 l 683.092 116.175 l 685.116 114.171 l h W n q 0 g /GS7 gs -61.2448196 341.0150757 341.0150757 61.2448196 504.0853882 -267.9881897 cm BX /Sh0 sh EX Q Q q 254.652 -302.015 m 252.644 -300.013 l 673.937 125.317 l 675.946 123.299 l h W n q 0 g /GS8 gs -61.2475471 341.0302734 341.0302734 61.2475471 494.9172363 -258.8638916 cm BX /Sh0 sh EX Q Q q 245.512 -292.888 m 243.503 -290.901 l 664.766 134.428 l 666.791 132.41 l h W n q 0 g /GS9 gs -61.2457619 341.0203247 341.0203247 61.2457619 485.7670593 -249.7390594 cm BX /Sh0 sh EX Q Q q 236.341 -283.762 m 234.348 -281.773 l 655.626 143.555 l 657.634 141.566 l h W n q 0 g /GS10 gs -61.2448082 341.0150146 341.0150146 61.2448082 476.6132202 -240.6094971 cm BX /Sh0 sh EX Q Q q 227.186 -274.619 m 225.177 -272.633 l 646.455 152.697 l 648.465 150.679 l h W n q 0 g /GS11 gs -61.2452888 341.0176697 341.0176697 61.2452888 467.4408264 -231.4702148 cm BX /Sh0 sh EX Q Q q 218.061 -265.463 m 216.037 -263.49 l 637.3 161.823 l 639.323 159.806 l h W n q 0 g /GS12 gs -61.2410278 340.9939575 340.9939575 61.2410278 458.296814 -222.3171387 cm BX /Sh0 sh EX Q Q q 208.875 -256.366 m 206.897 -254.348 l 628.16 170.935 l 630.152 168.948 l h W n q 0 g /GS13 gs -61.2420692 340.9997559 340.9997559 61.2420692 449.1481934 -213.2137756 cm BX /Sh0 sh EX Q Q q 199.705 -247.239 m 197.711 -245.237 l 618.973 180.077 l 620.997 178.059 l h W n q 0 g /GS14 gs -61.2452888 341.0176697 341.0176697 61.2452888 439.974884 -204.087677 cm BX /Sh0 sh EX Q Q q 190.58 -238.081 m 188.555 -236.11 l 609.833 189.203 l 611.842 187.201 l h W n q 0 g /GS15 gs -61.2402763 340.9897766 340.9897766 61.2402763 430.8163147 -194.9356384 cm BX /Sh0 sh EX Q Q q 181.394 -228.971 m 179.415 -226.952 l 600.662 198.361 l 602.687 196.344 l h W n q 0 g /GS16 gs -61.2480164 341.0328674 341.0328674 61.2480164 421.6741638 -185.8169708 cm BX /Sh0 sh EX Q Q q 172.238 -219.859 m 170.229 -217.855 l 591.507 207.488 l 593.516 205.47 l h W n q 0 g /GS17 gs -61.2507439 341.0480347 341.0480347 61.2507439 412.496582 -176.7100677 cm BX /Sh0 sh EX Q Q q 163.113 -210.701 m 161.089 -208.729 l 582.367 216.614 l 584.392 214.627 l h W n q 0 g /GS18 gs -61.2457314 341.0201416 341.0201416 61.2457314 403.3618469 -167.5537109 cm BX /Sh0 sh EX Q Q q 153.927 -201.591 m 151.949 -199.572 l 573.196 225.757 l 575.205 223.739 l h W n q 0 g /GS19 gs -61.2507362 341.0480042 341.0480042 61.2507362 394.2018127 -158.4382629 cm BX /Sh0 sh EX Q Q q 144.772 -192.464 m 142.763 -190.476 l 564.025 234.867 l 566.05 232.85 l h W n q 0 g /GS20 gs -61.2484779 341.0354309 341.0354309 61.2484779 385.0277405 -149.3150177 cm BX /Sh0 sh EX Q Q q 135.632 -183.321 m 133.607 -181.334 l 554.886 243.994 l 556.864 242.008 l h W n q 0 g /GS21 gs -61.2457314 341.0201416 341.0201416 61.2457314 375.8597107 -140.1776733 cm BX /Sh0 sh EX Q Q q 126.446 -174.195 m 124.482 -172.177 l 545.715 253.137 l 547.724 251.118 l h W n q 0 g /GS22 gs -61.2480011 341.0327759 341.0327759 61.2480011 366.7262573 -131.0417328 cm BX /Sh0 sh EX Q Q q 117.29 -165.083 m 115.296 -163.064 l 536.56 262.247 l 538.584 260.229 l h W n q 0 g /GS23 gs -61.2477226 341.0312195 341.0312195 61.2477226 357.5635681 -121.9305801 cm BX /Sh0 sh EX Q Q q 108.12 -155.926 m 106.156 -153.893 l 527.434 271.421 l 529.397 269.388 l h W n q 0 g /GS24 gs -61.2493439 341.0402527 341.0402527 61.2493439 348.4013672 -112.7726593 cm BX /Sh0 sh EX Q Q q 98.964 -146.815 m 96.94 -144.796 l 518.233 280.517 l 520.242 278.498 l h W n q 0 g /GS25 gs -61.2480011 341.0327759 341.0327759 61.2480011 339.2152405 -103.6672897 cm BX /Sh0 sh EX Q Q q 89.824 -137.703 m 87.8 -135.685 l 509.094 289.643 l 511.087 287.625 l h W n q 0 g /GS26 gs -61.2504463 341.0463867 341.0463867 61.2504463 330.0687866 -94.5559158 cm BX /Sh0 sh EX Q Q q 80.638 -128.547 m 78.659 -126.513 l 499.952 298.801 l 501.932 296.768 l h W n q 0 g /GS27 gs -61.2493439 341.0402527 341.0402527 61.2493439 320.9199524 -85.3928986 cm BX /Sh0 sh EX Q Q q 71.498 -119.434 m 69.474 -117.416 l 490.768 307.912 l 492.76 305.894 l h W n q 0 g /GS28 gs -61.2504501 341.0464172 341.0464172 61.2504501 311.7425537 -76.2870865 cm BX /Sh0 sh EX Q Q q 62.358 -110.308 m 60.333 -108.289 l 481.612 317.024 l 483.621 315.005 l h W n q 0 g /GS29 gs -61.248455 341.0353088 341.0353088 61.248455 302.6013184 -67.1606445 cm BX /Sh0 sh EX Q Q q 53.172 -101.165 m 51.193 -99.133 l 472.441 326.181 l 474.449 324.179 l h W n q 0 g /GS30 gs -61.2504578 341.0464478 341.0464478 61.2504578 293.4487 -58.0124435 cm BX /Sh0 sh EX Q Q q 44.031 -92.038 m 42.007 -90.021 l 463.286 335.291 l 465.294 333.289 l h W n q 0 g /GS31 gs -61.2481842 341.0338135 341.0338135 61.2481842 284.2764282 -48.8915443 cm BX /Sh0 sh EX Q Q q 34.891 -82.896 m 32.852 -80.91 l 454.145 344.42 l 456.123 342.432 l h W n q 0 g /GS32 gs -61.2457581 341.0202942 341.0202942 61.2457581 275.1112061 -39.7536964 cm BX /Sh0 sh EX Q Q q 25.705 -73.77 m 23.681 -71.752 l 444.959 353.561 l 446.968 351.558 l h W n q 0 g /GS33 gs -61.2481918 341.033844 341.033844 61.2481918 265.9501953 -30.6227131 cm BX /Sh0 sh EX Q Q q 16.55 -64.659 m 14.541 -62.641 l 435.818 362.673 l 437.828 360.685 l h W n q 0 g /GS34 gs -61.248024 341.0328979 341.0328979 61.248024 256.8111572 -21.5088825 cm BX /Sh0 sh EX Q Q q 7.41 -55.501 m 5.37 -53.515 l 426.663 371.815 l 428.657 369.827 l h W n q 0 g /GS35 gs -61.2457581 341.0202942 341.0202942 61.2457581 247.6371613 -12.3568954 cm BX /Sh0 sh EX Q Q q -1.776 -46.39 m -3.786 -44.356 l 417.493 380.941 l 419.518 378.954 l h W n q 0 g /GS36 gs -61.247982 341.0326538 341.0326538 61.247982 238.4938507 -3.2384477 cm BX /Sh0 sh EX Q Q q -10.917 -37.248 m -12.941 -35.229 l 408.353 390.082 l 410.362 388.064 l h W n q 0 g /GS37 gs -61.2477417 341.0313416 341.0313416 61.2477417 229.3348541 5.9005198 cm BX /Sh0 sh EX Q Q q -20.058 -28.105 m -22.096 -26.088 l 399.197 399.195 l 401.191 397.223 l h W n q 0 g /GS38 gs -61.2429886 341.0048828 341.0048828 61.2429886 220.1739349 15.039278 cm BX /Sh0 sh EX Q Q q -29.243 -18.979 m -31.282 -16.977 l 390.026 408.351 l 392.021 406.333 l h W n q 0 g /GS39 gs -61.2477531 341.0314026 341.0314026 61.2477531 210.9922638 24.1663857 cm BX /Sh0 sh EX Q Q q -38.398 -9.868 m -40.422 -7.85 l 380.871 417.448 l 382.881 415.446 l h W n q 0 g /GS40 gs -61.2452927 341.0177002 341.0177002 61.2452927 201.8536682 33.2802658 cm BX /Sh0 sh EX Q Q q -47.569 -0.741 m -49.548 1.309 l 371.731 426.575 l 373.71 424.586 l h W n q 0 g /GS41 gs -61.2443275 341.0123291 341.0123291 61.2443275 192.7086029 42.4114647 cm BX /Sh0 sh EX Q Q q -56.708 8.401 m -58.732 10.419 l 362.545 435.717 l 364.555 433.715 l h W n q 0 g /GS42 gs -61.2457733 341.0203857 341.0203857 61.2457733 183.5354156 51.5477982 cm BX /Sh0 sh EX Q Q q -65.85 17.558 m -67.903 19.529 l 353.404 444.844 l 355.429 442.871 l h W n q 0 g /GS43 gs -61.2405319 340.9911804 340.9911804 61.2405319 174.3833923 60.7023544 cm BX /Sh0 sh EX Q Q q -75.05 26.67 m -77.075 28.687 l 344.265 454.001 l 346.229 451.982 l h W n q 0 g /GS44 gs -61.246582 341.0248718 341.0248718 61.246582 165.2008972 69.8179321 cm BX /Sh0 sh EX Q Q endstream endobj 84 0 obj <> endobj 81 0 obj <> endobj 35 0 obj [/DeviceN[/Black]/DeviceCMYK 131 0 R 132 0 R] endobj 130 0 obj <> endobj 133 0 obj <> endobj 134 0 obj <> endobj 131 0 obj <>stream {1.000000 2 1 roll 1.000000 2 1 roll 1.000000 2 1 roll 0 index 1.000000 cvr exch sub 2 1 roll 5 -1 roll 1.000000 cvr exch sub 5 1 roll 4 -1 roll 1.000000 cvr exch sub 4 1 roll 3 -1 roll 1.000000 cvr exch sub 3 1 roll 2 -1 roll 1.000000 cvr exch sub 2 1 roll pop } endstream endobj 132 0 obj <> endobj 135 0 obj <> endobj 85 0 obj <> endobj 86 0 obj <> endobj 87 0 obj <> endobj 88 0 obj <> endobj 89 0 obj <> endobj 90 0 obj <> endobj 91 0 obj <> endobj 92 0 obj <> endobj 93 0 obj <> endobj 94 0 obj <> endobj 95 0 obj <> endobj 96 0 obj <> endobj 97 0 obj <> endobj 98 0 obj <> endobj 99 0 obj <> endobj 100 0 obj <> endobj 101 0 obj <> endobj 102 0 obj <> endobj 103 0 obj <> endobj 104 0 obj <> endobj 105 0 obj <> endobj 106 0 obj <> endobj 107 0 obj <> endobj 108 0 obj <> endobj 109 0 obj <> endobj 110 0 obj <> endobj 111 0 obj <> endobj 112 0 obj <> endobj 113 0 obj <> endobj 114 0 obj <> endobj 115 0 obj <> endobj 116 0 obj <> endobj 117 0 obj <> endobj 118 0 obj <> endobj 119 0 obj <> endobj 120 0 obj <> endobj 121 0 obj <> endobj 122 0 obj <> endobj 123 0 obj <> endobj 124 0 obj <> endobj 125 0 obj <> endobj 126 0 obj <> endobj 127 0 obj <> endobj 128 0 obj <> endobj 129 0 obj <> endobj 180 0 obj <> endobj 181 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457619 341.0203247 341.0203247 61.2457619 485.7670593 -249.7390594 cm BX /Sh0 sh EX Q endstream endobj 182 0 obj <> endobj 183 0 obj <> endobj 184 0 obj <> endobj 185 0 obj <> endobj 186 0 obj <> endobj 11 0 obj <> endobj 179 0 obj <> endobj 187 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2475471 341.0302734 341.0302734 61.2475471 494.9172363 -258.8638916 cm BX /Sh0 sh EX Q endstream endobj 188 0 obj <> endobj 178 0 obj <> endobj 189 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448196 341.0150757 341.0150757 61.2448196 504.0853882 -267.9881897 cm BX /Sh0 sh EX Q endstream endobj 190 0 obj <> endobj 177 0 obj <> endobj 191 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2475471 341.0302734 341.0302734 61.2475471 513.2435303 -277.1327515 cm BX /Sh0 sh EX Q endstream endobj 192 0 obj <> endobj 176 0 obj <> endobj 193 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2463303 341.023468 341.023468 61.2463303 522.3981934 -286.2410583 cm BX /Sh0 sh EX Q endstream endobj 194 0 obj <> endobj 175 0 obj <> endobj 195 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.246582 341.0248718 341.0248718 61.246582 165.2008972 69.8179321 cm BX /Sh0 sh EX Q endstream endobj 196 0 obj <> endobj 174 0 obj <> endobj 197 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2405319 340.9911804 340.9911804 61.2405319 174.3833923 60.7023544 cm BX /Sh0 sh EX Q endstream endobj 198 0 obj <> endobj 173 0 obj <> endobj 199 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 183.5354156 51.5477982 cm BX /Sh0 sh EX Q endstream endobj 200 0 obj <> endobj 172 0 obj <> endobj 201 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2443275 341.0123291 341.0123291 61.2443275 192.7086029 42.4114647 cm BX /Sh0 sh EX Q endstream endobj 202 0 obj <> endobj 171 0 obj <> endobj 203 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452927 341.0177002 341.0177002 61.2452927 201.8536682 33.2802658 cm BX /Sh0 sh EX Q endstream endobj 204 0 obj <> endobj 170 0 obj <> endobj 205 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2428246 341.0039368 341.0039368 61.2428246 531.5627441 -295.3599548 cm BX /Sh0 sh EX Q endstream endobj 206 0 obj <> endobj 169 0 obj <> endobj 207 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477531 341.0314026 341.0314026 61.2477531 210.9922638 24.1663857 cm BX /Sh0 sh EX Q endstream endobj 208 0 obj <> endobj 168 0 obj <> endobj 209 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2429886 341.0048828 341.0048828 61.2429886 220.1739349 15.039278 cm BX /Sh0 sh EX Q endstream endobj 210 0 obj <> endobj 167 0 obj <> endobj 211 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477417 341.0313416 341.0313416 61.2477417 229.3348541 5.9005198 cm BX /Sh0 sh EX Q endstream endobj 212 0 obj <> endobj 166 0 obj <> endobj 213 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.247982 341.0326538 341.0326538 61.247982 238.4938507 -3.2384477 cm BX /Sh0 sh EX Q endstream endobj 214 0 obj <> endobj 165 0 obj <> endobj 215 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457581 341.0202942 341.0202942 61.2457581 247.6371613 -12.3568954 cm BX /Sh0 sh EX Q endstream endobj 216 0 obj <> endobj 164 0 obj <> endobj 217 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.248024 341.0328979 341.0328979 61.248024 256.8111572 -21.5088825 cm BX /Sh0 sh EX Q endstream endobj 218 0 obj <> endobj 163 0 obj <> endobj 219 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2481918 341.033844 341.033844 61.2481918 265.9501953 -30.6227131 cm BX /Sh0 sh EX Q endstream endobj 220 0 obj <> endobj 162 0 obj <> endobj 221 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457581 341.0202942 341.0202942 61.2457581 275.1112061 -39.7536964 cm BX /Sh0 sh EX Q endstream endobj 222 0 obj <> endobj 161 0 obj <> endobj 223 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2481842 341.0338135 341.0338135 61.2481842 284.2764282 -48.8915443 cm BX /Sh0 sh EX Q endstream endobj 224 0 obj <> endobj 160 0 obj <> endobj 225 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504578 341.0464478 341.0464478 61.2504578 293.4487 -58.0124435 cm BX /Sh0 sh EX Q endstream endobj 226 0 obj <> endobj 159 0 obj <> endobj 227 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448082 341.0150146 341.0150146 61.2448082 540.7234497 -304.5099792 cm BX /Sh0 sh EX Q endstream endobj 228 0 obj <> endobj 158 0 obj <> endobj 229 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.248455 341.0353088 341.0353088 61.248455 302.6013184 -67.1606445 cm BX /Sh0 sh EX Q endstream endobj 230 0 obj <> endobj 157 0 obj <> endobj 231 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504501 341.0464172 341.0464172 61.2504501 311.7425537 -76.2870865 cm BX /Sh0 sh EX Q endstream endobj 232 0 obj <> endobj 156 0 obj <> endobj 233 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2493439 341.0402527 341.0402527 61.2493439 320.9199524 -85.3928986 cm BX /Sh0 sh EX Q endstream endobj 234 0 obj <> endobj 155 0 obj <> endobj 235 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504463 341.0463867 341.0463867 61.2504463 330.0687866 -94.5559158 cm BX /Sh0 sh EX Q endstream endobj 236 0 obj <> endobj 154 0 obj <> endobj 237 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480011 341.0327759 341.0327759 61.2480011 339.2152405 -103.6672897 cm BX /Sh0 sh EX Q endstream endobj 238 0 obj <> endobj 153 0 obj <> endobj 239 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2493439 341.0402527 341.0402527 61.2493439 348.4013672 -112.7726593 cm BX /Sh0 sh EX Q endstream endobj 240 0 obj <> endobj 152 0 obj <> endobj 241 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477226 341.0312195 341.0312195 61.2477226 357.5635681 -121.9305801 cm BX /Sh0 sh EX Q endstream endobj 242 0 obj <> endobj 151 0 obj <> endobj 243 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480011 341.0327759 341.0327759 61.2480011 366.7262573 -131.0417328 cm BX /Sh0 sh EX Q endstream endobj 244 0 obj <> endobj 150 0 obj <> endobj 245 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457314 341.0201416 341.0201416 61.2457314 375.8597107 -140.1776733 cm BX /Sh0 sh EX Q endstream endobj 246 0 obj <> endobj 149 0 obj <> endobj 247 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2484779 341.0354309 341.0354309 61.2484779 385.0277405 -149.3150177 cm BX /Sh0 sh EX Q endstream endobj 248 0 obj <> endobj 148 0 obj <> endobj 249 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2388649 340.9819031 340.9819031 61.2388649 549.9105835 -313.633606 cm BX /Sh0 sh EX Q endstream endobj 250 0 obj <> endobj 147 0 obj <> endobj 251 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2507362 341.0480042 341.0480042 61.2507362 394.2018127 -158.4382629 cm BX /Sh0 sh EX Q endstream endobj 252 0 obj <> endobj 146 0 obj <> endobj 253 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457314 341.0201416 341.0201416 61.2457314 403.3618469 -167.5537109 cm BX /Sh0 sh EX Q endstream endobj 254 0 obj <> endobj 145 0 obj <> endobj 255 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2507439 341.0480347 341.0480347 61.2507439 412.496582 -176.7100677 cm BX /Sh0 sh EX Q endstream endobj 256 0 obj <> endobj 144 0 obj <> endobj 257 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480164 341.0328674 341.0328674 61.2480164 421.6741638 -185.8169708 cm BX /Sh0 sh EX Q endstream endobj 258 0 obj <> endobj 143 0 obj <> endobj 259 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2402763 340.9897766 340.9897766 61.2402763 430.8163147 -194.9356384 cm BX /Sh0 sh EX Q endstream endobj 260 0 obj <> endobj 142 0 obj <> endobj 261 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452888 341.0176697 341.0176697 61.2452888 439.974884 -204.087677 cm BX /Sh0 sh EX Q endstream endobj 262 0 obj <> endobj 141 0 obj <> endobj 263 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2420692 340.9997559 340.9997559 61.2420692 449.1481934 -213.2137756 cm BX /Sh0 sh EX Q endstream endobj 264 0 obj <> endobj 140 0 obj <> endobj 265 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2410278 340.9939575 340.9939575 61.2410278 458.296814 -222.3171387 cm BX /Sh0 sh EX Q endstream endobj 266 0 obj <> endobj 139 0 obj <> endobj 267 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452888 341.0176697 341.0176697 61.2452888 467.4408264 -231.4702148 cm BX /Sh0 sh EX Q endstream endobj 268 0 obj <> endobj 138 0 obj <> endobj 269 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448082 341.0150146 341.0150146 61.2448082 476.6132202 -240.6094971 cm BX /Sh0 sh EX Q endstream endobj 270 0 obj <> endobj 137 0 obj <> endobj 271 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2378426 340.9762268 340.9762268 61.2378426 559.036377 -322.7411804 cm BX /Sh0 sh EX Q endstream endobj 272 0 obj <> endobj 136 0 obj <> endobj 273 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 568.1971436 -331.8982239 cm BX /Sh0 sh EX Q endstream endobj 274 0 obj <> endobj 83 0 obj <> endobj 82 0 obj <> endobj 34 0 obj <> endobj 36 0 obj <> endobj 37 0 obj <> endobj 38 0 obj <> endobj 39 0 obj <> endobj 40 0 obj <> endobj 41 0 obj <> endobj 42 0 obj <> endobj 43 0 obj <> endobj 44 0 obj <> endobj 45 0 obj <> endobj 46 0 obj <> endobj 47 0 obj <> endobj 48 0 obj <> endobj 49 0 obj <> endobj 50 0 obj <> endobj 51 0 obj <> endobj 52 0 obj <> endobj 53 0 obj <> endobj 54 0 obj <> endobj 55 0 obj <> endobj 56 0 obj <> endobj 57 0 obj <> endobj 58 0 obj <> endobj 59 0 obj <> endobj 60 0 obj <> endobj 61 0 obj <> endobj 62 0 obj <> endobj 63 0 obj <> endobj 64 0 obj <> endobj 65 0 obj <> endobj 66 0 obj <> endobj 67 0 obj <> endobj 68 0 obj <> endobj 69 0 obj <> endobj 70 0 obj <> endobj 71 0 obj <> endobj 72 0 obj <> endobj 73 0 obj <> endobj 74 0 obj <> endobj 75 0 obj <> endobj 76 0 obj <> endobj 77 0 obj <> endobj 78 0 obj <> endobj 79 0 obj <> endobj 80 0 obj <> endobj 319 0 obj <> endobj 320 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457619 341.0203247 341.0203247 61.2457619 485.7670593 418.02771 cm BX /Sh0 sh EX Q endstream endobj 321 0 obj <> endobj 318 0 obj <> endobj 322 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2475471 341.0302734 341.0302734 61.2475471 494.9172363 408.9028625 cm BX /Sh0 sh EX Q endstream endobj 323 0 obj <> endobj 317 0 obj <> endobj 324 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448196 341.0150757 341.0150757 61.2448196 504.0853882 399.7785645 cm BX /Sh0 sh EX Q endstream endobj 325 0 obj <> endobj 316 0 obj <> endobj 326 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2475471 341.0302734 341.0302734 61.2475471 513.2435303 390.6340332 cm BX /Sh0 sh EX Q endstream endobj 327 0 obj <> endobj 315 0 obj <> endobj 328 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2463303 341.023468 341.023468 61.2463303 522.3981934 381.5256958 cm BX /Sh0 sh EX Q endstream endobj 329 0 obj <> endobj 314 0 obj <> endobj 330 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.246582 341.0248718 341.0248718 61.246582 165.2008972 737.5847168 cm BX /Sh0 sh EX Q endstream endobj 331 0 obj <> endobj 313 0 obj <> endobj 332 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2405319 340.9911804 340.9911804 61.2405319 174.3833923 728.4691162 cm BX /Sh0 sh EX Q endstream endobj 333 0 obj <> endobj 312 0 obj <> endobj 334 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 183.5354156 719.3145752 cm BX /Sh0 sh EX Q endstream endobj 335 0 obj <> endobj 311 0 obj <> endobj 336 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2443275 341.0123291 341.0123291 61.2443275 192.7086029 710.1782227 cm BX /Sh0 sh EX Q endstream endobj 337 0 obj <> endobj 310 0 obj <> endobj 338 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452927 341.0177002 341.0177002 61.2452927 201.8536682 701.0469971 cm BX /Sh0 sh EX Q endstream endobj 339 0 obj <> endobj 309 0 obj <> endobj 340 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2428246 341.0039368 341.0039368 61.2428246 531.5627441 372.4067993 cm BX /Sh0 sh EX Q endstream endobj 341 0 obj <> endobj 308 0 obj <> endobj 342 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477531 341.0314026 341.0314026 61.2477531 210.9922638 691.9331665 cm BX /Sh0 sh EX Q endstream endobj 343 0 obj <> endobj 307 0 obj <> endobj 344 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2429886 341.0048828 341.0048828 61.2429886 220.1739349 682.8060303 cm BX /Sh0 sh EX Q endstream endobj 345 0 obj <> endobj 306 0 obj <> endobj 346 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477417 341.0313416 341.0313416 61.2477417 229.3348541 673.6672974 cm BX /Sh0 sh EX Q endstream endobj 347 0 obj <> endobj 305 0 obj <> endobj 348 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.247982 341.0326538 341.0326538 61.247982 238.4938507 664.5283203 cm BX /Sh0 sh EX Q endstream endobj 349 0 obj <> endobj 304 0 obj <> endobj 350 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457581 341.0202942 341.0202942 61.2457581 247.6371613 655.4098511 cm BX /Sh0 sh EX Q endstream endobj 351 0 obj <> endobj 303 0 obj <> endobj 352 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.248024 341.0328979 341.0328979 61.248024 256.8111572 646.2578735 cm BX /Sh0 sh EX Q endstream endobj 353 0 obj <> endobj 302 0 obj <> endobj 354 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2481918 341.033844 341.033844 61.2481918 265.9501953 637.144043 cm BX /Sh0 sh EX Q endstream endobj 355 0 obj <> endobj 301 0 obj <> endobj 356 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457581 341.0202942 341.0202942 61.2457581 275.1112061 628.0130615 cm BX /Sh0 sh EX Q endstream endobj 357 0 obj <> endobj 300 0 obj <> endobj 358 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2481842 341.0338135 341.0338135 61.2481842 284.2764282 618.8751831 cm BX /Sh0 sh EX Q endstream endobj 359 0 obj <> endobj 299 0 obj <> endobj 360 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504578 341.0464478 341.0464478 61.2504578 293.4487 609.7543335 cm BX /Sh0 sh EX Q endstream endobj 361 0 obj <> endobj 298 0 obj <> endobj 362 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448082 341.0150146 341.0150146 61.2448082 540.7234497 363.2567749 cm BX /Sh0 sh EX Q endstream endobj 363 0 obj <> endobj 297 0 obj <> endobj 364 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.248455 341.0353088 341.0353088 61.248455 302.6013184 600.6061401 cm BX /Sh0 sh EX Q endstream endobj 365 0 obj <> endobj 296 0 obj <> endobj 366 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504501 341.0464172 341.0464172 61.2504501 311.7425537 591.4796753 cm BX /Sh0 sh EX Q endstream endobj 367 0 obj <> endobj 295 0 obj <> endobj 368 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2493439 341.0402527 341.0402527 61.2493439 320.9199524 582.3738403 cm BX /Sh0 sh EX Q endstream endobj 369 0 obj <> endobj 294 0 obj <> endobj 370 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2504463 341.0463867 341.0463867 61.2504463 330.0687866 573.2108154 cm BX /Sh0 sh EX Q endstream endobj 371 0 obj <> endobj 293 0 obj <> endobj 372 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480011 341.0327759 341.0327759 61.2480011 339.2152405 564.0994873 cm BX /Sh0 sh EX Q endstream endobj 373 0 obj <> endobj 292 0 obj <> endobj 374 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2493439 341.0402527 341.0402527 61.2493439 348.4013672 554.9940796 cm BX /Sh0 sh EX Q endstream endobj 375 0 obj <> endobj 291 0 obj <> endobj 376 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2477226 341.0312195 341.0312195 61.2477226 357.5635681 545.8361816 cm BX /Sh0 sh EX Q endstream endobj 377 0 obj <> endobj 290 0 obj <> endobj 378 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480011 341.0327759 341.0327759 61.2480011 366.7262573 536.7250366 cm BX /Sh0 sh EX Q endstream endobj 379 0 obj <> endobj 289 0 obj <> endobj 380 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457314 341.0201416 341.0201416 61.2457314 375.8597107 527.5891113 cm BX /Sh0 sh EX Q endstream endobj 381 0 obj <> endobj 288 0 obj <> endobj 382 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2484779 341.0354309 341.0354309 61.2484779 385.0277405 518.4517212 cm BX /Sh0 sh EX Q endstream endobj 383 0 obj <> endobj 287 0 obj <> endobj 384 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2388649 340.9819031 340.9819031 61.2388649 549.9105835 354.1331482 cm BX /Sh0 sh EX Q endstream endobj 385 0 obj <> endobj 286 0 obj <> endobj 386 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2507362 341.0480042 341.0480042 61.2507362 394.2018127 509.3284912 cm BX /Sh0 sh EX Q endstream endobj 387 0 obj <> endobj 285 0 obj <> endobj 388 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457314 341.0201416 341.0201416 61.2457314 403.3618469 500.2130432 cm BX /Sh0 sh EX Q endstream endobj 389 0 obj <> endobj 284 0 obj <> endobj 390 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2507439 341.0480347 341.0480347 61.2507439 412.496582 491.0567017 cm BX /Sh0 sh EX Q endstream endobj 391 0 obj <> endobj 283 0 obj <> endobj 392 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2480164 341.0328674 341.0328674 61.2480164 421.6741638 481.9497986 cm BX /Sh0 sh EX Q endstream endobj 393 0 obj <> endobj 282 0 obj <> endobj 394 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2402763 340.9897766 340.9897766 61.2402763 430.8163147 472.8311157 cm BX /Sh0 sh EX Q endstream endobj 395 0 obj <> endobj 281 0 obj <> endobj 396 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452888 341.0176697 341.0176697 61.2452888 439.974884 463.6790771 cm BX /Sh0 sh EX Q endstream endobj 397 0 obj <> endobj 280 0 obj <> endobj 398 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2420692 340.9997559 340.9997559 61.2420692 449.1481934 454.5529785 cm BX /Sh0 sh EX Q endstream endobj 399 0 obj <> endobj 279 0 obj <> endobj 400 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2410278 340.9939575 340.9939575 61.2410278 458.296814 445.4496155 cm BX /Sh0 sh EX Q endstream endobj 401 0 obj <> endobj 278 0 obj <> endobj 402 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2452888 341.0176697 341.0176697 61.2452888 467.4408264 436.2965393 cm BX /Sh0 sh EX Q endstream endobj 403 0 obj <> endobj 277 0 obj <> endobj 404 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2448082 341.0150146 341.0150146 61.2448082 476.6132202 427.1572571 cm BX /Sh0 sh EX Q endstream endobj 405 0 obj <> endobj 276 0 obj <> endobj 406 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2378426 340.9762268 340.9762268 61.2378426 559.036377 345.0255737 cm BX /Sh0 sh EX Q endstream endobj 407 0 obj <> endobj 275 0 obj <> endobj 408 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -61.2457733 341.0203857 341.0203857 61.2457733 568.1971436 335.8685303 cm BX /Sh0 sh EX Q endstream endobj 409 0 obj <> endobj 33 0 obj <> endobj 32 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <> endobj 24 0 obj <> endobj 16 0 obj <> endobj 25 0 obj <> endobj 14 0 obj <> endobj 418 0 obj <> endobj 419 0 obj <>stream HVyxTW7KJҐμL3oBR,l2l:Z, %*ncUD{(;T[EݴV?EֺU+BxL{{Ͻ9w컮 $<|=S4p)=фLr|,",JF Ѕv؉ q0݇[9| ~a< Yjd Qj [Ѓ>lv}\a7#؃c؏/N܁88i͢rC3W{rj4ePKj(D-~E$/_<ɤj2h9ɅP(bJtЉ?P?4ϑ +ALD3&!`.#lېZB h9-(-e4ⴔbp:~38k8}9O{=qeLKiuѵv^M՞v499:wcDh>$Zl^|n_W5>쬖Õ9~FZK G{%{ۭbGG٭ub9^n%;bۥ7T|eoT+;<7\-0Zz =>{(0T; U4O'uw቗O?p|au}\QǨʴ Jk&m֦-jWi^ 4w{df77OXV%OIS`|J62>%O&ƧDƧd3S4Ŝ\L6[i֎R3U2!fd&q,ꈗܡ+#Z99qQM,ɍL2:2UO5Ōx^k:j}%cڂ9gW/+i-GZc݌%[-K$`n% !BuRmZ <5/}xD!/E!N:/ҷߞrvabpQtz!w;q#`T($YSiUKڿz#݉^y;dU 02 }ܮ;'tpa&ke/cotV+2Kqx ]B25[0#S)I0Ae*y9gg ju DR̯g%a0uɡ;[.z_?F)p4yw7UY3amOn$HU^ $ v\eu@z5U}{] Nq F*$4T i2f#'X4KXu7Bs(pD%4B*S:o萅ߣՕG :AF=TB?OX:j [vga/m(U` W>a`/`_cg#'rDCAp8p.@ ܡƹy@ƹ"(q<"%6&2D, rCAt$ k/D_^~!:Bt xjYCGo6Z7 r.ps.U/#~w w\6 ߂u 7 ~Ds5~o?;+DU"]N6׻Ə8GD :'DO ;5VUjU{~cvivҮ[Z̲$RbSţ<~%>Y/j[t77EmQxo7N5u%LM"3TVDᝒmqiޞn[mj:YN!*4Hԧ @?=332{:'' RA<,0[/a?a*Lu}>>WLEpV+!Vho~wJS"pg~~%G_\)-MxW-ijg 6WMm3T$ (0Ɣ g2P7x|1Z ][DA$$zR"C 5M;Y b|4;@Ngw@XD6T|!RE/V}Da9}}m:#{G¹9vQkP4 now s'Owؐ/O+c!f!dmfF;6KL 0mLI]*Y$ue(LZb.Z d`x`8UvM4o܅)yL8y0zfFlxyWuX^%/:n">8zwjY ٔc̾d2賶ٵguЛ8= EV+M0n"<&j7fKw2c6C8)RۋCLü~&ưo;*gΖϏ{)}.z3xRكڣJTd '|M1*g5]KR5&=I:UQCYERj"93=59pl}"6vb,#dr3… uESOٶιTdl\ [ijGVSgzYYϾQ)Ek_}s\Mz2г3PŒ ӢP_ؒ`Cuyz^Gl LJ>< QuQ%IpJ+t.(V♷^AʮHbaEGᢞf,\'C q.Č$D$ɕaQi:M;Sϩy8Ѵhuz{ԁ˗.LKu>!@6v~HBdL#!?c@={PQ9ÀQYll p8OL'rpkOE1>$*ELlFeFGcEDIm@?W{L?~D af@`f( 0ʀK@qtPp<46ݭhkv[lmӤf>nLִIi4MZ6f{:'{{OYzBxIm%>/(uo6O ±h[n I{c?kjjƳv%)-fg:{uei:PǠOidz9vs ĝ샯(M"(Nlc:ҋ2 bT/6?v6AXIwsI^-V/QUcd))*"Qg4!XD^MG"F_9 +2컚Yzi3C(q]\}1k,irطQFBvy2'ц? ?pcG`*]˺fʢƊF; Rdgc1E9h)cܜx8B#5$蒂%ڱ\s/˿p`dN m4ې*cbpQW("j* {dVDb\)H!Y-"͒uҐL(>6P", eHhjni57s3B32r xx`04:tA]pLĢg:|\U?`yrêdՒ\r(d^ȫJ_76ؚj(krs6wf79v;؃9/>cu_úa]bb,U}"T˪(f[D}-M=ۢSiMjvehN_&ێޒֲ̤w;єck{zʡw=f%a$T/I`G 20rXˇb /}/Ib w^yH?o9Uȣ"ګks=Lh=ɿ6s1P E+_T~|G' ʧyTЯ hPuz^OePQЧ"~?cxX2 =ZȪag 4Buiݏm7$Mhy~NQڳ.rr#mmr&Fmcgq78y}?I#2R1u@=Thm./OD.r=]AH$fO#kw'K%[t&7$=|2\=NFIGdctS3z(`t82jWgS2uA2R}ЬV:o?FrsdD/қo)uj_x#u٩y{UZ{d:9u"b;97/OFf쥑S sSѰob&45l[.'CO;45ggC1{䈽[]ӏԊ.Jh֘I';UQ%J-~Ѷ^F(Ǥt3-,͡_ nC~3s)FDL3riuP9RyJxb!{ei-1%1qHHcwUmᅟ_ /p~;mh,HƖK6LܤCA-f6܀}jO!;3ݢwt>;3?$D2YL<+'Ek endstream endobj 417 0 obj <> endobj 420 0 obj <>stream HVyxTW7KJҐμL3oHRLmX΃d@*6VZw,Ԋr'ZKhV~ݺBxLү{{Ͻ9wl。ėhTwC:fEN]=뻇OM;N@UPZ3Q/ ԫs-x!5l746mI%ю d_ONo 6';+Xgϖm3G^4MPΡM xVO{Z"s1%1b2e0|aĵt3nq§2G_ 3~Ҋᦗy^zu9v.3SMY L5;i7^ƯpƳ8y'q ^q4"qeI LD&Wbb>`1$щW\VB .l ؉1{>/K·p7p'xQh&S=bTb4X؈؄nb+ ۃc/>Ob?n88p 4fP)i+MŽt%t|D|%AU~I3؆o?8M~2 @NrTy Q|@THETL:M既ܔ_IC̕saAƣ;0H`5nyQ-%4bp:g:pWq%~ƧdSr2iQȺ|LMavh)KnF(z 8f7v6kZL KB?L^0 8U:‘)detcO{jm:F+Zpo2بԗRQL%2ezM-Ml =|GH?4o) .CZցT])\ fMZ&IO#i{ٛb?|YL}J\Wt)u•<;0+N`.,;3 p8!C!p8}7tKt4}{qBLj'qI,$Z5&I`$J)!p8N@YƵ贌2.Bd\˸='"tAE"4Z/%yU xن{'啅p8WlH%8_Y!䈫6ߴ!ѯa%e:#ݐW- Fڐ߶!^wt}+I =Y#nC"DaS{SG/^]xLXcboxo+k2Pi+;/n ۭɨaDoWPL7\w?? Y}˘YՅWXY*5.;y1n;n }nF7a;N}l41%.O~$nFwN[Nu ֖f:Çs1l[\Z\۩ |y }-J j!Mb%',(mm1> q. _A ?~yr s^cǘԚCNgSǶɕKŃRΦf6pgo˿ubrG'Fl)WxĶ0+ LQyk+3U+ry$`5aw(cђ"4az >/g_8r+^.j ?Dw..Q㟞~ SS[YΔLhA+Qt20ZUt$m=vD}brX-ȏƩ)?)+ˢXͲcеC8<]#o._<_:~i74}B\™E ޼PJP:jQSĽqthMq]7텞@Лe!S3M75P={:cSx%넦!XtA$Bc= e|8h;0vC;vB+g/^/\WFvAg =s]W I֞>ꁵ *>d&&;U㊪΁c0By2 Ch M0Y퍛w!ڄFa H2>nv6&CQuym9?nv4&pP3?,>lpNjΖ|c]FeצZY{j\7^SL  C^èHMQx Uha3҃h>^۷3c{2xczhKsY;羬]ݔ,>t1|w4K@p?P5OT3ӿqpgģGR|'O-V@ Y0S(4Z.ţϻe8 9o:|8@h/B/d2: ]?,X[1k'눹}k[4_fx$IQf>ұ1㶠XLP硯 d˃{wʾ}wX?|;NͿ_da!vB 2=jIq̽,˲˲,^6eycay?b7,6륀bM65Ji/ˉdCV#奪UTGmUU7^` Tjۙ;s3gF1zOׂ%R->{A -bע.DyFǫ{ F1EPlP8Bʪ &S[L QLrLR|Yt.7kGgO="&:kwgԔ(3Z>Zki9ئ"G98荎QpW@j$/4Hs5vivrN](IHy"lD"'l8V:#("teǸ4v63[|#};6 ^k?7CjCGwj{:%&? -VLi h2w MWr.׊oVӺ=3J]F ki>$o5WtW.ɔ6SK`-ZJg$bT]k<9H83"f!=( c$k$! `%oy"W'eaP=UM'~^[^ٺ}"/s#LrJC)sbY@w[krlvdVWC8q+D\;}<6εlnGeY`]VXSM FO@b X[j1es/&DaŘSyI޴`(")",ϳb}%%UKK$DȒ$B[wkfLUWH%GG|uYOcUMl'Nc5pu3-C8if2dz(i1KߛfvZiȿi7kٿOy&0zBk97 g~k(Ry;~䕗ޱ c:ydܲ_%c]z?L ZwyC{-NN$+" h^EsAP؏uS=< Uރh@ղ û+X" ?[ _KP ^RGx#6y];(q\|Zt뼊ܫاܹ $ހz:^UKw?n"o-|&T6ҁL @W 03!Q4MŘ (7 e714 cm8ڭc(y )Jxr-+Vq8AhH>@]|ZK, |K6 H*Z`(YձSĮ|sW`6۴Y)t(YI_V4Bo)T?UNUXO69XrSKWNON%Sex'#X$uGDXaWؓJP}f?% 웆&LR-]bV*w%*C};_ƜM=]oQW˔G6aoK:N[7ˈ6*Ro`4{/kXQ#&35{Y;κ2lvOvY"u]̈́^76|ڃh.}§!,vS9®hu oH<-]T]+uU(|[Cr|N_l)L.:iܠd|/s8$ΨhA$vMp us0anAu^qf"8)w+KBɯ2g^d?5F)Rq |^Ԗ2^z!ɠ֣j _F)*՞$[tΞޅEin1[<]1>G.v^6#7_fʓg9]3P]ݿCu endstream endobj 416 0 obj <> endobj 421 0 obj <>stream HVyxTW7KJҐμ$74,B:aay7LbJ{ǪjPz'ZKZfm?KҺWBxLүy{޽w;vƒز 7~ϏN>_ l*sȩ𴩫gC,ްyWבցc@UP}DGY@jgxؽ/6݀}d'NځD_ON?9ĖDw+/>z+07lݾ#ssJ9t~6gSZw9I0H]y1-YGsP}sYvFߴbe^६^ p_8S9M8א_$ -w8p ?1T(cOj hDLdr<,B, WFщW76Bn؅R݋V܆;-|wq?x8K3q|1 saa`3ыmn|+|{)|U܉8#Oi(4CS RX L#/ M'$~^@&UAI.W|lx䜖dÕ9މ}8n~X :Fhm>[=v[)j!vgr;zn%KoydnPk=8?|50|i >6ok?X= ƀ hzS'7(f?ujhND+*QZ6FkԦi-bmvv'vݥ<^ٹ̈,+c͢\-x@\#>z7#[M̌1 _T/_L܎ B:T"|FK]p7{X`%ŕ X*~҅G<>+"Cb wp7{]F3KMTz t_qbgv8sF;dds"j-a %D0JG{嚸&q5$d'z땰$F{?/lL)쮠L!јt6op$H+ ֊qSq!c1jt![[ettC6JfoV'₽I%,mJWZ[ۖeeH❖Sw ťIb$;(~k}H(Xyfّt HtA.1=Šmeu6d?(] ?lܼ4BG%KR.PBZNvbP_mYW"#!w8sQ ؅0E$e$T^b*N^c$s&.q]-Tlf:8ٺޠiMȎD{P|PY^GVë,ϔeC"8I+K¶HBpЂ̌Vt}AYnFǣ+s+ftiiXR"$KfCb5yxT͙p4i% OFƧxƧdS4lM6[n0gS3UN4e0 ILY4oyBW蛇SKr?H8yddިbY9M^Q\Wx?zK̎]z0x`m@cpyAqL-BKRRJSwjZO"Em#V]%*fs=|H]gziqMH"~pPDkC6W7dD CP/)\?3kbT cd8hf_bD)aAwG'gf(>{mRBqVV0Cq9C9kFha&m&!8N7xN3+wOe=Av= L&<$>| /';2L AEgaiEa>3 _~|gH.f;Rp)[$'^rJk/˰i8jǖKN(| IE 3J ŢZųMsߧ_sҗMDz-JQ!$|1jl pC*#p*g2F$!Dcsz@[@{n=7B L' 8vNqu}QEhn=".B=."%'UGٵ_vatqd)l9.$3rgq}Hܱ߅tW\H#LϹG ~ȅD?;s_s!#HЏ/91 blX]ldV^9߇|?1[Y܅BdAQn0JngN){y{/o^>q2VÙ#[x`7lו0~IGO) U Y>3lEMvۊo_|Hz5S$D㰭K5x;5Ȭ_c2 Ҩ QIx ^&ͺ[(PQ.L/*1Wz4.5'"鷼͉bVZGd<^{L,7.\ tZyqJ>%n. wnƍb#~R-s4& 2Uap^eAIU1IS1,|-h5؜(4.AD͖EA~d- g{e]gC2Ç;/Nl6qxơT#!DKRxg DWJKW^ ΂zUG%eȐ)&v6;0e;پmpz(\zH>1 I'QEETի3X%tC3U;ﲰFg/M߱%ˌO2 Ӱ/^N1aN7u97矯ri#cGEB \cN2 [~#afkd7">oz]7{eR6+LWdNF+ 8(|^Ut%LY7G^CV93 옻L5]H-Q! 9mr$uyEQ,_ I ?K7ի'+ټV_,1Z;Xod&ݯ4D5a*Pբ#)$QNQ[Q,<+:^e2{E@_V^Vti^dcSM@H}Yv,4ᏸIWћEbƦ3GIu}H i䴱]ԩJtLNR1NQoNCym2xZZ[ڮ4?gVy&Z:i _qi? %>Ԛj GG#."BH#kE~EdЛr6b/ 9hKCR "^]V*?/?+a k}Y_ź,o0ϜWowṇK|놽uTlfD=cCg\>V!IcTW} /VGb j9"P[,-nZ,sM6מhYYm&ֽvi՞\nɾ3>D͇Ro$ӽ=*bV"z6L,E{aBQu'#h>ɔ!qf%卷~tgONɅbY٘bЉ6>a߰x>lwSݭ{k׬`sb|]hq)2 RF0S"}>w,dN/={G?0>)u;?|)vw}kr~1SBɒ|Gn&|^]N)Ls.9gBWC.2X$=L.ZRÑ~8HsH"S+.Nag1)J^lYӲ3^M]g{{ؾ~I q  mB e<t&Mk ֱ! u&JK7u{M֍LML*X}\_4w=}'wFHw! b=Sf,A1d&q4>s3j+S=n>8;>6:mZ.>un7GFJvQpmEsY .[!M;!{Io%b2퀀7У, IJBYd"/-A g0CC[Z*?xz.v.QE2N eNiD#vMܨ~X> dhD;gg+Iޗ܇\I|>;#B7{w֥Gz;x8'.#2ؚ[@GXe2a&d?V.]+g&QꍒM-A,`K;#Hn./,#,gmL̈́\X1a vt" 2YRJf\^A0bm^*\FxTdy`.P}9+$^RfG$wxkrucYk\v1C,' RqsPg)2Չ0!RR͢YQLĉ xs@c?^m+՗.sC/jUeﵵLف֢~TB; eUW@iS`-a,~񼡤mmYD>P.f%Dش7rw9 YD ,_dJ4񼼄1Proz {)^N?tX'un7'b;Ý.kb`, ~p/Yn>Tk<ٮLlt`XĮ3Y H5e69\&S'SL0x ,0FeF=ٲqJ۲zlؚ \ 7,s2c o H\o<{WG.Z:a/ jHCH FU*W.+CPuo kaoti+Xˤ p /JK}w-ra!jm!fx@00W<4O C*{| Lݣ[BovL0pmp4vбfEh9&T`~IqB({gEʵy9R_)&׶^8]nowT+i*a+{)`lڵD-NEB~rp pX6`\Rb S[J4nZт V%ي 26a^V3Jt &yQͭHC]I?J&CegA՘O!H-9ϧ7z;H^~zA C<7uESV҄# Ut#a IͰ JmXBS@9?:SQ9L驉M4)|'4/<_șΰMO>?'#tYNJc/P*m&6ݱ9!j"vۘIx;0~:fF!s fSg\P ˨\aJ$(T<4hܘ?eXSĖ B6.(C9!%bCA]YZ`Tb$\Wo4x'D9FA%қ Ju;䪰䱱-B-RpI:ջEu;s_xORYVk8i"d*70&CTcPvQL ?jHm)ο>6mtݶݟT?: X: R+ac)3H)N<,1NVII8"/:zqj߭^ÃUWO߃s:YSZMAא@}(Ĥ3c0nLmf%`o̓S$eFӱCQÓoy}>4ϳÖ {]aO3g~x=q_hm.vsTir'HGZ›@Ckn%g` Ou o%XsRZ `m誁7?nmMSpS Ji=>Mx3/@W|ao(#"٥8 Dy ޕ 4$ ӎYW}:Q k f9{$*i kKR5R|jW5ƸHZwW/b5HΒ#dyv?yTQ<'t]D9'0)KIj41L>##0c&}|>Bb7l`3qEϒ'Dkk\wh~lhf/wwNxRTXn0_k̕Qk-_0ې#jz dBk)Fpp3vT>W{*;ί܎a|NgOv㰼݊::epM3̏c_Jn%s2B@ #vnÜ)0&lΗ~ x5b[@cD#]+^!;Lu1qwjxCC[Ye8k0VX k Sz4^2v B㓇os?1S8˽uIWY{{nPUǂlbo;Z;zhnջz%9 Gi[]=.o[.n:*J4ĝ` endstream endobj 414 0 obj [422 0 R] endobj 415 0 obj <>stream H\͊0{bDPۂa}]a!ڃoqta d&AY*MA8ApN!\F;5=D7V> ʴHS>8V:sWY!`f Y[_襱MPڦ~-BD2j8Fk E* 4~kG[.e$E$mɺ 1+fkį6 endstream endobj 422 0 obj <> endobj 423 0 obj <> endobj 424 0 obj <> endobj 425 0 obj <>stream H QAAH #} endstream endobj 426 0 obj <>stream HWKpH?drF o B cdv#K6.K 6EMZ9d/lzLRE8pت!T*rL*H{$a&T_u˗\!-c Gv~x[xBm.!mg_]/#4])~Gȶ{@8 .?1x+x{!Z_wBK'Q>Prճxxa/^Z/QFm0w%=MFD#l;:{< 䟊iK y~$c*B됑?wLT@T'Urge5( h.605#@4am˲, R0W,+.T>p<ӌ)4^8,AbeG[N1ԠA| Δ `Vΰ L,[&BtA f?.4]:QLyaS2SE, Z/ tC ;-]bdRP#Mhvw1pm"E1ɺP^L&Z6Y.a >mV]ҬBΦ1`f6d)xVDnn9IyqcG|!#7JK{@ƄF~ucfUl\; d0lG{8#Ǽe , zft<" ,NLCNR# `[2 )H 'ģQCoFuiQy@Y"ҧ tOvDh@$2>>611::c> 8 0w}->Q̛˧+|uvnaG`Ds$;Ȏd?ؤKpU%KG Gvx|b`a"ٸrg d?:T9Q|gy? JEH.NU>ţ*G )^B7UL=)yUUϒF=>L4E|0~1:ysNlХ22L1a|ڤQa(qؐ+3Ħ \R+Z =_5kLg6٧Fl 3kenoݚ];!gkxFe`l3rFPpΓGQM<PLbv2qUBiKBRRܡejoy{Q(Sn\K ۂV oF}RVܾN\Gֶ<\4X,+*5+n|q;cF6…3ӴSU)l`H tEیD,1[jKU-r6t;Ĝj(u9SFy5݂pK^zvLmTq LEe`-gI 16bIbi̤At"$2iɲK-l [Y\XbRT1 Kr鉘r VlH{ ؄kpScb0/˟(=sf ].98Z3s35'i0zO?];LUd,]BWAҪILȐfHOdu?Mg_Fn1qߠpcS76n{! o7it|weI^5a ۰"8u7J :ߠ|&gǨQ&vSS'Х!3:*s~C`*Zu %-|/&GžԟsܣՏ}WoOn$n5C.O3n7?E6؇WZLf@=<̥󜶳Kyٷ'./YXu Ir쪻BryH.X>stream H\݊@F}lhGD}0Q1"o>,p+bsx?**/6ݗΊ c(k;GK>>nv"傷uyN5,]"^㫈yW;B=B{{"ioŇrPtSoos٥/6Ib׸$is.x"w\$-=)GRҗJ! m> endobj 428 0 obj <> endobj 429 0 obj <> endobj 430 0 obj <>stream Hl % >E9 o endstream endobj 431 0 obj <>stream HWo?gYkг>8ޙ^vvaCX_ 3Yߠ&-iOZ>* YV4PRT)TU jofטZu~|s\eY}w\owo=}"v2og ˹Aƺ4x>xl?sRy9cs u<ƒn/,]=CZ8{ K e}ߏ jB539_򓬗{/~ {ؿGa"yjw:2$`L|\հvoK3z1?=!;jg!rXDNflկ.]ţ: bUlnNbb]fYnTP]4fyUsfXٹ g t8/q׋P<Ҏ.!%]W]*!}1mojAB]uGW<8R8 ; ,dm(*hH%Kٌ ySinvNPZ(0P u IǖN*=eCShe *b%g*Hd\f J]T|^P" Wk{A6+hvUrYLw|-ƣw `!nWd@utʩ:x¨ovj;V1ah^@˵5[q;nziY5_5U:DdQ4Ĩ#S5bM^J20rEI3mvU L5rvnʟo曌kڥFKBF5&$gJuCVT"БKgI>oJUEH*~.)[ה:ef0U:#G|$IHnG|$;NGr#مHHy4`6 u-zդ̄2q w ( C:3:E߳VZުvvB<(]3}Fp;jY/*׏;[Q2ՀlKj?Qq@ߍt˃G@gE;<ւEM5;< Ť"U~{ bL\j &Bu8jUc1\aR3K PkVAv=)aa AxVSHe%PNV]#E9gom{+y u SHѾ5crRRk`fvR%˓ ܁owxO;JI:ybUJҟ\)0E86Yv^+Sd)[pAGNG駮}֊J<`P{EF AmHEA*2JMXJ\$(^!q_疢BNH)EoJT0ўD\3Qd-q/8]nN~ol0f5|P!r,,.d6Ѭ^ܛx3LqLQ.c@C/w?gs8yey8$>$›5]tE[U|"u%Ɯbќ^`H4 Gm2xٽ+uy@͛ڝ++`DZG&NyH㇘VCA-!~"ͱ``I]ojbLzM[6ǚ&:KXK8DXƣHwpS*vrW*k叼瓏S1;h>Sio;FLs̆MZ`o2N!Ӵ)% U6u7G"=%hb-S90?t`3K7oeޜ~p+cSod~ÙnQ5/a-1#|KYOURVWؿ6#z.)˗HA._zRIQdrUl,ђHb׎ǐk#@AEAE&@ 4pE gp_sR/;(.sgΜ33lp4ZºPH Q~0p~95y[%,MnjΟ?7t03v90YL+4xؘ΂Gc1d/w@"VW8mz6}EQ pM3jk e'OXvB@*!))9t*20W]`s<!DYnl‰ԲI+_ZN_÷a; QT YEC.  MIA*Ф")3!'dpU۱?OB}[$~!evs]f|CeET6{k`F>|~s~%&nOoj g5xw}jdń) ;Z:&\[/EDU)On)* }XűߍONKRR dho\q~yۇܢZo˜Y ¤= E_zAQ18N |j]%RiE#Cm-W @Wn\." OɾlCv5 oUqw) ؍7QquY([ 5eX Xeũ(zKї(iƏA`-!N8MAH_vuu׾7Y&! >:ܬ/dt<յ[=wrq(*es؋cn,%+ Qb!;zێZ*{0WVrٙCN^'NO%Uf ǦgK94 3.ux2M2< !EASG9F'Iš͗E~T z9` -p'a:,6ZA!*b9W^_'H1Ͻ0)1}&3pu4t99s65ِ9r: $B'>F`Sw Nbs;'jdp3r48x|.OZ[G4}Mlڞ QzF .BNi\Z@P^aZŀW(B6f6p<>OCLX%iVhNEL*f&һXp) s;#с>ne5io8Q0vF7V|ݜ~.Jj'l#:{lz2 [:t(i /$EiGOO,ӡO=`J5y .CDPMx^DlX*/9rr`%q;W>^) e#MK4[Gp+`Ff -ċ(BN3  UȽOtS5TSuG-)0&fa"ءvTZoؗYmKH ip2 a?Q`iNjl .S,o=TfO і(S;4w#̠͠Dz>n-swYF pS"F;͑Q;p>sz-͐B\0TGdrhW!l F5Lk6ώf&ƴ byRK-"Xoנ[цZoc >8FD]xhs ;}t?q ̿K>i&_N\nn¿xvZJXkύ-hОRRZ?q]׋]km_6bc6/Glu4JTTyԪ$%U)JEiҴTUj)mP I&f};̽3̙ ʽ^kI; a,d_fǒ>+[ҎXHkhǜ`)Lvo,GC&숦,\W&ByUDdΔ@`V;MQ 0^ݥtׇsj`ICVLJA|6kN  9VQQ~%FÓZ!5GYdA)G k)b}zu[<%[95-W(pnOMް!cc}N;+-v_]Ԯ w? 7:M8NwIzKؙc^ͤ.=Nv XbnL GώIJNRV{%hmlayϋYф(Ia!$5mƑM NJ,j`)a1\h꟰f /;;on8X#3nc2/ '|$9ʐ#)Eۗ/?{Eg巢oE3?~inve|/ G~Ʊb;'v;@:H[U74Kbox~|W<_y>~rS>;sFQCrAa\p,PK$@2ùw̴4&Փbzyu Bi3u/O2ABOB)jQ VҢ"eO >؜N4[|qϦ M*q6`D`Tz͒Mad0,>z)D$Nt7˜gfFc{DII qq1=n=D#oK:Tn[71Z 7vqyl!?vE0r+rgƱg0|/l^}a\1k4¤ P“;$&9Vq?4۷vt'&}Ct OE{66CUoo*ߛHO`@]V:DHۿLZVa3-^3 mmX.e+9w;>hŸ [wϨ /n==S9Q}1g1`嵉=>rS9%oNEاGENЏۚz[&]2𧨗jyBe;ʵw8Ol4\MBᔌ+ , ^kAgDAy)%xvdsCwa>stream H\˪@>E/Y 0cyikTթ>M&ܟ&41?^Fb͑F|~=6}?M;o0_[M??叾is1)[vw-|+8 &>nhY1σ~,]niO.䞞qrwIȤATV,j-ő0$C1tKQRJދyA j-2 ‹XKB/)ihI3Er5Sz8zJ)P e2 RR-Tt[4KS.uIM+(\WNʽW@Ԗ3VF']%^jHxxKMG/5;!`fI5"&غl:ܟ`Kod/"jz57 endstream endobj 432 0 obj <> endobj 433 0 obj <> endobj 434 0 obj <> endobj 435 0 obj <>stream Hl$ 6qP ] endstream endobj 436 0 obj <>stream HWo?gfo^Mz .181fK J1C$mi.^y)V"ъ[U>GQ*vb.jE;sk󬎽<᝽{%y;gN/e!rܕA?fL]:3_a3p]<:Ϝ\/0;l/}v0|z{~E?^8_֧x|ļJ'|39WWX/w"/61/1g7NlMlÿKS_gl=lݯYFR8g$ӅdGͬ%DknFZ415bB,Qrم9S呐ݤ&潼)M d0oژ  4`eY $˛󖕔]`o|Fޔ>-#ZqXI5%J yS*vvVzP(0P!ΫiԬ%a:B+OJ.Fb)nj 2,H> /+) W;^6#h9b[DWk@3h5\0-E@uqTʩ*xh1D&e'V1ahN@uAjQ+ zIQr0:Bzc?-2l4F %eD + [m!ܢ玘%ܘ) Cf;F1vk2&CBF6%$gJhC*%f/jXV% 4c! ?GKIK5dːlxs*SGL٤eDV5aPFR?!?HHS b 'U/qV!%M/H%?IU/HK$kK k"%I IٵA*/e*әlH=_">Hv">1G2HnG|$w >.ca6d  z:Ք. -܉ 0!6VԨ#>RU֬FFl̓^]'v>8ͳm-16 zy+׏;[QLʴ:< .ԄEb"%&# m+`t-*"E׌94Yk$)M"(Eܽ3` iS9dRGP#AO6+l<~mjf{C19MzԊQPmjd)-wm`aA8VShnK>,bG(8gmm{*yyІ*Yǵ 2J)g1Sb\<)ȯJ 1m|{ڱ.WJw'FT6 xȕQ(raU2Ő*x .苏h#ڑ}֊Q]&e0݉"|6) f&t,5\^!q'_疢5 m8!Qcu0Q8FQr$ՠ't{r8%q_d~-aޯ]9[ xV259*'pP_L9D,4q&#!pT7 } [ܝ39x198tx:I6 W&SdM6 30C!0G_/Bq"/Bg9/B=.:#9 _\;.5Z\t!q~pxs _3rV\v!x݅D_>e CtF.$[.$XY&B"ąD){9k.$]HwLxυDx߅D@UU*ff^z:˕p|_+w-g5Ɔ`mU;<ճk;z+WV_(wSk_)|c'֋/f8 pp?'aΎn۶5Ěysm%{#9¯ECl ״P_!Ş鞗zچ{^_=x&r3y {߿Hrs?9NiaVv=dQ|o1<~ n1Mbۣ@[ӯut@_oU֖H_oOR_Ϝ=;]p믟I'W99 blIy9<(g, 6C&dѴ΁tz ă7~}>|7bu_(Ch3^m\eO|K23lb'NbǷعq$v.+%݅A+UTr THPhUAB V *$D> N ;ės}(%aO \ L,+9x |vU<9AgM,\*, [,e.š\PֽG?}O,Rwܨ7uؚXDel &@3x`,Y8ǟx__7+C.^{Eu[P\,Д2]n(Zay(ÃO>dlf ;1nY${G47^!7."ix5r\$n)%P[n2 xfsG7:`T_W{wẲw^{3n_˽qCuNeNCZ „:F].=6gKɰm6e)[RYmӢ,Aԃ Zc6 20 0` TBsH=XTeN=V飿x>yRYl c_v9-_ r1PUb&'YY6|a@uE|K.YIF`̒p)7J]>1!lDK3T_P8C xA+3ssjg]:3V^qzVwtY!ƾTqaaee>s(u21"dT189(aVރY?dL2pn'(ʢ BP2B}d&diځX7p$&cX6E#K!;HJ1`53Y՚ǬVC/)@:2 Ywx~`w^[R2ى )j/U3;o6+j.5?1tcC sZweN 5f1`:Qb >s#qHZ0~wQ= ^XZ?ܛsl.C=o8 ^h!kNiɫ >[ʫ[#}di!b5[|nebZ{u_"4$`IH=PLk;R4֣gbqW&&D 9΍[7wn; iGԯ,0@>D%8l>)^â 㑦u7 Y0k'Oj9+.,~1lwn, pɻbd1~lBpp\O'l⑌qT9y0sQSBEgwHinK||:LiU=%',ڌ9R8paEK Y+XoC\5|Z`x45҉`g%BЗ/7s}|A\b.z(BM9)DjGG`+қR*a3$޺Jff՞tݱsJ 0-5UIiiщ5=ߕ24*^fܑLic@ fM3X< *Ծ!yƘFތ~RONv+JZzaWzʽ[ '6ao^jjL6 0Nىf?$6CCBGN-_2jӼ"Ĭ,<$Hs ;ʠY0s!ԧe;|pXuCغ* ėPT %4=(GkLa;Y{vڸ"Nl2^R~c\x+LDsu ub4Gp3wY a/ Y-p:  (tq35 Ba{dĸOmlL^Sڏ!ƭ[-g}[uˢ,]jj`C;!?U&?5r 7&Ji 'Me7Oab~UARBzqp,5HKs$Wr! mMڝܻ-CZkGD5g-3ѤNJ+4&1Ϧ6*U:3>Q徫BVծjq6wyjxզz.ٖ ]`Crj9ppC{;HvHvH3Hj=182_^^ aZKA1l8xQTH;w페 믧]~j(zx >ERfFwF,6v"nI QCy6y/qBN;8ss8Nȍ @HX@]ۭ[EM+TKu+.) Mcj%:vnǴ Fƺb9l|^Wq)سŠ惒ո}{YgVb{ l5XA5 4"Wjx%t\9mxc]]thDL*.4l f\֏aR)nT5Z9dH&Ѷh UWye>i:k]WaO[>þf6\n%8%)ΕY=WLb[q3K`v$jYAKϔ#fXbcd2,:ֻ ٮffIr 2$ӰlȜ'uP%UUJCw򿲯Q=*3=T,K) Ch#/USqJSa Yjj˦ $B=uסGFB$glӷYTIEVdM|ih 3v GGd,d Ѻ4:̫6C~H7[陻tip{1:<v Ya erh8FB+ʪ0h}DŽ1l/=1m#.鐅FFFR{vR;B{;:;=w>6:15'cVkm*ѵ?a+AV} ~SXAMDy,cHH\PeNceIyG:G,3p {b@ӋKyB=<rƾ>1ў>ܹ|zyxeut…@ɟL^1yNN#> 7: A7 42AeؙJcyYްF"[^4EcsB֤ԺuM-@;~^5г7O,'ǚ#{,~c1]v틒1 z((j;3Z@pV@aw|7Z:->:݊W+Gz"K~+Ե]s|o\m{ʿirbG =e88cֆ<0 UCEnJYUVVQKmnO_,K eN@>O)9y\]2 D`| *(Bz9uhYŮ>rh} Mm̒۶mf IZNOES%@/5K?:82t OܡڄkARWXA}I-jCǾ)6þL jn Ԝ90,~}Բ%`ap1 lsSR箙J%;1Rll+FWJɾdR; bqֈ%1'}F 0L޹{p̢2SFTZ-aƪ.\LFdj0KP|*2ͻl*`*؟2"eXňXH$Fb=髭yVnͺwr k }؄Zw/pʷX^{ЅG^ onhsog&y?6l.vo6E[x5W )з y;r-Lq@Lm`hע-_fmގPn>V<mAF2!{jf۩q9GitUYFrp#,ɷ|2M~Jػ*>1v?ǺAzVMj I'gu\Ajg..OE:+XQ{; *Jn?sO἟y]aO6=EW_jT LS]TÙ?Kܪ<q' c @R,x6yTiҰkN*D_-DmsFo& oe?b&LGHDB"Z˄U,ta]WzϱDX؈m2w]bm9gLΗNMQf,}`h0V b0JLggsn2k {D4tYT2d'uSΓ^( Rhqhi6JȷA4Ipr8hz0IGI֌N4iRYS1P{P>RS?sÝ(tbT;Y,GܣtFoR$-J/Tܝ2*k]djzLUOGMȅXǘQzQZMU_6Ys]bFKs1|/'T9QvUeJ5eJ& 0u> endstream endobj 10 0 obj <> endobj 22 0 obj <> endobj 23 0 obj <> endobj 8 0 obj <>stream HtWɮWfeVv5\|!$@?X" Z8"f#AuGOwU.Y.ˏn~r??.|n󥜥Σmv]+z/,nf2~aՏ(G0\yzx׾;j`8ެ^LWM/o"tRY%lx\N3ӏyNc|m!ظFwYq8ktq26Ά8 X6,~yWAD3`Esz`+qV]ï^Ok>>: dPrVW|~ ꁕ\ \!3}>akuN t*jgxB$'!Uẅ́V6<0s oܠ-&ao_UXa4-0ʝ7o3O(fMpQ&VzE, }5ldu0s΢˯ǧ/~=R*nBKU D>4 .S@Pqd1E=2T J$`L^Tn*ũgị+K.;D;%iJ-OzCp} <`h[B%3lhDYF9.+!j{ W!d˨V7;^=cޫh5*ҳszE"D 3@BD=kAO.kxkk4T,EbJےԞpzFz8+i-a(IRPL@I@`¥EÜ)$!ĻV*JEQʹ!"ئuQ!j@>….ID\) [DHץɅ &–U\;az Ts1"D`Qd0 j{?MEKLz A}>ڎy7v7 3Q3N2;HTs dyd5vHHY@޿,1z&dWr.ʀ2<.2q)'et¾TV]֜UNɰ  eà 0UC0ߌ%$gW3QЍ}3Ch$i`Ri) [Nnb&Iڣ*VYySj ]KI[ϱa0B,gδxly(>ek\Wp6}wUT|)y`BI{kZ40lWK$ )'J<~U_ȈJPH@l♕Hԑ@A AH )3AsK6KVGwji0/pa["s0 .vҿ#̍5C iDĻ'T&?\(Y,^N.B0` F^Ku HPIªσYo˱ {&oK<`k /fQ_Ьt|U;YS2kƖBOA`#}4\N⏰R) 01ٳGGX&PzQNNNC61Qj#q:*7gZ q!m4u]7;]QPT )DI3pSc7p j SP=j䟭zb(đc@~8\GC}x1p(S!6&OZ]q(VU|h^9~@̶ ӫA|)4eD^7僻^o,'81yK2{N<jb.Tب X>_˂B^Hܧ'J^+RȦ _9 &C 06ԅGM&x!eyY-]w5B[c$%OCGqd6i'K(&JxH ;/xA'8(CyGKp;Qm 9[OY>7y= t&,7\py>`K-㴛y mYѨP5Loo3Xrh{$p4P#ClF!܅J}H+Q"<9 M\W`P0@\HFuhK*+ Ȯue+\T^qQ_B1XBqMezQDSԚkkGo&5b%u=(_s8z]$/Ѵ+'5]yV9e!Gj/TRDRc%OlSC  Fu,[@?;SBkk C߿~9~?YqYZ[VFGhn"BYNɿ~i>k3N7iPA .?GLcD9D=RQ;I:6k^QFg8T\kN-/I-ȶ7S9 JD7 E;t(q5 lq{X>X<׺*\oti.2?49 y!k7~TVpo5 ק$K09 977 UIڍ 4۞O 1֦x~9Pv-E+*E3Zl^3mM&Gp?AUixmv;rMo\/kpQ;r|%H6)51NJd|"a6(plO@J1^w}#fŋ7㧄^DZАAlc}v}Mj(g*_R⌿fb"3z3lߨXtAI5. P%DQz glRHR=>%in!5r(=unQgDq׶ |GB1C &a8$^qJ5e$ՙo)>(7-*jz2{[SB lc^Ar͒juN ha(yNʞhÈԌFDa$i='B(OF*lS̶t98C=Bų0Lz?d}t@ &hPY[q88L^n$bDz5xz k&,>$$.Bp4<Y4OM&ko(l,M]9Ӝ)^>Υ]~u\O: &&P]*C e4GFIFղqD,#)ya#H25PB22s>f4eF8]}OWUWP%mi/Yt"!Bў&80m~0MWJ"͢NdHjf`A&ъ ShyUG`̇R|9L,Ko56~HF k>8Y^E!:ƨܳ&}ZTO\Y0VgXWuv z!BТrxe5I!u8٦e}մPն(=،VC!fi1BLRtdIK}g2-Db:j ;K=hdZ`w̹M%;fKfWUD;`L8wZ&6$ 6ctG/(JP7koQ !ZY>8) !OBei@%sٱL!Nj"-dց4]HH :& )9LFrqþ˳q-f6t&*^wQSM`+DY@R>xlY$`(V{m2od}J.Ϥrz-k/eQ+lj)Z5QHX-+SR`kc4@rV]^TYh"/WXp"!:mki1Jbf aZ,̠1{Xm h^ :3$T0$mRu47ԆC۶6lGl}cbGFE{ rˁHB-92?VYP"-.KB 'ddRaiK ID2#}:jgO$u 9EsǯeK7.D9l|2˥՘$ U;%Lu]c&<'Q%JY}#3ԪCA*h`;HxKm1| b?J !Gқ @ٞ7!2*,~$,hPNtuBӨOOSѴ S`Ϣ5r71#GwXI?^V6Ѵ\qFzm8'(]hBA]AݮʫSkW%id33IhG<(PMi‘L2:CNZpJ2:,ݦ;.C|lЯǮY< 8FI Σ)$[@K^.Ms:$@b# *I>@6>4)4f:r-BΒ'{2Fѧi3=*0ېӺcgԦg5F4&u%"KX~txΩMq "TuՖ6A"m>Ad <6 /XFѓ&n0U/?]r9-} npn~nR`O7ϱ乔uCyGKAН 'z F/3??XC'D7OF1fpfw{c+lZ.8ݲsߩbNgVpzsJrʟae#J|^YIV̊Zdh\:{.QVhLs߬P/ߛ pBncrܬ! 2|a Ebc+%s~Y0Vڬt8UYyrhYWړ~ilQMv*m0b%ҘW/uTIצ8x> `k6YqAGVJ+;Amf{*,]`ئɍ\+0ǰy.Bp8ۜ:6IlvKNt궴ݿ7{/e ACN_'B`אg9 ;FrsT"J7dH빇3U?0@@:B+@?}_ϸ^_O\KOÅa $⪦F(I÷Zِ0d=subλy߹QB'^UJ¹#Ba;?pЁOGbD^]Ks~kP"}f^ޟbxZ'ThI ڙҠD1YEگ \9kGnOJȳ7aoC\0P|F! t 8 + 3f t 7Nz8'yOn9cRHwsL^H0Kg]c q>0Ra+}jƝp9S9i6 <~./"Ab2cńj F=1z}D;m> Ţ-ĐNF4e,%{0,sO)dFBv^&]HTU|y\΀>.y '"T>alaAn3PM>n ڝ^qЧ?QdR-Кq}{M]ϻnz|~xaƹ_?=~y}Ϗ<=o>?>};/vh-z)j+,Jf`BH5)ehYekWBxX1L+d-[`fNUD\1.VO54Mv3 $U"ӫFX~U$ rt/( >NĮOjQY anf8 A~V8lJחpXV&  ߠDc+Z`NCWM0Ḱ_RC8EA7B$Xd\TِԘHq`Cܠ^T| 3UMϋ^k-{O>X"BZ/$ĕ mTQw $Xjd窵 P+1'Vq(fI'\B=[Ơ~!/cf816bzT$ .c㖯,5ə/'M&MVgn(,D@_ق!aπy[ao;ס䖙]< B#hjA+4x*&&)X rs{P]݋+<DҿK9S<{9SN_?ɍJIF,Uqoo_Y(r 9ǻ/+f̚oȇ,̂Y@>*&έ&*ߠ-Qm+ˠmcݦo{,޲Ё<*zB" 9$yV{S3;NEcV[ekbus 1#~o7fs]{?lӟeae\ۧ&l0M0&> /Ll76(?WxhBo?Bӊ+ ?hxM\91~Ԅl??~j3¾#\͟)u  G$oK7ϟ뺉=9_ 4%4^t~0BV€C0 X~,"s@5Y4lD=0rVАK5 -3\`"a\c/c1F= -Za7 vA;օEua`uC.!imN0w1Ǝ:+Zw1GaGq$j5xIGf%U*ʐȒFlυ-)dߡKZ{|8P[%CĀ)JޜYa†ԉ@$>z&3 "y~ed NUJBuY6@6ұnr2q`frmK"Oޜ JRs e@ow;N)eޏYhѩU*7x{H5E$yYG?dn܈Whnř d6NN?rj Ejq0'Rd ΩB[! 96XN d^KƝ;6^k\ךgvճf9#l?{rxٛwye∛/~7\g?"HBHȯ}~3AhÇdz=}YO?/w;:}O_d4@]ӟ_﫞BU>ܹ5{2zg{Z/u,dph {cKr>OyG㯚- ;^IJTf* ~F痳fjj{A֛feh.?bmǼu nHz8Qn@3^]]U, wmx]~/>WS^W]߉e$*f[Ƥ }|#Y#]ν.kkk 1u>m7=x sWk^ޙ]9lZ7hz6!sTvʍ>3&f")%_>EE.8ͷR͕p+"'%{g%&;b4$F2 әl&1𺫥K4 }vL!Gt*LG/^_^gTO 5۹pMq]h!>з{fs|.gxEe|ZMGc:ZڍT`{:Slfe%hgrwj^mv]v{P>8Z% Vt#}ϛ~EHԐG \sq;X/VK;r]7_!zc{#Q2[Z-37@+U72kYjZ0)찻>]$FQO^B$R<{N0I{ 9,{X,ABit C@=rnډ-_E`=p$.xİTA&# o&} srT) $AVSj,E<EX#韥E#=QS̷Xh| > rC(ϕ/@Fvr6J-.#AJzɀ,TD6Ee[8Htd'>=0p3eBWwlH6eKMq?_b!_Uy]lbS)|VCLWhpiSAk϶qT+*&Wreu~slc&X)2,/"5KkNL %HhRRa=q7ʶqF6X%ZvT q` ~lLa  = fFWp\zCkdi4(dmUE}GdAz&͠NntiÇA=F Tb]z&ţsRQ@mINyā }I#\Б"GŖ*bTƐ D]h,ҡ=Aؙ3LN+jdR\gd|w8Y liSMu"ej|/M݌(XEFvTL_[3&}w/دs裙[7$>! 5ExpS#&TD"&QG9 #}kpSj޴j8ʸpSx!!ܝtTekpWwxa}n!?o*zMdD3}i]o `N4߇:o\Yv2Z58kHc˭殲ʬئ֠lS1Xhc _0hpgp[e LLq֠_|Ce_.=MѠ{Y4Xe"^0x0B+j7gxiTza pˊnGZ&KJ]/`nm F ]ƀ~0RŊnRz?Vl#_P]}㹤/&vۯMU.qb,,v_<ͨ(-; |"v40yR8[++%5ƣ+k84gȜ37Wj|eT z/f3))3Np ;U .|[Mh{z4uC@^p0GH2kn֙9 <״4a*q"[P=YeT+EZ1lYQk`7UV*Q J:iaw!q6:wL)<&#X?dG m.8!Ih"[΍.fE|8d;AN"6.Nd_!p`7<]~5׊D{Gj+%_3!r[j׆dο)D+#!cpƒ}X2\6 6l/diν]x݈NЖy[Hg%r^ٔ;d XXXU-H2:1ٗ-ԙ9͜JdT* ٦Ucޗ}lQ9= BճxR0mR2#h* 5iO&Ԭc6|8Yr&8|^>'z*86j 62*Z9M5IF;CŻ0dka>rdWQ- Z n|(ꉎQ,0 -U9E.~~T~CHڏph_zm[55v?!Oh_#+YjFZH~]ƮV\g}J .+S[Q`Qva~hԭэ7.Ȱ!g)eb%{ }^0eFs[8YO @5oٮYz+J> =CSA Dup`Yf:iS2_0@.HĊQ Fv.Q_)%ڒęJTuK)ؐa:kTTdx(ՅUkc>pNBr64M/3:Mrբj ;()b⚭#.OY]r,=]X q37O{ '&: vٚL,r+VPS(c q&#pPbAT=Vyp lSіŎj(QkF}Dsk֠ 16]E ĞlЃhwdxٟU n~|:m+3I4q;C"HqMkdY.B}q5@R!ŁAYۯ`먿KfiU=3Uy9*rEa'xy_W>2'<W݀# G"5+JaQWҎ ;`##݁.~.WmQsgWFƐFjYZ tQVDbQ hQL 9#$_3^u=z{9E<\F Jr0H6PɊb1C:Foh$5t=!]NOCtU|[*k7*MFO!·Q+]x z~]x&Z?:~b;@4XͿ'MߚiҴ嚦Ϥi i:1foh[ 0juD+k׀4GDήَPM)|G3h9ؕc*5=GGzm g?E sEMkX`EE>ѨHP0B$LW=J4BaPJk&h,n(VH1D͢b!™-Ilk"j狯1YfxFb^z"TgQx(^2n3DU[Y[3d$\!卷t]MMC][ÛY#3#$%V%~$ PxSΈEIU-{ eN6L:Ӎ%XyߘO>_ji8pD-V %D(A|k3 -F" IGA aQ^k If7,\um"E4L%Lep<8ϕAwP2EzHZ‚a7{VR>=z {؇woCoQ o.-WLTI]uJg(Ѐnj1nvcDwծp,| 7ݔ1>E}r2c>Y>>z~gRoYjb˨&-@e0 x ȡ唩2cYDSף"wTV끗Rl&%6Vfb>6uZRJGpix~iĒ6H އ>wSGxukUߺ#޴7SJ_K@DD7O7m}F)soylyq->b1׏{#X"}DOBe@XFD O endstream endobj 9 0 obj <> endobj 18 0 obj <>>>/Subtype/Form>>stream 0 0 0 0.08 k /GS0 gs 193.865 -5.365 -197.255 785.455 re f endstream endobj 19 0 obj <>/XObject<>>>/Subtype/Form>>stream q 194.002 0 -193.002 780.09 re W n q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS0 gs 0 TL/Fm0 Do Q q 0 Tc 0 Tw 0 Ts 100 Tz 0 Tr /GS1 gs 0 TL/Fm1 Do Q Q endstream endobj 438 0 obj <> endobj 439 0 obj <>>>/Subtype/Form>>stream 0 0 0 0 k /GS0 gs q 1 0 0 1 65.7763 -161.1719 cm 0 0 m -2.825 2.744 l 580.704 589.983 l 583.51 587.197 l h f Q q 1 0 0 1 53.0957 -148.5283 cm 0 0 m -2.804 2.702 l 580.704 589.921 l 583.488 587.154 l h f Q q 1 0 0 1 40.3711 -135.9687 cm 0 0 m -2.741 2.786 l 580.77 589.94 l 583.573 587.217 l h f Q q 1 0 0 1 27.6689 -123.3682 cm 0 0 m -2.761 2.765 l 580.747 589.984 l 583.553 587.198 l h f Q q 1 0 0 1 15.0307 -110.7256 cm 0 0 m -2.804 2.701 l 580.726 589.964 l 583.508 587.176 l h f Q q 1 0 0 1 2.2861 -98.1445 cm 0 0 m -2.762 2.765 l 580.79 590.003 l 583.552 587.217 l h f Q q 1 0 0 1 -10.3741 -85.5654 cm 0 0 m -2.783 2.765 l 580.747 590.005 l 583.531 587.219 l h f Q q 1 0 0 1 -23.0762 -72.9424 cm 0 0 m -2.762 2.742 l 580.747 589.983 l 583.55 587.217 l h f Q q 1 0 0 1 -35.7574 -60.3418 cm 0 0 m -2.783 2.765 l 580.747 590.005 l 583.531 587.219 l h f Q q 1 0 0 1 -48.4175 -47.7412 cm 0 0 m -2.783 2.743 l 580.705 589.983 l 583.51 587.198 l h f Q q 1 0 0 1 -61.1197 -35.1406 cm 0 0 m -2.761 2.745 l 580.748 589.984 l 583.529 587.239 l h f Q q 1 0 0 1 -73.8008 -22.5176 cm 0 0 m -2.783 2.742 l 580.726 589.983 l 583.51 587.197 l h f Q q 1 0 0 1 -86.4395 -9.876 cm 0 0 m -2.804 2.724 l 580.684 589.942 l 583.487 587.157 l h f Q q 1 0 0 1 -99.1631 2.6836 cm 0 0 m -2.74 2.786 l 580.748 589.962 l 583.508 587.219 l h f Q q 1 0 0 1 -111.8653 15.2852 cm 0 0 m -2.762 2.764 l 580.726 589.983 l 583.529 587.197 l h f Q q 1 0 0 1 -124.5044 27.9287 cm 0 0 m -2.804 2.722 l 580.706 589.94 l 583.488 587.176 l h f Q q 1 0 0 1 -137.2276 40.5078 cm 0 0 m -2.74 2.786 l 580.726 590.005 l 583.53 587.219 l h f Q q 1 0 0 1 -149.9087 53.0869 cm 0 0 m -2.783 2.767 l 580.726 590.027 l 583.508 587.241 l h f Q q 1 0 0 1 -162.5479 65.7314 cm 0 0 m -2.803 2.724 l 580.706 589.983 l 583.51 587.239 l h f Q q 1 0 0 1 -175.271 78.3105 cm 0 0 m -2.74 2.786 l 580.727 590.027 l 583.509 587.241 l h f Q q 1 0 0 1 -187.9522 90.9111 cm 0 0 m -2.783 2.745 l 580.705 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -200.6124 103.5342 cm 0 0 m -2.804 2.745 l 580.706 589.983 l 583.447 587.24 l h f Q q 1 0 0 1 -213.3355 116.1348 cm 0 0 m -2.719 2.786 l 580.727 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -226.0166 128.7158 cm 0 0 m -2.762 2.786 l 580.727 590.003 l 583.53 587.217 l h f Q q 1 0 0 1 -238.7193 141.3584 cm 0 0 m -2.719 2.808 l 580.79 590.027 l 583.509 587.219 l h f Q q 1 0 0 1 -251.4004 153.9375 cm 0 0 m -2.804 2.788 l 580.727 590.005 l 583.509 587.219 l h f Q q 1 0 0 1 -264.0601 166.5186 cm 0 0 m -2.804 2.786 l 580.728 590.025 l 583.488 587.239 l h f Q q 1 0 0 1 -276.7837 179.1602 cm 0 0 m -2.74 2.809 l 580.79 590.027 l 583.53 587.22 l h f Q q 1 0 0 1 -289.4434 191.7422 cm 0 0 m -2.804 2.786 l 580.727 590.024 l 583.487 587.238 l h f Q q 1 0 0 1 -302.1035 204.3428 cm 0 0 m -2.804 2.786 l 580.706 590.005 l 583.488 587.217 l h f Q q 1 0 0 1 -314.8267 216.9648 cm 0 0 m -2.741 2.806 l 580.727 590.025 l 583.509 587.261 l h f Q q 1 0 0 1 -327.4868 229.5664 cm 0 0 m -2.804 2.786 l 580.706 590.002 l 583.488 587.238 l h f Q q 1 0 0 1 -340.147 242.1885 cm 0 0 m -2.825 2.743 l 580.705 589.983 l 583.445 587.239 l h f Q q 1 0 0 1 -352.8706 254.7891 cm 0 0 m -2.804 2.786 l 580.706 590.003 l 583.488 587.239 l h f Q q 1 0 0 1 -365.5513 267.3682 cm 0 0 m -2.783 2.786 l 580.726 590.005 l 583.509 587.261 l h f Q q 1 0 0 1 -378.2115 280.0127 cm 0 0 m -2.825 2.743 l 580.705 589.983 l 583.467 587.239 l h f Q q 1 0 0 1 -390.9351 292.5918 cm 0 0 m -2.783 2.808 l 580.728 590.005 l 583.531 587.26 l h f Q q 1 0 0 1 -403.5948 305.2148 cm 0 0 m -2.804 2.785 l 580.726 590.002 l 583.51 587.216 l h f Q q 1 0 0 1 -416.2559 317.8369 cm 0 0 m -2.823 2.786 l 580.706 589.962 l 583.468 587.239 l h f Q q 1 0 0 1 -428.9781 330.4375 cm 0 0 m -2.825 2.765 l 580.726 590.003 l 583.488 587.217 l h f Q q 1 0 0 1 -441.6592 343.0166 cm 0 0 m -2.804 2.786 l 580.726 589.984 l 583.51 587.219 l h f Q q 1 0 0 1 -454.3618 355.6182 cm 0 0 m -2.741 2.829 l 580.769 589.983 l 583.51 587.238 l h f Q q 1 0 0 1 -467.021 368.2402 cm 0 0 m -2.804 2.786 l 580.704 589.983 l 583.488 587.219 l h f Q q 1 0 0 1 -479.6826 380.8828 cm 0 0 m -2.845 2.723 l 580.707 589.942 l 583.51 587.219 l h f Q q 1 0 0 1 -492.4263 393.4639 cm 0 0 m -2.804 2.786 l 580.791 590.005 l 583.51 587.217 l h f Q endstream endobj 440 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream q 72.047 -167.342 m 69.222 -164.598 l 652.751 422.641 l 655.557 419.855 l h W n q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 404.6374512 -107.6104355 cm BX /Sh0 sh EX Q Q q 59.366 -154.698 m 56.562 -151.996 l 640.07 435.223 l 642.854 432.456 l h W n q 0 g /GS1 gs -84.491539 470.4542847 470.4542847 84.491539 391.9489441 -94.9675598 cm BX /Sh0 sh EX Q Q q 46.642 -142.139 m 43.901 -139.353 l 627.411 447.802 l 630.215 445.079 l h W n q 0 g /GS2 gs -84.4929352 470.4620667 470.4620667 84.4929352 379.3088379 -82.392952 cm BX /Sh0 sh EX Q Q q 33.939 -129.538 m 31.179 -126.773 l 614.686 460.446 l 617.493 457.66 l h W n q 0 g /GS3 gs -84.501152 470.5078125 470.5078125 84.501152 366.5837708 -69.7962036 cm BX /Sh0 sh EX Q Q q 21.301 -116.896 m 18.498 -114.194 l 602.027 473.068 l 604.81 470.28 l h W n q 0 g /GS4 gs -84.4984055 470.4925232 470.4925232 84.4984055 353.8954163 -57.163044 cm BX /Sh0 sh EX Q Q q 8.557 -104.314 m 5.795 -101.55 l 589.346 485.689 l 592.109 482.903 l h W n q 0 g /GS5 gs -84.5032425 470.5194702 470.5194702 84.5032425 341.2015991 -44.5727921 cm BX /Sh0 sh EX Q Q q -4.104 -91.735 m -6.886 -88.971 l 576.643 498.27 l 579.428 495.484 l h W n q 0 g /GS6 gs -84.5049362 470.5288696 470.5288696 84.5049362 328.5215759 -31.9971905 cm BX /Sh0 sh EX Q Q q -16.806 -79.112 m -19.567 -76.37 l 563.941 510.871 l 566.745 508.104 l h W n q 0 g /GS7 gs -84.5011673 470.5079041 470.5079041 84.5011673 315.8367004 -19.3715687 cm BX /Sh0 sh EX Q Q q -29.487 -66.512 m -32.27 -63.747 l 551.26 523.493 l 554.044 520.708 l h W n q 0 g /GS8 gs -84.5049362 470.5288696 470.5288696 84.5049362 303.1379089 -6.7738895 cm BX /Sh0 sh EX Q Q q -42.147 -53.911 m -44.929 -51.168 l 538.558 536.072 l 541.363 533.287 l h W n q 0 g /GS9 gs -84.5024719 470.5151367 470.5151367 84.5024719 290.4641113 5.8245244 cm BX /Sh0 sh EX Q Q q -54.849 -41.311 m -57.61 -38.565 l 525.898 548.673 l 528.68 545.929 l h W n q 0 g /GS10 gs -84.501152 470.5078125 470.5078125 84.501152 277.7851562 18.4294758 cm BX /Sh0 sh EX Q Q q -67.53 -28.687 m -70.313 -25.945 l 513.196 561.296 l 515.98 558.51 l h W n q 0 g /GS11 gs -84.5018082 470.5114746 470.5114746 84.5018082 265.0805664 31.0478077 cm BX /Sh0 sh EX Q Q q -80.169 -16.046 m -82.973 -13.322 l 500.515 573.896 l 503.318 571.111 l h W n q 0 g /GS12 gs -84.4959335 470.4787598 470.4787598 84.4959335 252.4152679 43.6852188 cm BX /Sh0 sh EX Q Q q -92.893 -3.486 m -95.633 -0.7 l 487.855 586.476 l 490.616 583.733 l h W n q 0 g /GS13 gs -84.4973679 470.4867249 470.4867249 84.4973679 239.743576 56.2540016 cm BX /Sh0 sh EX Q Q q -105.595 9.115 m -108.356 11.879 l 475.131 599.098 l 477.935 596.312 l h W n q 0 g /GS14 gs -84.5018082 470.5114746 470.5114746 84.5018082 227.037674 68.8541489 cm BX /Sh0 sh EX Q Q q -118.233 21.759 m -121.037 24.48 l 462.472 611.699 l 465.254 608.935 l h W n q 0 g /GS15 gs -84.4948959 470.4729614 470.4729614 84.4948959 214.3522186 81.4901123 cm BX /Sh0 sh EX Q Q q -130.957 34.338 m -133.697 37.124 l 449.769 624.343 l 452.573 621.557 l h W n q 0 g /GS16 gs -84.5055847 470.5324707 470.5324707 84.5055847 201.6894989 94.0800323 cm BX /Sh0 sh EX Q Q q -143.638 46.917 m -146.421 49.684 l 437.088 636.944 l 439.87 634.158 l h W n q 0 g /GS17 gs -84.509346 470.5534363 470.5534363 84.509346 188.9777069 106.6536789 cm BX /Sh0 sh EX Q Q q -156.277 59.562 m -159.081 62.285 l 424.429 649.545 l 427.232 646.8 l h W n q 0 g /GS18 gs -84.5024261 470.5148926 470.5148926 84.5024261 176.3252258 119.2956085 cm BX /Sh0 sh EX Q Q q -169.001 72.141 m -171.741 74.927 l 411.726 662.167 l 414.508 659.381 l h W n q 0 g /GS19 gs -84.5093384 470.5533752 470.5533752 84.5093384 163.6377258 131.881073 cm BX /Sh0 sh EX Q Q q -181.682 84.741 m -184.464 87.486 l 399.023 674.747 l 401.827 671.96 l h W n q 0 g /GS20 gs -84.5062256 470.5360413 470.5360413 84.5062256 150.9308014 144.4772797 cm BX /Sh0 sh EX Q Q q -194.341 97.364 m -197.146 100.109 l 386.364 687.348 l 389.105 684.604 l h W n q 0 g /GS21 gs -84.5024261 470.5148926 470.5148926 84.5024261 138.2322388 157.0929413 cm BX /Sh0 sh EX Q Q q -207.065 109.965 m -209.784 112.751 l 373.662 699.97 l 376.444 697.184 l h W n q 0 g /GS22 gs -84.5055618 470.5323486 470.5323486 84.5055618 125.5815582 169.7067261 cm BX /Sh0 sh EX Q Q q -219.746 122.546 m -222.508 125.332 l 360.981 712.549 l 363.785 709.763 l h W n q 0 g /GS23 gs -84.5051804 470.5302124 470.5302124 84.5051804 112.8903732 182.2862549 cm BX /Sh0 sh EX Q Q q -232.448 135.188 m -235.168 137.996 l 348.341 725.215 l 351.06 722.407 l h W n q 0 g /GS24 gs -84.5074081 470.5426636 470.5426636 84.5074081 100.1998596 194.9303436 cm BX /Sh0 sh EX Q Q q -245.129 147.768 m -247.933 150.556 l 335.597 737.772 l 338.379 734.986 l h W n q 0 g /GS25 gs -84.5055618 470.5323486 470.5323486 84.5055618 87.4762268 207.5018616 cm BX /Sh0 sh EX Q Q q -257.79 160.349 m -260.593 163.135 l 322.938 750.374 l 325.698 747.587 l h W n q 0 g /GS26 gs -84.508934 470.5511475 470.5511475 84.508934 74.8075562 220.0816803 cm BX /Sh0 sh EX Q Q q -270.513 172.99 m -273.253 175.799 l 310.276 763.018 l 313.017 760.21 l h W n q 0 g /GS27 gs -84.5074081 470.5426636 470.5426636 84.5074081 62.1355553 232.7328491 cm BX /Sh0 sh EX Q Q q -283.173 185.572 m -285.977 188.358 l 297.554 775.597 l 300.314 772.811 l h W n q 0 g /GS28 gs -84.5089417 470.551178 470.551178 84.5089417 49.4240303 245.3049622 cm BX /Sh0 sh EX Q Q q -295.833 198.173 m -298.637 200.959 l 284.874 788.178 l 287.655 785.39 l h W n q 0 g /GS29 gs -84.5061874 470.5358582 470.5358582 84.5061874 36.7625771 257.9055786 cm BX /Sh0 sh EX Q Q q -308.556 210.795 m -311.297 213.601 l 272.17 800.82 l 274.953 798.056 l h W n q 0 g /GS30 gs -84.5089493 470.551239 470.551239 84.5089493 24.0853195 270.5362854 cm BX /Sh0 sh EX Q Q q -321.216 223.396 m -324.02 226.183 l 259.49 813.399 l 262.271 810.635 l h W n q 0 g /GS31 gs -84.5058136 470.5337524 470.5337524 84.5058136 11.3808966 283.1292419 cm BX /Sh0 sh EX Q Q q -333.876 236.019 m -336.701 238.762 l 246.828 826.002 l 249.569 823.257 l h W n q 0 g /GS32 gs -84.5024643 470.5151062 470.5151062 84.5024643 -1.313791 295.7456055 cm BX /Sh0 sh EX Q Q q -346.6 248.619 m -349.403 251.405 l 234.106 838.623 l 236.888 835.858 l h W n q 0 g /GS33 gs -84.5058212 470.5338135 470.5338135 84.5058212 -14.0026321 308.3525391 cm BX /Sh0 sh EX Q Q q -359.281 261.198 m -362.064 263.984 l 221.445 851.204 l 224.229 848.459 l h W n q 0 g /GS34 gs -84.5055923 470.5325317 470.5325317 84.5055923 -26.6610661 320.9357605 cm BX /Sh0 sh EX Q Q q -371.941 273.843 m -374.766 276.586 l 208.764 863.826 l 211.526 861.082 l h W n q 0 g /GS35 gs -84.5024643 470.5151062 470.5151062 84.5024643 -39.3678665 333.5716248 cm BX /Sh0 sh EX Q Q q -384.665 286.422 m -387.447 289.229 l 196.063 876.427 l 198.867 873.682 l h W n q 0 g /GS36 gs -84.5055313 470.532196 470.532196 84.5055313 -52.0322342 346.1612549 cm BX /Sh0 sh EX Q Q q -397.324 299.045 m -400.128 301.831 l 183.402 889.047 l 186.186 886.262 l h W n q 0 g /GS37 gs -84.5052032 470.530365 470.530365 84.5052032 -64.7182617 358.7791748 cm BX /Sh0 sh EX Q Q q -409.985 311.667 m -412.809 314.453 l 170.721 901.629 l 173.483 898.906 l h W n q 0 g /GS38 gs -84.498642 470.4938354 470.4938354 84.498642 -77.4070053 371.3967896 cm BX /Sh0 sh EX Q Q q -422.708 324.268 m -425.533 327.032 l 158.018 914.271 l 160.781 911.485 l h W n q 0 g /GS39 gs -84.5052109 470.530426 470.530426 84.5052109 -90.1244431 383.9983521 cm BX /Sh0 sh EX Q Q q -435.388 336.847 m -438.192 339.633 l 145.337 926.831 l 148.122 924.066 l h W n q 0 g /GS40 gs -84.5018234 470.5115356 470.5115356 84.5018234 -102.7822647 396.581665 cm BX /Sh0 sh EX Q Q q -448.091 349.448 m -450.832 352.277 l 132.678 939.432 l 135.419 936.687 l h W n q 0 g /GS41 gs -84.5004883 470.5041199 470.5041199 84.5004883 -115.4490433 409.1888733 cm BX /Sh0 sh EX Q Q q -460.751 362.07 m -463.554 364.856 l 119.954 952.054 l 122.738 949.29 l h W n q 0 g /GS42 gs -84.5024872 470.5152283 470.5152283 84.5024872 -128.1547394 421.8031311 cm BX /Sh0 sh EX Q Q q -473.412 374.713 m -476.257 377.436 l 107.294 964.655 l 110.098 961.932 l h W n q 0 g /GS43 gs -84.4952469 470.4749146 470.4749146 84.4952469 -140.831131 434.4425659 cm BX /Sh0 sh EX Q Q q -486.156 387.294 m -488.96 390.08 l 94.635 977.299 l 97.354 974.511 l h W n q 0 g /GS44 gs -84.5035934 470.5214233 470.5214233 84.5035934 -153.5497284 447.0282288 cm BX /Sh0 sh EX Q Q endstream endobj 442 0 obj <> endobj 443 0 obj <> endobj 444 0 obj <> endobj 445 0 obj <> endobj 446 0 obj <> endobj 447 0 obj <> endobj 448 0 obj <> endobj 449 0 obj <> endobj 450 0 obj <> endobj 451 0 obj <> endobj 452 0 obj <> endobj 453 0 obj <> endobj 454 0 obj <> endobj 455 0 obj <> endobj 456 0 obj <> endobj 457 0 obj <> endobj 458 0 obj <> endobj 459 0 obj <> endobj 460 0 obj <> endobj 461 0 obj <> endobj 462 0 obj <> endobj 463 0 obj <> endobj 464 0 obj <> endobj 465 0 obj <> endobj 466 0 obj <> endobj 467 0 obj <> endobj 468 0 obj <> endobj 469 0 obj <> endobj 470 0 obj <> endobj 471 0 obj <> endobj 472 0 obj <> endobj 473 0 obj <> endobj 474 0 obj <> endobj 475 0 obj <> endobj 476 0 obj <> endobj 477 0 obj <> endobj 478 0 obj <> endobj 479 0 obj <> endobj 480 0 obj <> endobj 481 0 obj <> endobj 482 0 obj <> endobj 483 0 obj <> endobj 484 0 obj <> endobj 485 0 obj <> endobj 486 0 obj <> endobj 487 0 obj <> endobj 532 0 obj <> endobj 533 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024719 470.5151367 470.5151367 84.5024719 290.4641113 5.8245244 cm BX /Sh0 sh EX Q endstream endobj 534 0 obj <> endobj 531 0 obj <> endobj 535 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5049362 470.5288696 470.5288696 84.5049362 303.1379089 -6.7738895 cm BX /Sh0 sh EX Q endstream endobj 536 0 obj <> endobj 530 0 obj <> endobj 537 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5011673 470.5079041 470.5079041 84.5011673 315.8367004 -19.3715687 cm BX /Sh0 sh EX Q endstream endobj 538 0 obj <> endobj 529 0 obj <> endobj 539 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5049362 470.5288696 470.5288696 84.5049362 328.5215759 -31.9971905 cm BX /Sh0 sh EX Q endstream endobj 540 0 obj <> endobj 528 0 obj <> endobj 541 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5032425 470.5194702 470.5194702 84.5032425 341.2015991 -44.5727921 cm BX /Sh0 sh EX Q endstream endobj 542 0 obj <> endobj 527 0 obj <> endobj 543 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5035934 470.5214233 470.5214233 84.5035934 -153.5497284 447.0282288 cm BX /Sh0 sh EX Q endstream endobj 544 0 obj <> endobj 526 0 obj <> endobj 545 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4952469 470.4749146 470.4749146 84.4952469 -140.831131 434.4425659 cm BX /Sh0 sh EX Q endstream endobj 546 0 obj <> endobj 525 0 obj <> endobj 547 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 -128.1547394 421.8031311 cm BX /Sh0 sh EX Q endstream endobj 548 0 obj <> endobj 524 0 obj <> endobj 549 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5004883 470.5041199 470.5041199 84.5004883 -115.4490433 409.1888733 cm BX /Sh0 sh EX Q endstream endobj 550 0 obj <> endobj 523 0 obj <> endobj 551 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018234 470.5115356 470.5115356 84.5018234 -102.7822647 396.581665 cm BX /Sh0 sh EX Q endstream endobj 552 0 obj <> endobj 522 0 obj <> endobj 553 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4984055 470.4925232 470.4925232 84.4984055 353.8954163 -57.163044 cm BX /Sh0 sh EX Q endstream endobj 554 0 obj <> endobj 521 0 obj <> endobj 555 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5052109 470.530426 470.530426 84.5052109 -90.1244431 383.9983521 cm BX /Sh0 sh EX Q endstream endobj 556 0 obj <> endobj 520 0 obj <> endobj 557 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.498642 470.4938354 470.4938354 84.498642 -77.4070053 371.3967896 cm BX /Sh0 sh EX Q endstream endobj 558 0 obj <> endobj 519 0 obj <> endobj 559 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5052032 470.530365 470.530365 84.5052032 -64.7182617 358.7791748 cm BX /Sh0 sh EX Q endstream endobj 560 0 obj <> endobj 518 0 obj <> endobj 561 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055313 470.532196 470.532196 84.5055313 -52.0322342 346.1612549 cm BX /Sh0 sh EX Q endstream endobj 562 0 obj <> endobj 517 0 obj <> endobj 563 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024643 470.5151062 470.5151062 84.5024643 -39.3678665 333.5716248 cm BX /Sh0 sh EX Q endstream endobj 564 0 obj <> endobj 516 0 obj <> endobj 565 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055923 470.5325317 470.5325317 84.5055923 -26.6610661 320.9357605 cm BX /Sh0 sh EX Q endstream endobj 566 0 obj <> endobj 515 0 obj <> endobj 567 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5058212 470.5338135 470.5338135 84.5058212 -14.0026321 308.3525391 cm BX /Sh0 sh EX Q endstream endobj 568 0 obj <> endobj 514 0 obj <> endobj 569 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024643 470.5151062 470.5151062 84.5024643 -1.313791 295.7456055 cm BX /Sh0 sh EX Q endstream endobj 570 0 obj <> endobj 513 0 obj <> endobj 571 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5058136 470.5337524 470.5337524 84.5058136 11.3808966 283.1292419 cm BX /Sh0 sh EX Q endstream endobj 572 0 obj <> endobj 512 0 obj <> endobj 573 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5089493 470.551239 470.551239 84.5089493 24.0853195 270.5362854 cm BX /Sh0 sh EX Q endstream endobj 574 0 obj <> endobj 511 0 obj <> endobj 575 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.501152 470.5078125 470.5078125 84.501152 366.5837708 -69.7962036 cm BX /Sh0 sh EX Q endstream endobj 576 0 obj <> endobj 510 0 obj <> endobj 577 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5061874 470.5358582 470.5358582 84.5061874 36.7625771 257.9055786 cm BX /Sh0 sh EX Q endstream endobj 578 0 obj <> endobj 509 0 obj <> endobj 579 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5089417 470.551178 470.551178 84.5089417 49.4240303 245.3049622 cm BX /Sh0 sh EX Q endstream endobj 580 0 obj <> endobj 508 0 obj <> endobj 581 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5074081 470.5426636 470.5426636 84.5074081 62.1355553 232.7328491 cm BX /Sh0 sh EX Q endstream endobj 582 0 obj <> endobj 507 0 obj <> endobj 583 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.508934 470.5511475 470.5511475 84.508934 74.8075562 220.0816803 cm BX /Sh0 sh EX Q endstream endobj 584 0 obj <> endobj 506 0 obj <> endobj 585 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055618 470.5323486 470.5323486 84.5055618 87.4762268 207.5018616 cm BX /Sh0 sh EX Q endstream endobj 586 0 obj <> endobj 505 0 obj <> endobj 587 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5074081 470.5426636 470.5426636 84.5074081 100.1998596 194.9303436 cm BX /Sh0 sh EX Q endstream endobj 588 0 obj <> endobj 504 0 obj <> endobj 589 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5051804 470.5302124 470.5302124 84.5051804 112.8903732 182.2862549 cm BX /Sh0 sh EX Q endstream endobj 590 0 obj <> endobj 503 0 obj <> endobj 591 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055618 470.5323486 470.5323486 84.5055618 125.5815582 169.7067261 cm BX /Sh0 sh EX Q endstream endobj 592 0 obj <> endobj 502 0 obj <> endobj 593 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024261 470.5148926 470.5148926 84.5024261 138.2322388 157.0929413 cm BX /Sh0 sh EX Q endstream endobj 594 0 obj <> endobj 501 0 obj <> endobj 595 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5062256 470.5360413 470.5360413 84.5062256 150.9308014 144.4772797 cm BX /Sh0 sh EX Q endstream endobj 596 0 obj <> endobj 500 0 obj <> endobj 597 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4929352 470.4620667 470.4620667 84.4929352 379.3088379 -82.392952 cm BX /Sh0 sh EX Q endstream endobj 598 0 obj <> endobj 499 0 obj <> endobj 599 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5093384 470.5533752 470.5533752 84.5093384 163.6377258 131.881073 cm BX /Sh0 sh EX Q endstream endobj 600 0 obj <> endobj 498 0 obj <> endobj 601 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024261 470.5148926 470.5148926 84.5024261 176.3252258 119.2956085 cm BX /Sh0 sh EX Q endstream endobj 602 0 obj <> endobj 497 0 obj <> endobj 603 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.509346 470.5534363 470.5534363 84.509346 188.9777069 106.6536789 cm BX /Sh0 sh EX Q endstream endobj 604 0 obj <> endobj 496 0 obj <> endobj 605 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5055847 470.5324707 470.5324707 84.5055847 201.6894989 94.0800323 cm BX /Sh0 sh EX Q endstream endobj 606 0 obj <> endobj 495 0 obj <> endobj 607 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4948959 470.4729614 470.4729614 84.4948959 214.3522186 81.4901123 cm BX /Sh0 sh EX Q endstream endobj 608 0 obj <> endobj 494 0 obj <> endobj 609 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018082 470.5114746 470.5114746 84.5018082 227.037674 68.8541489 cm BX /Sh0 sh EX Q endstream endobj 610 0 obj <> endobj 493 0 obj <> endobj 611 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4973679 470.4867249 470.4867249 84.4973679 239.743576 56.2540016 cm BX /Sh0 sh EX Q endstream endobj 612 0 obj <> endobj 492 0 obj <> endobj 613 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.4959335 470.4787598 470.4787598 84.4959335 252.4152679 43.6852188 cm BX /Sh0 sh EX Q endstream endobj 614 0 obj <> endobj 491 0 obj <> endobj 615 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5018082 470.5114746 470.5114746 84.5018082 265.0805664 31.0478077 cm BX /Sh0 sh EX Q endstream endobj 616 0 obj <> endobj 490 0 obj <> endobj 617 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.501152 470.5078125 470.5078125 84.501152 277.7851562 18.4294758 cm BX /Sh0 sh EX Q endstream endobj 618 0 obj <> endobj 489 0 obj <> endobj 619 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.491539 470.4542847 470.4542847 84.491539 391.9489441 -94.9675598 cm BX /Sh0 sh EX Q endstream endobj 620 0 obj <> endobj 488 0 obj <> endobj 621 0 obj <>/Shading<>>>/Subtype/Form>>stream q 0 g /GS0 gs -84.5024872 470.5152283 470.5152283 84.5024872 404.6374512 -107.6104355 cm BX /Sh0 sh EX Q endstream endobj 622 0 obj <> endobj 441 0 obj <> endobj 437 0 obj <> endobj 17 0 obj <> endobj 623 0 obj <> endobj 624 0 obj <> endobj 625 0 obj <> endobj 15 0 obj <> endobj 626 0 obj <> endobj 627 0 obj <>stream HVyxTW7KJҐyI7!liY0,-}CbֽcUu(w"nS,RuEhܙү{{Ͻ9wĖwM[Wu!=VG{I-+ѬuA.]9w-_l4pY)2&Be᥌^]ˁ4E4f ^E*4ko4sn h2P-N1'QžT рfLtJ,",JFыW؁ Ƈa$Q{>/v|·qqxa gi.QBc"|X؄-،~ b |^| wq~Hh,KWR+Q$!D #/ 5+'~L*'\q<#o( Ix=r YlOGnpvLKI/PhIBbuz ;lKmWs"&X"? !mHHd8R/9;F"5Qp㲎OAmB3h HҴIBbu%=jgd1$f(d-d- Kxꤧ R3".^^/Ϭ)VS!I,J AR%gQTm0UfgSAXצ LG+$>侢EVeYŗop)-%n`Nf0M`l0Sd%Y+̔C*3Trr)YmJf*G3$3TӸw9†ht"H@6SV)eqʆ1`VYkBzɌOI/S4uOzƧdSr S)ib^L&-Esk2dꙪVMpS\"FP;te,T)5\Ts#S3L1;LGavqCDWkpTW?ܻy,}< { Mc4 ɆMIH0()ZEF3hcqT;WZ?(]M1߽wj7EP`Tl) *[AO & yz˾^btV8.'\Drgk6HZ+p|)y<-KXoZ'UqLOvF*3",ǝl ?M`Hߺ`OޥO )ihVm. ;t q& ^ .XpƁ{ㄎOII4E<ў]= LӞfhO#C`8K]@'.B'.BH]NI].B}>n.ʶ>vty"^:$s 9L_\yy%g!͸C_:{A^I:$K:$e4/_! nkqW䕤_!ѿC3 UJ* _V;ْY~b=܄߷L/R6J-fU0Ӟkroh6ח_],~Xs$ [I51azTŤO#LU4dT[5[fbx<v_].;ED7-vt,-~#vfrnaaؙ7T_| ӗno^z?Y41_e6V©60 ᠍4d*hltQPQiشFPI<g.ƧF"rDOceWZl{ƓϜ(VF"tWb'Kb 10q 7 +hxv+Z"5DEcnh}6m7ݘ< >7h壻[e6gε=֑*_LSc1,!v 5!icʀbm1Y*KsEՈps` ZU)\D|XaMô{dJ2GMV) rL5OX\V`h!C|/elQ ժ1RLŖi>{)qGbtv: ܯ C~`G(hdz+"əL#\Фٜ͡>*ev"g'#OysfhWi0r؋r7ډ}d2ԦM6v;\Pg^U F3^NdJ~7H̵Ͼ>2#!0_3 ?d>H5,Nm)KbUR"O2DnBG`/hށ0kN%\ 5I?4L1bX45gP#eqj~cHkiPt+ (EuMOZsÍӘrc/Yc5,{fE-F20q57031Vb0necac& g73c#f0ɣLM?P oi]:+$wCk/rZ2!d~P}PPȒymvaKN36vGm̛.Rp77Ƃd%v;IlEy8!vɉjSCcGՎvIW)b4bmF\O=1 D2%ڨ7'j[<̞6ɍհjD85Ԟ :RC^MhyL&JAmUh"˺ qRH\CXa$}!0kFXvB7׾>ԯCʜ:F:f5k}aY1Y%P=ksk2"';KËPFdy3 {$L4[lU.dl泴}~J3{Toh78j4L2:}S`43[lSnNdoM;e$3]0 endstream endobj 6 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$> endobj xref 0 629 0000000000 65535 f 0000000016 00000 n 0000000258 00000 n 0000067123 00000 n 0000000000 00000 f 0000067180 00000 n 0000283129 00000 n 0000067560 00000 n 0000217436 00000 n 0000236450 00000 n 0000217066 00000 n 0000122321 00000 n 0000167990 00000 n 0000168125 00000 n 0000169212 00000 n 0000277010 00000 n 0000168396 00000 n 0000276453 00000 n 0000236515 00000 n 0000236758 00000 n 0000067997 00000 n 0000087479 00000 n 0000217189 00000 n 0000217313 00000 n 0000168262 00000 n 0000168821 00000 n 0000087545 00000 n 0000087788 00000 n 0000092179 00000 n 0000101283 00000 n 0000101527 00000 n 0000105944 00000 n 0000167927 00000 n 0000167864 00000 n 0000142353 00000 n 0000115310 00000 n 0000142416 00000 n 0000142532 00000 n 0000142648 00000 n 0000142764 00000 n 0000142880 00000 n 0000142996 00000 n 0000143112 00000 n 0000143228 00000 n 0000143344 00000 n 0000143460 00000 n 0000143576 00000 n 0000143692 00000 n 0000143808 00000 n 0000143924 00000 n 0000144040 00000 n 0000144156 00000 n 0000144272 00000 n 0000144388 00000 n 0000144504 00000 n 0000144620 00000 n 0000144736 00000 n 0000144852 00000 n 0000144968 00000 n 0000145084 00000 n 0000145200 00000 n 0000145316 00000 n 0000145432 00000 n 0000145548 00000 n 0000145664 00000 n 0000145780 00000 n 0000145896 00000 n 0000146012 00000 n 0000146128 00000 n 0000146244 00000 n 0000146360 00000 n 0000146476 00000 n 0000146592 00000 n 0000146708 00000 n 0000146824 00000 n 0000146940 00000 n 0000147056 00000 n 0000147172 00000 n 0000147288 00000 n 0000147404 00000 n 0000147520 00000 n 0000115166 00000 n 0000142290 00000 n 0000142227 00000 n 0000115103 00000 n 0000116191 00000 n 0000116307 00000 n 0000116423 00000 n 0000116539 00000 n 0000116655 00000 n 0000116771 00000 n 0000116887 00000 n 0000117003 00000 n 0000117119 00000 n 0000117235 00000 n 0000117351 00000 n 0000117467 00000 n 0000117583 00000 n 0000117699 00000 n 0000117815 00000 n 0000117931 00000 n 0000118048 00000 n 0000118165 00000 n 0000118282 00000 n 0000118399 00000 n 0000118516 00000 n 0000118633 00000 n 0000118750 00000 n 0000118867 00000 n 0000118984 00000 n 0000119101 00000 n 0000119218 00000 n 0000119335 00000 n 0000119452 00000 n 0000119569 00000 n 0000119686 00000 n 0000119803 00000 n 0000119920 00000 n 0000120037 00000 n 0000120154 00000 n 0000120271 00000 n 0000120388 00000 n 0000120505 00000 n 0000120622 00000 n 0000120739 00000 n 0000120856 00000 n 0000120973 00000 n 0000121090 00000 n 0000121207 00000 n 0000121324 00000 n 0000115372 00000 n 0000115665 00000 n 0000116053 00000 n 0000115493 00000 n 0000115576 00000 n 0000116108 00000 n 0000141776 00000 n 0000141326 00000 n 0000140875 00000 n 0000140424 00000 n 0000139974 00000 n 0000139523 00000 n 0000139074 00000 n 0000138623 00000 n 0000138172 00000 n 0000137722 00000 n 0000137271 00000 n 0000136820 00000 n 0000136370 00000 n 0000135919 00000 n 0000135468 00000 n 0000135017 00000 n 0000134566 00000 n 0000134115 00000 n 0000133664 00000 n 0000133214 00000 n 0000132764 00000 n 0000132314 00000 n 0000131866 00000 n 0000131415 00000 n 0000130968 00000 n 0000130518 00000 n 0000130068 00000 n 0000129620 00000 n 0000129172 00000 n 0000128722 00000 n 0000128275 00000 n 0000127827 00000 n 0000127379 00000 n 0000126930 00000 n 0000126479 00000 n 0000126030 00000 n 0000125581 00000 n 0000125132 00000 n 0000124683 00000 n 0000124236 00000 n 0000123787 00000 n 0000123336 00000 n 0000122885 00000 n 0000122434 00000 n 0000121441 00000 n 0000121496 00000 n 0000121814 00000 n 0000121892 00000 n 0000122041 00000 n 0000122162 00000 n 0000122241 00000 n 0000122489 00000 n 0000122807 00000 n 0000122940 00000 n 0000123258 00000 n 0000123391 00000 n 0000123709 00000 n 0000123842 00000 n 0000124158 00000 n 0000124291 00000 n 0000124605 00000 n 0000124738 00000 n 0000125054 00000 n 0000125187 00000 n 0000125503 00000 n 0000125636 00000 n 0000125952 00000 n 0000126085 00000 n 0000126401 00000 n 0000126534 00000 n 0000126852 00000 n 0000126985 00000 n 0000127301 00000 n 0000127434 00000 n 0000127749 00000 n 0000127882 00000 n 0000128197 00000 n 0000128330 00000 n 0000128644 00000 n 0000128777 00000 n 0000129094 00000 n 0000129227 00000 n 0000129542 00000 n 0000129675 00000 n 0000129990 00000 n 0000130123 00000 n 0000130440 00000 n 0000130573 00000 n 0000130890 00000 n 0000131023 00000 n 0000131337 00000 n 0000131470 00000 n 0000131788 00000 n 0000131921 00000 n 0000132236 00000 n 0000132369 00000 n 0000132686 00000 n 0000132819 00000 n 0000133136 00000 n 0000133269 00000 n 0000133586 00000 n 0000133719 00000 n 0000134037 00000 n 0000134170 00000 n 0000134488 00000 n 0000134621 00000 n 0000134939 00000 n 0000135072 00000 n 0000135390 00000 n 0000135523 00000 n 0000135841 00000 n 0000135974 00000 n 0000136292 00000 n 0000136425 00000 n 0000136742 00000 n 0000136875 00000 n 0000137193 00000 n 0000137326 00000 n 0000137644 00000 n 0000137777 00000 n 0000138094 00000 n 0000138227 00000 n 0000138545 00000 n 0000138678 00000 n 0000138996 00000 n 0000139129 00000 n 0000139445 00000 n 0000139578 00000 n 0000139896 00000 n 0000140029 00000 n 0000140346 00000 n 0000140479 00000 n 0000140797 00000 n 0000140930 00000 n 0000141248 00000 n 0000141381 00000 n 0000141698 00000 n 0000141831 00000 n 0000142149 00000 n 0000167414 00000 n 0000166965 00000 n 0000166515 00000 n 0000166065 00000 n 0000165616 00000 n 0000165166 00000 n 0000164717 00000 n 0000164267 00000 n 0000163817 00000 n 0000163368 00000 n 0000162918 00000 n 0000162468 00000 n 0000162018 00000 n 0000161568 00000 n 0000161118 00000 n 0000160668 00000 n 0000160218 00000 n 0000159768 00000 n 0000159318 00000 n 0000158868 00000 n 0000158418 00000 n 0000157968 00000 n 0000157520 00000 n 0000157070 00000 n 0000156623 00000 n 0000156173 00000 n 0000155723 00000 n 0000155276 00000 n 0000154828 00000 n 0000154378 00000 n 0000153930 00000 n 0000153480 00000 n 0000153030 00000 n 0000152580 00000 n 0000152130 00000 n 0000151680 00000 n 0000151230 00000 n 0000150780 00000 n 0000150330 00000 n 0000149882 00000 n 0000149434 00000 n 0000148984 00000 n 0000148534 00000 n 0000148084 00000 n 0000147636 00000 n 0000147691 00000 n 0000148006 00000 n 0000148139 00000 n 0000148456 00000 n 0000148589 00000 n 0000148906 00000 n 0000149039 00000 n 0000149356 00000 n 0000149489 00000 n 0000149804 00000 n 0000149937 00000 n 0000150252 00000 n 0000150385 00000 n 0000150702 00000 n 0000150835 00000 n 0000151152 00000 n 0000151285 00000 n 0000151602 00000 n 0000151735 00000 n 0000152052 00000 n 0000152185 00000 n 0000152502 00000 n 0000152635 00000 n 0000152952 00000 n 0000153085 00000 n 0000153402 00000 n 0000153535 00000 n 0000153852 00000 n 0000153985 00000 n 0000154300 00000 n 0000154433 00000 n 0000154750 00000 n 0000154883 00000 n 0000155198 00000 n 0000155331 00000 n 0000155645 00000 n 0000155778 00000 n 0000156095 00000 n 0000156228 00000 n 0000156545 00000 n 0000156678 00000 n 0000156992 00000 n 0000157125 00000 n 0000157442 00000 n 0000157575 00000 n 0000157890 00000 n 0000158023 00000 n 0000158340 00000 n 0000158473 00000 n 0000158790 00000 n 0000158923 00000 n 0000159240 00000 n 0000159373 00000 n 0000159690 00000 n 0000159823 00000 n 0000160140 00000 n 0000160273 00000 n 0000160590 00000 n 0000160723 00000 n 0000161040 00000 n 0000161173 00000 n 0000161490 00000 n 0000161623 00000 n 0000161940 00000 n 0000162073 00000 n 0000162390 00000 n 0000162523 00000 n 0000162840 00000 n 0000162973 00000 n 0000163290 00000 n 0000163423 00000 n 0000163739 00000 n 0000163872 00000 n 0000164189 00000 n 0000164322 00000 n 0000164639 00000 n 0000164772 00000 n 0000165088 00000 n 0000165221 00000 n 0000165538 00000 n 0000165671 00000 n 0000165987 00000 n 0000166120 00000 n 0000166437 00000 n 0000166570 00000 n 0000166887 00000 n 0000167020 00000 n 0000167336 00000 n 0000167469 00000 n 0000167786 00000 n 0000207670 00000 n 0000207697 00000 n 0000198725 00000 n 0000198752 00000 n 0000192584 00000 n 0000192611 00000 n 0000184109 00000 n 0000176909 00000 n 0000169602 00000 n 0000169855 00000 n 0000177162 00000 n 0000184365 00000 n 0000192986 00000 n 0000193256 00000 n 0000193326 00000 n 0000193596 00000 n 0000193697 00000 n 0000199288 00000 n 0000199783 00000 n 0000199853 00000 n 0000200120 00000 n 0000200233 00000 n 0000208225 00000 n 0000208691 00000 n 0000208761 00000 n 0000209031 00000 n 0000209147 00000 n 0000276389 00000 n 0000237131 00000 n 0000237195 00000 n 0000241621 00000 n 0000276325 00000 n 0000250788 00000 n 0000250852 00000 n 0000250969 00000 n 0000251086 00000 n 0000251203 00000 n 0000251320 00000 n 0000251437 00000 n 0000251554 00000 n 0000251671 00000 n 0000251788 00000 n 0000251905 00000 n 0000252022 00000 n 0000252139 00000 n 0000252256 00000 n 0000252373 00000 n 0000252490 00000 n 0000252607 00000 n 0000252724 00000 n 0000252841 00000 n 0000252958 00000 n 0000253075 00000 n 0000253192 00000 n 0000253309 00000 n 0000253426 00000 n 0000253543 00000 n 0000253660 00000 n 0000253777 00000 n 0000253894 00000 n 0000254011 00000 n 0000254128 00000 n 0000254245 00000 n 0000254362 00000 n 0000254479 00000 n 0000254596 00000 n 0000254713 00000 n 0000254830 00000 n 0000254947 00000 n 0000255064 00000 n 0000255181 00000 n 0000255298 00000 n 0000255415 00000 n 0000255532 00000 n 0000255649 00000 n 0000255766 00000 n 0000255883 00000 n 0000256000 00000 n 0000275874 00000 n 0000275426 00000 n 0000274979 00000 n 0000274530 00000 n 0000274081 00000 n 0000273633 00000 n 0000273185 00000 n 0000272736 00000 n 0000272287 00000 n 0000271839 00000 n 0000271389 00000 n 0000270940 00000 n 0000270491 00000 n 0000270041 00000 n 0000269591 00000 n 0000269141 00000 n 0000268691 00000 n 0000268241 00000 n 0000267792 00000 n 0000267345 00000 n 0000266896 00000 n 0000266449 00000 n 0000266000 00000 n 0000265552 00000 n 0000265105 00000 n 0000264656 00000 n 0000264208 00000 n 0000263758 00000 n 0000263308 00000 n 0000262858 00000 n 0000262410 00000 n 0000261962 00000 n 0000261514 00000 n 0000261066 00000 n 0000260617 00000 n 0000260167 00000 n 0000259716 00000 n 0000259265 00000 n 0000258815 00000 n 0000258364 00000 n 0000257914 00000 n 0000257464 00000 n 0000257014 00000 n 0000256565 00000 n 0000256117 00000 n 0000256172 00000 n 0000256487 00000 n 0000256620 00000 n 0000256936 00000 n 0000257069 00000 n 0000257386 00000 n 0000257519 00000 n 0000257836 00000 n 0000257969 00000 n 0000258286 00000 n 0000258419 00000 n 0000258737 00000 n 0000258870 00000 n 0000259187 00000 n 0000259320 00000 n 0000259638 00000 n 0000259771 00000 n 0000260089 00000 n 0000260222 00000 n 0000260539 00000 n 0000260672 00000 n 0000260988 00000 n 0000261121 00000 n 0000261436 00000 n 0000261569 00000 n 0000261884 00000 n 0000262017 00000 n 0000262332 00000 n 0000262465 00000 n 0000262780 00000 n 0000262913 00000 n 0000263230 00000 n 0000263363 00000 n 0000263680 00000 n 0000263813 00000 n 0000264130 00000 n 0000264263 00000 n 0000264578 00000 n 0000264711 00000 n 0000265027 00000 n 0000265160 00000 n 0000265474 00000 n 0000265607 00000 n 0000265922 00000 n 0000266055 00000 n 0000266371 00000 n 0000266504 00000 n 0000266818 00000 n 0000266951 00000 n 0000267267 00000 n 0000267400 00000 n 0000267714 00000 n 0000267847 00000 n 0000268163 00000 n 0000268296 00000 n 0000268613 00000 n 0000268746 00000 n 0000269063 00000 n 0000269196 00000 n 0000269513 00000 n 0000269646 00000 n 0000269963 00000 n 0000270096 00000 n 0000270413 00000 n 0000270546 00000 n 0000270862 00000 n 0000270995 00000 n 0000271311 00000 n 0000271444 00000 n 0000271761 00000 n 0000271894 00000 n 0000272209 00000 n 0000272342 00000 n 0000272658 00000 n 0000272791 00000 n 0000273107 00000 n 0000273240 00000 n 0000273555 00000 n 0000273688 00000 n 0000274003 00000 n 0000274136 00000 n 0000274452 00000 n 0000274585 00000 n 0000274901 00000 n 0000275034 00000 n 0000275348 00000 n 0000275481 00000 n 0000275796 00000 n 0000275929 00000 n 0000276247 00000 n 0000276601 00000 n 0000276722 00000 n 0000276869 00000 n 0000277374 00000 n 0000277630 00000 n 0000937537 00000 n trailer <<76F48FDD2A2B402493EC20F5E8AE2BA1>]>> startxref 937778 %%EOF